Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
Prepublished online as a Blood First Edition Paper on April 17, 2002; DOI 10.1182/blood-2002-01-0320.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2002-01-0320v1
100/1/306    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wagner, F. F.
Right arrow Articles by Flegel, W. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wagner, F. F.
Right arrow Articles by Flegel, W. A.
Related Collections
Right arrow Red Cells
Right arrow Transfusion Medicine
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, 1 July 2002, Vol. 100, No. 1, pp. 306-311

TRANSFUSION MEDICINE

The DAU allele cluster of the RHD gene

Franz F. Wagner, Birgit Ladewig, Katharina S. Angert, Guido A. Heymann, Nicole I. Eicher, and Willy A. Flegel

From the Abteilung Transfusionsmedizin, Universitätsklinikum Ulm and DRK Blutspendedienst Baden-Württemberg-Hessen, Institut Ulm, Ulm, Germany; Biotest AG, Dreieich, Germany; Abteilung Transfusionsmedizin, Universitätsklinikum Aachen, Germany; Institut für Transfusionsmedizin, Charité, Berlin, Germany; and Blutspendedienst SRK Bern, Bern, Switzerland.


    Abstract
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Variant D occurs frequently in Africans. However, considerably less RHD alleles have been described in this population compared with Europeans. We characterized 5 new RHD alleles, dubbed DAU-0 to DAU-4, that shared a T379M substitution and occurred in a cDe haplotype. DAU-1 to DAU-4 were detected in Africans with partial D phenotypes. They harbored one and 2 additional missense mutations, respectively, dispersed throughout the RhD protein. An anti-D immunization was found in DAU-3. DAU-0 carrying T379M only was detected by screening European blood donors and expressed a normal D phenotype. Within the phylogeny of the RHD alleles, DAU formed an independent allele cluster, separate from the DIVa, weak D type 4, and Eurasian D clusters. The characterization of the RH phylogeny provided a framework for future studies on RH alleles. The identification of the DAU alleles increased the number of known partial D alleles in Africans considerably. DAU alleles may be a major cause of antigen D variability and anti-D immunization in patients of African descent. (Blood. 2002;100:306-311)

© 2002 by The American Society of Hematology.

    Introduction
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

The D antigen of the RH blood group (ISBT 004.001; RH1; CD240D; "Rhesus D") is the most important blood group antigen determined by a protein, because D-negative individuals are easily anti-D immunized.1 This antibody remains the leading cause for the hemolytic disease of the newborn,2,3 and antigen D-compatible transfusion is standard in modern transfusion therapy.

D-positive individuals harboring a "partial" D antigen may produce an allo-anti-D, too. Among Europeans, the population frequency of all known partial D phenotypes combined is less than 1%.4,5 The molecular basis is generally a gene conversion, in which parts of the RHD gene were substituted by the respective segments of the RHCE gene, and single missense mutations.6 The molecular characterization of aberrant RHD alleles was much facilitated in Europeans by the frequent occurrence of the RHD gene deletion.7,8 Transfusion strategies were devised to ensure D-negative transfusion in carriers of D category VI, which was known to be the clinically most relevant partial D occurring in Europeans.9

The situation is more intricate in Africans: The occurrence of aberrant RHD alleles and anti-D immunizations in D-positive individuals is much more frequent than in Europeans.10 The serologic testing is confounded by frequent "African" alleles that almost defy serologic recognition, like D category III types.11 Molecular analysis revealed that there are often multiple missense mutations, rather than single ones.12 The molecular characterization of RHD alleles was hampered in Africans by the frequent occurrence of RHDpsi ,13 Ccdes,14 or the concomitant presence of 2 different partial D alleles. RHDpsi and Ccdes do not express a D antigen, yet they harbor a grossly intact RHD allele or an RHD-CE-D hybrid allele, respectively, that often interferes with RHD polymerase chain reaction (PCR) and RHD-specific sequencing.

We described 5 RHD alleles that shared a T379M substitution. Four of these alleles expressed a partial D phenotype characterized by the lack of distinct D epitopes or by an anti-D immunization event. We provide a detailed RHD phylogeny in which the DAU alleles formed a previously unknown cluster.


