|
|
Prepublished online as a Blood First Edition Paper on December 27, 2002; DOI 10.1182/blood-2002-07-2301.
 Previous Article | Table of Contents | Next Article 
Blood, 1 May 2003, Vol. 101, No. 9, pp. 3615-3621
NEOPLASIA
Transactivation of the fucosyltransferase VII gene by human
T-cell leukemia virus type 1 Tax through a variant cAMP-responsive
element
Nozomu Hiraiwa,
Tomonori Yabuta,
Keijiro Yoritomi,
Miki Hiraiwa,
Yuetsu Tanaka,
Takeshi Suzuki,
Mitsuaki Yoshida, and
Reiji Kannagi
From the Division of Molecular Pathology, Aichi Cancer
Center, Chikusa-ku, Nagoya; Department of Infectious Disease and
Immunology, Faculty of Medicine, Okinawa-Asia Research Center of
Medical Science, University of the Ryukyus, Nishihara; and Department
of Cellular and Molecular Biology, The Institute of Medical Science,
University of Tokyo, Shirokanedai, Minato-ku, Japan.
Human T-cell leukemic virus type 1 (HTLV-1)-infected T cells
express the fucosyltransferase (Fuc-T) VII
gene involved in the biosynthesis of the leukocyte sialyl Lewis
X, which may be related to tissue infiltration in patients with
malignant adult T-cell leukemia. HTLV-1 induces Fuc-T VII
transcription through the viral transactivator Tax, although the
underlying molecular mechanism remains unknown. In the present study,
we analyzed the role of the cis-activating element in Tax
activation using reporter constructs bearing the 5'-regulatory region
of Fuc-T VII in Jurkat T cells. A sequence
(GGCTGTGGGGGCGTCATATTGCCCTGG) covering a half-palindromic cyclic
adenosine monophosphate (cAMP)-responsive element (CRE) was found to
be required for Tax activation of the Fuc-T VII promoter. We further demonstrated that transcription factors of the CRE-binding protein (CREB)/activating transcription factor (ATF) family bind to
this CRE-like sequence and that Tax binds in association with CREB and
the coactivator CREB-binding protein (CBP) in Jurkat T cells. This
element, containing the G+C-rich flanking sequences, is homologous to
the Tax-responsive viral CREs in the HTLV-1 long terminal repeat
(LTR)-promoter. Furthermore, CREM , an isoform of CREB deficient
in the glutamine-rich domains, was found to activate the Fuc-T
VII promoter in a phosphorylation-independent manner, similar to
the viral CRE in HTLV-1 LTR but in contrast to the
phosphorylation-dependent activation of the cellular CREs by Tax. These
findings indicate that the Fuc-T VII promoter is transactivated by Tax in concert with CBP through a CRE-like sequence in a manner similar to that of viral CRE in HTLV-1 LTR.
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
K. Nystrom, R. Norden, I. Muylaert, P. Elias, G. Larson, and S. Olofsson
Induction of sialyl-Lex expression by herpes simplex virus type 1 is dependent on viral immediate early RNA-activated transcription of host fucosyltransferase genes
Glycobiology,
August 1, 2009;
19(8):
847 - 859.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Norden, K. Nystrom, and S. Olofsson
Activation of host antiviral RNA-sensing factors necessary for herpes simplex virus type 1-activated transcription of host cell fucosyltransferase genes FUT3, FUT5, and FUT6 and subsequent expression of sLex in virus-infected cells
Glycobiology,
July 1, 2009;
19(7):
776 - 788.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G.-Y. Chen, K. Sakuma, and R. Kannagi
Significance of NF-{kappa}B/GATA Axis in Tumor Necrosis Factor-{alpha}-induced Expression of 6-Sulfated Cell Recognition Glycans in Human T-lymphocytes
J. Biol. Chem.,
December 12, 2008;
283(50):
34563 - 34570.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Nystrom, A. Grahn, M. Lindh, M. Brytting, U. Mandel, G. Larson, and S. Olofsson
Virus-induced transcriptional activation of host FUT genes associated with neo-expression of Ley in cytomegalovirus-infected and sialyl-Lex in varicella-zoster virus-infected diploid human cells
Glycobiology,
April 1, 2007;
17(4):
355 - 366.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G.-Y. Chen, H. Osada, L. F. Santamaria-Babi, and R. Kannagi
Interaction of GATA-3/T-bet transcription factors regulates expression of sialyl Lewis X homing receptors on Th1/Th2 lymphocytes
PNAS,
November 7, 2006;
103(45):
16894 - 16899.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M.-X. Guo, D. Wang, H.-J. Shao, H.-L. Qiu, L. Xue, Z.-Z. Zhao, C.-G. Zhu, Y.-B. Shi, and W.-X. Li
Transcription of Human Zinc Finger ZNF268 Gene Requires an Intragenic Promoter Element
J. Biol. Chem.,
August 25, 2006;
281(34):
24623 - 24636.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Ohmori, F. Fukui, M. Kiso, T. Imai, O. Yoshie, H. Hasegawa, K. Matsushima, and R. Kannagi
Identification of cutaneous lymphocyte-associated antigen as sialyl 6-sulfo Lewis X, a selectin ligand expressed on a subset of skin-homing helper memory T cells
Blood,
April 15, 2006;
107(8):
3197 - 3204.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Kikuchi, H. Shinohara, C. Nonomura, H. Ando, S. Takaku, H. Nojiri, and M. Nakamura
Not core 2 {beta}1,6-N-acetylglucosaminyltransferase-2 or -3 but -1 regulates sialyl-Lewis x expression in human precursor B cells
Glycobiology,
March 1, 2005;
15(3):
271 - 280.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. K. Patnaik, B. Potvin, and P. Stanley
LEC12 and LEC29 Gain-of-Function Chinese Hamster Ovary Mutants Reveal Mechanisms for Regulating VIM-2 Antigen Synthesis and E-selectin Binding
J. Biol. Chem.,
November 26, 2004;
279(48):
49716 - 49726.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. Markine-Goriaynoff, L. Gillet, J. L. Van Etten, H. Korres, N. Verma, and A. Vanderplasschen
Glycosyltransferases encoded by viruses
J. Gen. Virol.,
October 1, 2004;
85(10):
2741 - 2754.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. D. Dodon, Z. Li, S. Hamaia, and L. Gazzolo
Tax protein of human T-cell leukaemia virus type 1 induces interleukin 17 gene expression in T cells
J. Gen. Virol.,
July 1, 2004;
85(7):
1921 - 1932.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Koike, N. Kimura, K. Miyazaki, T. Yabuta, K. Kumamoto, S. Takenoshita, J. Chen, M. Kobayashi, M. Hosokawa, A. Taniguchi, et al.
Hypoxia induces adhesion molecules on cancer cells: A missing link between Warburg effect and induction of selectin-ligand carbohydrates
PNAS,
May 25, 2004;
101(21):
8132 - 8137.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
