Prepublished online as a Blood First Edition Paper on April 17, 2002; DOI 10.1182/blood-2002-01-0320.
 Previous Article | Table of Contents | Next Article 
Blood, 1 July 2002, Vol. 100, No. 1, pp. 306-311
TRANSFUSION MEDICINE
The DAU allele cluster of the RHD
gene
Franz F. Wagner,
Birgit Ladewig,
Katharina S. Angert,
Guido A. Heymann,
Nicole I. Eicher, and
Willy A. Flegel
From the Abteilung Transfusionsmedizin,
Universitätsklinikum Ulm and DRK Blutspendedienst
Baden-Württemberg-Hessen, Institut Ulm, Ulm, Germany;
Biotest AG, Dreieich, Germany; Abteilung
Transfusionsmedizin, Universitätsklinikum Aachen, Germany;
Institut für Transfusionsmedizin, Charité, Berlin, Germany;
and Blutspendedienst SRK Bern, Bern, Switzerland.
 |
Abstract |
Variant D occurs frequently in Africans. However, considerably less
RHD alleles have been described in this population compared with Europeans. We characterized 5 new RHD alleles, dubbed
DAU-0 to DAU-4, that shared a T379M
substitution and occurred in a cDe haplotype.
DAU-1 to DAU-4 were detected in Africans with
partial D phenotypes. They harbored one and 2 additional missense
mutations, respectively, dispersed throughout the RhD protein. An
anti-D immunization was found in DAU-3. DAU-0
carrying T379M only was detected by screening European blood donors and
expressed a normal D phenotype. Within the phylogeny of the
RHD alleles, DAU formed an independent allele cluster,
separate from the DIVa, weak D type 4, and Eurasian D clusters. The
characterization of the RH phylogeny provided a framework
for future studies on RH alleles. The identification of the
DAU alleles increased the number of known partial D alleles
in Africans considerably. DAU alleles may be a major cause
of antigen D variability and anti-D immunization in patients of African descent.
(Blood. 2002;100:306-311)
© 2002 by The American Society of Hematology.
| |
Introduction |
The D antigen of the RH blood group (ISBT 004.001;
RH1; CD240D; "Rhesus D") is the most important blood group antigen
determined by a protein, because D-negative individuals are easily
anti-D immunized.1 This antibody remains the leading cause
for the hemolytic disease of the newborn,2,3 and antigen
D-compatible transfusion is standard in modern transfusion therapy.
D-positive individuals harboring a "partial" D antigen may produce
an allo-anti-D, too. Among Europeans, the population frequency of all
known partial D phenotypes combined is less than 1%.4,5 The molecular basis is generally a gene conversion, in which parts of
the RHD gene were substituted by the respective segments of the RHCE gene, and single missense mutations.6
The molecular characterization of aberrant RHD alleles was
much facilitated in Europeans by the frequent occurrence of the
RHD gene deletion.7,8 Transfusion strategies
were devised to ensure D-negative transfusion in carriers of D
category VI, which was known to be the clinically most relevant partial
D occurring in Europeans.9
The situation is more intricate in Africans: The occurrence of aberrant
RHD alleles and anti-D immunizations in D-positive individuals is much more frequent than in Europeans.10
The serologic testing is confounded by frequent "African"
alleles that almost defy serologic recognition, like D category III
types.11 Molecular analysis revealed that there are often
multiple missense mutations, rather than single ones.12
The molecular characterization of RHD alleles was hampered
in Africans by the frequent occurrence of
RHD ,13
Ccdes,14 or the concomitant
presence of 2 different partial D alleles. RHD and
Ccdes do not express a D antigen, yet they
harbor a grossly intact RHD allele or an RHD-CE-D
hybrid allele, respectively, that often interferes with RHD
polymerase chain reaction (PCR) and RHD-specific sequencing.
We described 5 RHD alleles that shared a T379M substitution.