    Materials and methods
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Blood samples

There were 6 ethylenediaminetetraacetic acid (EDTA)-anticoagulated blood samples referred to our laboratory for problems with D typing or anti-D production in a D-positive individual (sample RIR no. 38 of the Rhesus Immunization Registry, accessible at http://www.uni-ulm.de/~wflegel/RIR). In addition, EDTA-anticoagulated blood samples were collected from blood donors of ccDee phenotype in Baden-Württemberg, Germany. DNA was isolated using QiaAmp blood kit (Qiagen, Hilden, Germany) or by a modified salting-out procedure.15 In addition, 2 DNA samples with rare RhCE phenotypes typically occurring in Africans (95-012: hrs- and 95-013: Rh: -34) were obtained from the serum, cells, and fluid exchange (SCARF).

Sequencing of the 10 RHD exons from genomic DNA

Nucleotide sequencing of the 10 RHD exons was performed as previously described.16-18 The standard PCR for RHD exon 2 amplification failed with some alleles belonging to the DIVa cluster (eg, in sample 95-013); in such samples RH exon 2 was amplified using primers re12c and re2317 and sequenced in a RHD-specific manner using primer re17. Primer sequences were re12c, attagccgggcacggtggtg; and re17, ctcgtctgcttcctcctcg.

Polymerase chain reaction with sequence-specific priming

A PCR with sequence-specific priming (PCR-SSP) was devised to detect or to confirm the 1136 C > T substitution in the DAU alleles and triggered to work under similar PCR conditions as a PCR-SSP system previously developed for RHD typing.18,19 The positive control was a 434-base-pair (bp) PCR fragment of the human growth hormone gene. Specific primers dau1b and daub as well as control primers were used at concentrations of 1 µM. Amplifications were carried out with Taq (Qiagen) in a final volume of 10 µL. Primer sequences were dau1b, ttggccatcgtgatagctcacat; and daub, ggagatggggcacatagacatc.

Population screen for DAU

To screen for DAU alleles among Europeans, 194 random ccDee donations were screened for the 1136 C > T substitution by PCR-SSP. The presence of a DAU allele was confirmed by sequencing of RHD exon 8. The DAU type was determined by sequencing the 10 RHD exons from genomic DNA. DAU allele frequencies were calculated based on phenotype and haplotype frequencies previously determined for the local donor population.9

Antigen density and Rhesus index

Flow cytometric determination of antigen density and Rhesus index was performed as described previously.16,20 The secondary antibody was goat anti-human IgG, Fab-fragment, fluorescein isothiocyanate (FITC)-conjugated (Jackson Immunoresearch, supplied by Dianova, Hamburg, Germany). For the DAU-3 sample, which had a positive direct agglutination test, the background fluorescence was determined by incubating the sample with secondary antibody only. Monoclonal anti-D antibodies were provided by the 3rd International Workshop on Monoclonal Antibodies against Human Red Blood Cells and Related Antigens.21 The following IgG anti-D antibodies were used as primary antibodies: D-89/47 (workshop no. III-1-29); HG/92 (III-30); D-90/7 (III-31); D-90/17 (III-32); D-90/12 (III-33); 17010C9 (III-36); AUB-2F7/Fiss (III-41); LOR11-2D9 (III-43); LOR12-E2 (III-44); LOR17-6C7 (III-45); LOR17-8D3 (III-46); LOR28-21D3 (III-47); LOR28-7E6 (III-48); LOR29-F7 (III-49); LORA (III-50); LORE (III-51); NAU3-2E8 (III-53); NAU6-4D5 (III-55); NOI (III-56); SAL17-4E8 (III-58); SAL20-12D5 (III-59); SALSA-12 (III-60); 822 (III-68); BTSN4 (III-71); BTSN6 (III-72); BTSN10 (III-73); LHM76/58 (III-74); LHM76/55 (III-75); LHM76/59 (III-76); LHM77/64 (III-77); LHM59/19 (III-78); LHM50/2B (III-80); LHM169/80 (III-81); LHM169/81 (III-82); C205-29 (III-88); CLAS1-126 (III-89); F5S (III-90); H2D5D2F5 (III-93); RAB.B15 (III-94); BIRMA-DG3 (III-95); BIRMA-D6 (III-96); BIRMA-D56 (III-97); P3G6 (III-101); P3AF6 (III-102); BRAD3 (III-105); L87.1G7 (III-108); MS26 (III-112); D10 (III-114); HIRO-3 (III-117); HIRO-4 (III-118); ID6-H8 (III-119); HIRO-7 (III-120); HIRO-8 (III-121); HIRO-2 (III-122); D6DO2 (III-123); and MCAD-6 (III-124).

