|
|
 Previous Article | Table of Contents | Next Article 
Mechanism of the chromosomal translocation t(14;18) in lymphoma: detection
of a 45-Kd breakpoint binding protein
U Jaeger, B Purtscher, GD Karth, S Knapp, C Mannhalter and K Lechner
Department of Internal Medicine I, University of Vienna, Austria.
The translocation t(14;18) between the BCL-2 oncogene and the Ig heavy
chain (IgH) gene provides the molecular basis for the development of
follicular lymphomas. The illegitimate recombination occurs in early B
cells. While V(D)J-recombinase is most likely involved on the chromosome 14
part, little is known about the mechanism of breakage on chromosome 18. We
investigated the BCL-2 breakpoint regions for their structural
vulnerability and protein binding capacity. We found that the major
breakpoint region (mbr) contains an S1 nuclease-sensitive site and is the
target of an endogenous nuclease present in early B cells. A 45 Kd nuclear
protein (bp45) from early B cell extracts binds to a
homopurine-homopyrimidine stretch (GGGAGGACGGGAGGAAGGCG) in the mbr, which
is homologous to a recombinatorial element in Escherichia coli (CHI). The
protein also binds to homologous sequences in the minor breakpoint cluster
region (mcr) and in the IgH locus. The localization of the binding sites on
both chromosomes as well as the tissue distribution of bp45 suggest that
this protein-DNA interaction is involved in the translocation t(14;18). The
DNA binding motif is also present at other translocation breakpoints
indicating a more general role for this mechanism.
Volume 81,
Issue 7,
pp. 1833-1840,
04/01/1993
Copyright © 1993 by The American Society of Hematology
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
G. S. Lee, M. B. Neiditch, R. R. Sinden, and D. B. Roth
Targeted Transposition by the V(D)J Recombinase
Mol. Cell. Biol.,
April 1, 2002;
22(7):
2068 - 2077.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Marculescu, T. Le, P. Simon, U. Jaeger, and B. Nadel
V(D)J-mediated Translocations in Lymphoid Neoplasms: A Functional Assessment of Genomic Instability by Cryptic Sites
J. Exp. Med.,
January 7, 2002;
195(1):
85 - 98.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. B. Callanan, P. Le Baccon, P. Mossuz, S. Duley, C. Bastard, R. Hamoudi, M. J. Dyer, G. Klobeck, R. Rimokh, J. J. Sotto, et al.
The IgG Fc receptor, Fcgamma RIIB, is a target for deregulation by chromosomal translocation in malignant lymphoma
PNAS,
January 4, 2000;
97(1):
309 - 314.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. J. Vanasse, P. Concannon, and D. M. Willerford
Regulated Genomic Instability and Neoplasia in the Lymphoid Lineage
Blood,
December 15, 1999;
94(12):
3997 - 4010.
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. L. Wiemels and M. Greaves
Structure and Possible Mechanisms of TEL-AML1 Gene Fusions in Childhood Acute Lymphoblastic Leukemia
Cancer Res.,
August 1, 1999;
59(16):
4075 - 4082.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