Epitope patterns

Agglutination was tested in a gel matrix test (LISS-Coombs 37°C, DiaMed-ID Micro Typing System; DiaMed, Cressier sur Morat, Switzerland) using the following antibodies in addition to those tested in flow cytometry: B9A4B2 (workshop no. III-1-28); HeM-92 (III-34); 175-2 (III-35); NaTH28-3C11 (III-37); NaTH87-4A5 (III-38); NaTH53-2A7 (III-39); CAZ7-4C5 (III-42); MAR-1F8 (III-52); NAU6-1G6 (III-54); NOU (III-57); VOL-3F6 (III-61); ZIG-189 (III-62); 819 (III-69); LHM70/45 (III-79); LHM174/102 (III-83); LHM50/3.5 (III-84); LHM59/25 (III-85); LHM59/20 (III-86); T3D2F7 (III-87); P3187 (III-98); P3F17 (III-99); P3F20 (III-100); MS201 (III-113); HIRO-1 (III-115); HIRO-6 (III-116); HS114 (III-134); and BS87 (III-180).

Routine D typing

Reactions of the DAU phenotypes in routine D-typing conditions were established using commercial anti-D BS226 (Biotest, Dreieich, Germany), BS232 (Biotest), RUM1 (Immucor, Norcross, GA), and D14E11 (Immucor) in tube technique. In addition, P3×61 (Diagast, Loos, France) was tested in a gel matrix test.

Phylogeny of RHD alleles

A possible phylogenetic tree for RHD alleles was developed which was based on the RHD coding sequence and the presence of a C or E allele. Nucleotide substitutions, gene conversions, recombinations, and mutations in the accompanying RHCE alleles were counted as equivalent single events. The tree was devised manually to minimize the required number of events. Within RHCE, only standard C alleles caused by the gene conversion around exon 222 were counted as C positive. Because of insufficient data, further intricacies of RHCE alleles like the 16 Trp/Cys, 245 Leu/Val, and 336 Gly/Cys polymorphisms were disregarded. Sequences from chimpanzee (Pan troglodytes Rh-like protein IIR, nucleic acid accession number L3705023) were used for external rooting. The RHD alleles shown in the phylogeny tree were published previously13,14,16-18,24-31 or described in this study for DAU-0 to DAU-4 and DIII type 5.

Nomenclature

The name DAU derived from "D of African origin" (in German: D afrikanischen Ursprungs) and is pronounced like in "now."


    Results
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

DAU alleles

There were 5 RHD alleles identified (Table 1). These alleles constituted a cluster, because they shared a 1136C > T single nucleotide polymorphism (SNP) causing a T379M substitution. T379M only was found in DAU-0 which represented the primordial allele of the DAU allele cluster. The other 4 DAU alleles harbored one or 2 additional substitutions dispersed in the various segments of the protein (Figure 1).

                              
View this table:
[in this window]
[in a new window]
 
Table 1. RHD alleles described in this study



View larger version (49K):
[in this window]
[in a new window]
 
Figure 1. Schematic representation of the RhD proteins observed in the 5 DAU phenotypes. All DAU types share a T379M substitution (black disk) that is located in the twelfth transmembrane protein segment. DAU-1 to DAU-4 have additional substitutions: the S230I substitution of DAU-1 and the E233Q substitution of DAU-4 are both located in exofacial loop 4; the R70Q and S333N substitutions of DAU-2 position near the border of intramembrane and intracellular protein segments; the V279M substitution of DAU-3 locates at an intramembraneous protein segment proximate to exofacial loop 5.

Population frequencies

DAU-1 to DAU-4 samples were referred to our laboratory because of typing problems or, in the case of DAU-3 (sample RIR no. 38), of an anti-D immunization. All probands carrying these alleles were, if known, of African descent (Table 1). To determine the possible presence of such alleles in Europeans, we screened for the common 1136C > T SNP by PCR-SSP (Figure 2). Among 194 random samples of ccDee phenotype, 3 samples (1.5%) were positive for the 1136C > T SNP. These samples, however, lacked any additional SNP in the coding sequence and represented DAU-0. The haplotype frequency of the cDe haplotype with DAU-0 was 1:3159 (95% confidence interval: 1:1170-1:11 587). The frequency of the DAU-0 phenotype in the German population was calculated to be 1:3843. All 4 other DAU alleles were infrequent in whites (cumulative frequency < 1:3164, upper limit of 95% confidence interval according to the Poisson distribution).


View larger version (39K):
[in this window]
[in a new window]
 
Figure 2. Specific detection of the T379M substitution by PCR-SSP. A PCR-SSP was devised that amplified a specific 140-bp product from the aberrant RHD exon 8 in all DAU alleles tested (lane 1: DAU-0; lane 2: DAU-1; lane 3: DAU-2; lane 4: DAU-3; lane 5: DAU-4). In a normal D-positive sample (lane 6), only the 434-bp control product deriving from the human growth hormone gene is amplified.

Phenotypes of DAU alleles

Antigen density and Rhesus index. As previously noted for weak D samples,16 there was no simple relation of the type of substitution (Figure 1) to the antigen density or to the Rhesus index (Table 2). Both the antigen density and the Rhesus index of the DAU-0 phenotype were about normal, rendering it indistinguishable from the normal antigen D-positive phenotype. However, the extracellular substitutions in the DAU-1 and DAU-4 phenotypes correlated well with their much diminished Rhesus index, which is typical for partial D. The DAU-2 with its low antigen density was reminiscent of weak D because its 2 unique substitutions were located at the inner boundary of the red cell membrane. The Rhesus index of DAU-3 indicated its propensity to anti-D immunization, while its antigen D density at the lower end of the normal range would render DAU-3 carriers being transfused with D-positive blood units.

                              
View this table:
[in this window]
[in a new window]
 
Table 2. Antigen D density and Rhesus D similarity index

Epitope patterns. The D epitope patterns of the DAU phenotypes were distinct (Table 3). Despite DAU-1 having a much higher antigen density than DAU-2, more anti-D antibodies agglutinated DAU-2 than DAU-1 red blood cells. The profile of DAU-4 was almost identical to that reported for DHK,32 alias DYO,33 which shared the E233K substitution. DAU-0 had a normal D-positive epitope pattern.

                              
View this table:
[in this window]
[in a new window]
 
Table 3. Reactivity patterns of antibodies with DAU samples

Routine D-typing issues. Applying routine methods for D typing,34 DAU-0 typed D positive, whereas DAU-1, DAU-2, and DAU-4 were not agglutinated by most commercial monoclonal IgM anti-D antibodies (Table 4). Hence, DAU-1, DAU-2, and DAU-4 would usually be typed as D-negative, triggering D-negative transfusions, which is the clinically favored management.

                              
View this table:
[in this window]
[in a new window]
 
Table 4. DAU phenotypes in routine D typing

DIII type 5

Sequencing of DNA sample 95-013 revealed 6 nucleotide substitutions, 186G > T, 410C > T, 455A > C, 692C > G, 667T > G, 819G > A. This result predicted the homozygous or hemizygous presence of an RHD (L62F, A137V, N152T, T201R, F223V) allele that was dubbed DIII type 5, because of its similarity to the molecular structure described for mditDIIIa.12

Phylogeny of RHD alleles in humans

Based on the molecular structure of the DAU alleles, the phylogenetic models35,36 of the RHD alleles were extended (Figure 3). The DAU alleles, which were characterized by a cDe haplotype and a T379M substitution, formed a separate cluster of RHD alleles. There were 2 other allele clusters also associated with the cDe haplotype: the weak D type 4 cluster was characterized by a common F223V substitution. The DIVa cluster comprising DIII type 4, DIVa, Ccdes, and DIII type 5 was characterized by a common N152T substitution. In addition, DIII type 4 and type 5 as well as all DIVa24 and Ccdes14,37 samples investigated by us carried L62F and A137V. The remaining RHD alleles could be derived from the RHD allele prevalent in Eurasians by a single event (point mutation, gene conversion, or deletion) and formed the Eurasian D cluster.


View larger version (43K):
[in this window]
[in a new window]
 
Figure 3. Phylogeny of RHD in humans. A phylogenetic tree of RHD is shown for most "African" alleles and representative "Eurasian" alleles. There are 4 main clusters that may be discerned. The DIVa cluster encompasses the DIVa, DIII type 4, and Ccdes alleles. Most samples harboring these alleles share 3 characteristic amino acids (62F, 137V, 152T) that are ancestral, because they are also observed in chimpanzee RH (Pan troglodytes Rh-like protein IIR). The weak D type 4 cluster encompasses DAR, DOL, and RHDPsi , too. For this cluster, the RHD (F223V) allele is postulated36 but has yet to be shown extant. DIII type 5, a new RHD allele resembling DIIIa, evolved by a recombination between alleles of the DIVa and the weak D type 4 clusters. For the DAU cluster, its primitive type DAU-0 has been found and was shown to be the most frequent DAU allele in Europeans. All enumerated alleles occurred in a cDe haplotype and were predominantly observed in Africans. In contrast, most other RHD alleles were typical for Eurasians, derived from standard Eurasian RHD by a single event, occurred in a CDe or cDE haplotype, and formed the Eurasian D cluster. The tree was mainly based on RHD allelic variability, and dismisses the largely unknown RHCE variability beyond the C and E polymorphism. For each evolutionary step, the event is indicated; the depicted distances of the alleles are arbitrary.


    Discussion
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

We found 5 RHD alleles that shared a T379M missense mutation and formed a previously unknown cluster. There were 4 of these alleles that had one or 2 additional mutations and were observed in individuals of African descent. The fifth allele, RHD (T379M), was detected in Europeans by screening blood donors. DAU alleles may be a major cause of antigen D variability and anti-D immunization in patients of African descent.

Anti-D immunization in transfusion recipients and pregnant women harboring "African" partial D is a continuing problem. For example, 11% of anti-D in pregnancies in the Cape Town area, South Africa, occurred in D-positive women.10 Current D-typing strategies are tuned to detect partial D phenotypes that are typical for white populations.9,34 Although carriers of partial D are more frequent in African populations,25 more than 25 partial D alleles are predominantly observed in Europeans and to date only 5 partial D alleles were typical for Africans.12,16,24-26 Thus, the identification of the DAU cluster increased the number of "African" partial D considerably. Because anti-D immunization may occur in carriers of DAU alleles, our molecular characterization is instrumental for evaluating the clinical relevance in transfusion recipients.

All of the more than 50 known aberrant RHD alleles expressed variant D antigens.6,36 Unexpectedly, DAU-0 encoded a normal phenotype despite its intramembraneous T379M substitution. DAU-0 may be the first example of a host of alleles harboring an amino acid substitution that does not affect their antigen D. The other 4 DAU phenotypes, however, had a low Rhesus index and qualify as partial D. The partial D phenotype was most obvious for DAU-3, in which an anti-D immunization was documented. If such immunizations were frequently occurring in populations with African admixture, the specific detection of the involved DAU alleles might be warranted.

A phylogeny model for the RH haplotypes was originally presented by Carritt et al35 in 1997 which explained the mechanisms shaping RH heterogeneity in Eurasian populations. More recently, these haplotypes were recognized to represent just one branch separated from 2 different clusters of RHD alleles that are primarily observed in African populations.36 Alleles of the DAU cluster added to this diversity and represented a third "African" cluster (Figure 3). Each of these 3 "African" allele clusters was characterized by a specific amino acid substitution relative to the "Eurasian" RHD allele: (1) T379M in the DAU cluster, (2) F223V in the weak D type 4 cluster, which included RHDPsi , DOL, and many alleles sharing F223V and T201R, and (3) N152T in the DIVa cluster, which included DIII type 4, DIVa, and Ccdes.

Recently, Rh-related proteins, including RhAG, have been shown to transport ammonia.38 It is tempting to speculate that amino acid substitutions located in transmembraneous Rh protein segments, like T379M in DAU, F223V and T201R in weak D type 4, and L245V and G336C in Ccdes, may affect the function of the Rh protein. Even a substitution that does not alter the D antigen, like T379M in DAU-0, may still be functionally effective. Malaria and other blood-borne diseases endemic in Africa may favor functional and antigenic variability, as exemplified by glucose-6-phosphate dehydrogenase deficiency39 and lack of Duffy protein expression in red cells,40 respectively. Similar processes might confer evolutionary advantages to carriers of aberrant RH alleles.

The RHD alleles of the 3 "African" clusters generally occurred in a cDe haplotype, which indicated that the cE and Ce alleles of RHCE evolved in the "Eurasian" branch after its divergence from the other branches. However, haplotypes of the "Eurasian" cluster represented a sizeable fraction of haplotypes extant in Africans. For example, the frequency of antigen E-encoding "Eurasian" haplotypes is 9.01% among Barotse in Zambia.41 In contrast, even the most frequent alleles of the "African" clusters are very rare among Europeans. This was shown for DAU-0 in the present study (population frequency of 1:3159) and previously determined for weak D type 4 (1:15 000).17 The knowledge of RH phylogeny is of practical importance because it defines the framework for determining the clinically relevant RH alleles in any population.

In populations without African admixture, including whites, Asians, Arabs, and probably American Indians, partial D phenotypes are likely to be rare and to derive from the limited and serologically well-characterized set of alleles of the Eurasian D cluster. For these populations, the current D-typing strategies applied in Europe9 appear to be appropriate and sufficient. Typing strategies for African populations and those with African admixture may take account of the various frequently occurring alleles of the "African" clusters. Several of these alleles characterized by multiple dispersed amino acid substitutions are difficult to discern by serologic means and may in the future warrant genotyping approaches for detection in patients and donors.


    Acknowledgments

We are greatly indebted to all contributors of the 3rd International Workshop on Monoclonal Antibodies against Human Red Blood Cells and Related Antigens in Nantes, France, 1996, who provided most other monoclonal anti-D antibodies. We thank John J. Moulds and Joann M. Moulds, Philadelphia, PA, for rare DNA samples from the SCARF Exchange program. We acknowledge the expert technical assistance of Marianne Lotsch, Anita Hacker, Sabine Kaiser, and Sabine Zahn.


    Footnotes

Submitted January 31, 2002; accepted March 1, 2002.

Prepublished online as Blood First Edition Paper, April 17, 2002; DOI 10.1182/blood-2002-01-0320.

Supported by the DRK-Blutspendedienst Baden-Württemberg-Hessen, Mannheim; by the University of Ulm (Forschungsförderungsprojekt P. 531); and by the Deutsche Gesellschaft für Transfusionsmedizin und Immunhämatologie (project DGTI/fle/00-01).

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: Willy A. Flegel, Abteilung Transfusionsmedizin, Universitätsklinikum Ulm, and DRK Blutspendedienst Baden-Württemberg-Hessen, Institut Ulm, Helmholtzstrasse 10, D-89081 Ulm, Germany; e-mail: waf{at}ucsd.edu.


    References
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

1. Urbaniak SJ, Robertson AE. A successful program of immunizing Rh-negative male volunteers for anti-D production using frozen/thawed blood. Transfusion. 1981;21:64-69[CrossRef][Medline] [Order article via Infotrieve].

2. Filbey D, Hanson U, Wesstrom G. The prevalence of red cell antibodies in pregnancy correlated to the outcome of the newborn: a 12 year study in central Sweden. Acta Obstet Gynecol Scand. 1995;74:687-692[Medline] [Order article via Infotrieve].

3. Bowman J. The management of hemolytic disease in the fetus and newborn. Semin Perinatol. 1997;21:39-44[CrossRef][Medline] [Order article via Infotrieve].

4. Flegel WA, Wagner FF. The frequency of RHD protein variants in Caucasians [abstract]. Transfus Clin Biol. 1996;3:10s.

5. Roubinet F, Apoil PA, Blancher A. Frequency of partial D phenotypes in the south western region of France. Transfus Clin Biol. 1996;3:247-255[CrossRef][Medline] [Order article via Infotrieve].

6. Avent ND, Reid ME. The Rh blood group system: a review. Blood. 2000;95:375-387[Abstract/Free Full Text].

7. Colin Y, Cherif-Zahar B, Le Van Kim C, Raynal V, van Huffel V, Cartron JP. Genetic basis of the RhD-positive and RhD-negative blood group polymorphism as determined by southern analysis. Blood. 1991;78:2747-2752[Abstract/Free Full Text].

8. Wagner FF, Flegel WA. RHD gene deletion occurred in the Rhesus box. Blood. 2000;95:3662-3668[Abstract/Free Full Text].

9. Wagner FF, Kasulke D, Kerowgan M, Flegel WA. Frequencies of the blood groups ABO, Rhesus, D category VI, Kell, and of clinically relevant high-frequency antigens in South-Western Germany. Infusionsther Transfusionsmed. 1995;22:285-290[Medline] [Order article via Infotrieve].

10. du Toit ED, Martell RW, Botha I, Kriel CJ. Anti-D antibodies in Rh-positive mothers. S Afr Med J. 1989;75:452[Medline] [Order article via Infotrieve].

11. Scott M. Rh serology---coordinator's report. Transfus Clin Biol. 1996;3:333-337[CrossRef][Medline] [Order article via Infotrieve].

12. Huang CH, Chen Y, Reid M. Human DIIIa erythrocytes: RhD protein is associated with multiple dispersed amino acid variations. Am J Hematol. 1997;55:139-145[CrossRef][Medline] [Order article via Infotrieve].

13. Singleton BK, Green CA, Avent ND, et al. The presence of an RHD pseudogene containing a 37 base pair duplication and a nonsense mutation in Africans with the Rh D-negative blood group phenotype. Blood. 2000;95:12-18[Abstract/Free Full Text].

14. Faas BHW, Becker EAM, Wildoer P, et al. Molecular background of VS and weak C expression in blacks. Transfusion. 1997;37:38-44[CrossRef][Medline] [Order article via Infotrieve].

15. Miller SA, Dykes DD, Polesky HF. A simple salting-out procedure for extracting DNA from human nucleated cells. Nucl Acids Res. 1988;16:1215[Free Full Text].

16. Wagner FF, Frohmajer A, Ladewig B, et al. Weak D alleles express distinct phenotypes. Blood. 2000;95:2699-2708[Abstract/Free Full Text].

17. Wagner FF, Gassner C, Müller TH, Schönitzer D, Schunter F, Flegel WA. Molecular basis of weak D phenotypes. Blood. 1999;93:385-393[Abstract/Free Full Text].

18. Wagner FF, Frohmajer A, Flegel WA. RHD positive haplotypes in D negative Europeans. BMC Genet. 2001;2:10[CrossRef][Medline] [Order article via Infotrieve].

19. Gassner C, Schmarda A, Kilga-Nogler S, et al. RhesusD/CE typing by polymerase chain reaction using sequence-specific primers. Transfusion. 1997;37:1020-1026[CrossRef][Medline] [Order article via Infotrieve].

20. Flegel WA, Curin-Serbec V, Delamaire M, et al. Rh flow cytometry---coordinator's report. Rhesus index and antigen density: an analysis of the reproducibility of flow cytometric determination. Transfus Clin Biol. 2002;9:33-42[CrossRef][Medline] [Order article via Infotrieve].

21. Rouger P, Muller J-Y. Third International Workshop and Symposium on Monoclonal Antibodies against Human Red Cells and Related Antigens: Section RH. Transfus Clin Biol. 1996;3:329-541[CrossRef][Medline] [Order article via Infotrieve].

22. Poulter M, Kemp TJ, Carritt B. DNA-based Rhesus typing: simultaneous determination of RHC and RHD status using the polymerase chain reaction. Vox Sang. 1996;7:164-168.

23. Salvignol I, Blancher A, Calvas P, et al. Molecular genetics of chimpanzee Rh-related genes: their relationship with the R-C-E-F blood group system, the chimpanzee counterpart of the human rhesus system. Biochem Genet. 1994;32:201-221[CrossRef][Medline] [Order article via Infotrieve].

24. Rouillac C, Colin Y, Hughes-Jones NC, et al. Transcript analysis of D category phenotypes predicts hybrid Rh D-CE-D proteins associated with alteration of D epitopes. Blood. 1995;85:2937-2944[Abstract/Free Full Text].

25. Hemker MB, Ligthart PC, Berger L, van Rhenen DJ, van der Schoot CE, Wijk PA. DAR, a new RhD variant involving exons 4, 5, and 7, often in linkage with ceAR, a new rhce variant frequently found in African blacks. Blood. 1999;94:4337-4342[Abstract/Free Full Text].

26. Avent ND, Poole J, Singleton BK, et al. Studies of two partial Ds: DMH and DOL [abstract]. Transfus Med. 1999;9:33.

27. Rouillac C, Le Van Kim C, Beolet M, Cartron JP, Colin Y. Leu110Pro substitution in the RhD polypeptide is responsible for the DVII category blood group phenotype. Am J Hematol. 1995;49:87-88[Medline] [Order article via Infotrieve].

28. Wagner FF, Gassner C, Müller TH, Schönitzer D, Schunter F, Flegel WA. Three molecular structures cause Rhesus D category VI phenotypes with distinct immunohematologic features. Blood. 1998;91:2157-2168[Abstract/Free Full Text].

29. Avent ND, Liu W, Jones JW, et al. Molecular analysis of Rh transcripts and polypeptides from individuals expressing the DVI variant phenotype: an RHD gene deletion event does not generate all DVIccEe phenotypes. Blood. 1997;89:1779-1786[Abstract/Free Full Text].

30. Jones JW, Finning KM, Mattock R, Voak D, Scott ML, Avent ND. The serological profile and molecular basis of a new partial D phenotype, DHR. Vox Sang. 1997;73:252-256[CrossRef][Medline] [Order article via Infotrieve].

31. Faas BHW, Beckers EAM, Simsek S, et al. Involvement of Ser103 of the Rh polypeptides in G epitope formation. Transfusion. 1996;36:506-511[CrossRef][Medline] [Order article via Infotrieve].

32. Omi T, Takahashi J, Tsudo N, et al. The genomic organization of the partial D category DVa: the presence of a new partial D associated with the DVa phenotype. Biochem Biophys Res Commun. 1999;254:786-794[CrossRef][Medline] [Order article via Infotrieve].

33. Hyodo H, Ishikawa Y, Kashiwase K, et al. Polymorphisms of RhDVa and a new RhDVa-like variant found in Japanese individuals. Vox Sang. 2000;78:122-125[CrossRef][Medline] [Order article via Infotrieve].

34. Wissenschaftlicher Beirat der Bundesärztekammer, Paul-Ehrlich-Institut. Richtlinien zur Gewinnung von Blut und Blutbestandteilen und zur Anwendung von Blutprodukten (Hämotherapie). Köln: Deutscher Ärzte-Verlag; 2000.

35. Carritt B, Kemp TJ, Poulter M. Evolution of the human RH (rhesus) blood group genes: a 50 year old prediction (partially) fulfilled. Hum Mol Genet. 1997;6:843-850[Abstract/Free Full Text].

36. Flegel WA, Wagner FF. Molecular genetics of RH. Vox Sang. 2000;78:109-115.

37. Daniels GL, Faas BH, Green CA, et al. The VS and V blood group polymorphisms in Africans: a serologic and molecular analysis. Transfusion. 1998;38:951-958[CrossRef][Medline] [Order article via Infotrieve].

38. Marini AM, Matassi G, Raynal V, et al. The human Rhesus-associated RhAG protein and a kidney homologue promote ammonium transport in yeast. Nat Genet. 2000;26:341-344[CrossRef][Medline] [Order article via Infotrieve].

39. Ruwende C, Khoo SC, Snow RW, et al. Natural selection of hemi- and heterozygotes for G6PD deficiency in Africa by resistance to severe malaria. Nature. 1995;376:246-249[CrossRef][Medline] [Order article via Infotrieve].

40. Miller LH, Mason SJ, Clyde DF, McGinniss MH. The resistance factor to Plasmodium vivax in blacks: the Duffy-blood-group genotype, FyFy. N Engl J Med. 1976;295:302-304[Abstract].

41. Mourant AE, Kopec AC, Domaniewska-Sobczak K. The distribution of the human blood groups and other polymorphisms. London United Kingdom: Oxford University Press; 1976.

42. Lomas C, McColl K, Tippett P. Further complexities of the Rh antigen D disclosed by testing category DII cells with monoclonal anti-D. Transfus Med. 1993;3:67-69[Medline] [Order article via Infotrieve].

© 2002 by The American Society of Hematology.
 

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
BloodHome page
D. J. Anstee
Red cell genotyping and the future of pretransfusion testing
Blood, July 9, 2009; 114(2): 248 - 256.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2002-01-0320v1
100/1/306    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wagner, F. F.
Right arrow Articles by Flegel, W. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wagner, F. F.
Right arrow Articles by Flegel, W. A.
Related Collections
Right arrow Red Cells
Right arrow Transfusion Medicine
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2002 by American Society of Hematology         Online ISSN: 1528-0020