Four of these alleles expressed a partial D phenotype characterized by
the lack of distinct D epitopes or by an anti-D immunization event. We
provide a detailed RHD phylogeny in which the DAU
alleles formed a previously unknown cluster.
| |
Materials and methods |
Blood samples
There were 6 ethylenediaminetetraacetic acid
(EDTA)-anticoagulated blood samples referred to our laboratory for
problems with D typing or anti-D production in a D-positive individual
(sample RIR no. 38 of the Rhesus Immunization Registry, accessible at http://www.uni-ulm.de/~wflegel/RIR). In addition, EDTA-anticoagulated blood samples were collected from blood donors of ccDee phenotype in
Baden-Württemberg, Germany. DNA was isolated using QiaAmp blood
kit (Qiagen, Hilden, Germany) or by a modified salting-out procedure.15 In addition, 2 DNA samples with rare RhCE
phenotypes typically occurring in Africans (95-012:
hrs- and 95-013: Rh: -34) were obtained from the serum,
cells, and fluid exchange (SCARF).
Sequencing of the 10 RHD exons from
genomic DNA
Nucleotide sequencing of the 10 RHD exons was
performed as previously described.16-18 The standard PCR
for RHD exon 2 amplification failed with some alleles
belonging to the DIVa cluster (eg, in sample 95-013); in such
samples RH exon 2 was amplified using primers re12c and
re2317 and sequenced in a RHD-specific manner using primer re17. Primer sequences were re12c, attagccgggcacggtggtg; and re17, ctcgtctgcttcctcctcg.
Polymerase chain reaction with sequence-specific priming
A PCR with sequence-specific priming (PCR-SSP) was devised to
detect or to confirm the 1136 C > T substitution in the
DAU alleles and triggered to work under similar PCR
conditions as a PCR-SSP system previously developed for RHD
typing.18,19 The positive control was a 434-base-pair
(bp) PCR fragment of the human growth hormone gene. Specific primers
dau1b and daub as well as control primers were used at concentrations
of 1 µM. Amplifications were carried out with Taq (Qiagen) in a final
volume of 10 µL. Primer sequences were dau1b,
ttggccatcgtgatagctcacat; and daub, ggagatggggcacatagacatc.
Population screen for DAU
To screen for DAU alleles among Europeans, 194 random
ccDee donations were screened for the 1136 C > T substitution by
PCR-SSP. The presence of a DAU allele was confirmed by
sequencing of RHD exon 8. The DAU type was
determined by sequencing the 10 RHD exons from genomic DNA.
DAU allele frequencies were calculated based on phenotype
and haplotype frequencies previously determined for the local donor
population.9
Antigen density and Rhesus index
Flow cytometric determination of antigen density and Rhesus
index was performed as described previously.16,20 The
secondary antibody was goat anti-human IgG, Fab-fragment, fluorescein
isothiocyanate (FITC)-conjugated (Jackson Immunoresearch,
supplied by Dianova, Hamburg, Germany). For the DAU-3 sample, which had
a positive direct agglutination test, the background fluorescence was
determined by incubating the sample with secondary antibody only.
Monoclonal anti-D antibodies were provided by the 3rd
International Workshop on Monoclonal Antibodies against Human Red Blood
Cells and Related Antigens.21 The following IgG anti-D
antibodies were used as primary antibodies: D-89/47 (workshop
no. III-1-29); HG/92 (III-30); D-90/7 (III-31); D-90/17 (III-32);
D-90/12 (III-33); 17010C9 (III-36); AUB-2F7/Fiss (III-41); LOR11-2D9
(III-43); LOR12-E2 (III-44); LOR17-6C7 (III-45); LOR17-8D3 (III-46);
LOR28-21D3 (III-47); LOR28-7E6 (III-48); LOR29-F7 (III-49); LORA
(III-50); LORE (III-51); NAU3-2E8 (III-53); NAU6-4D5 (III-55); NOI
(III-56); SAL17-4E8 (III-58); SAL20-12D5 (III-59); SALSA-12 (III-60);
822 (III-68); BTSN4 (III-71); BTSN6 (III-72); BTSN10 (III-73); LHM76/58
(III-74); LHM76/55 (III-75); LHM76/59 (III-76); LHM77/64 (III-77);
LHM59/19 (III-78); LHM50/2B (III-80); LHM169/80 (III-81); LHM169/81
(III-82); C205-29 (III-88); CLAS1-126 (III-89); F5S (III-90); H2D5D2F5
(III-93); RAB.B15 (III-94); BIRMA-DG3 (III-95); BIRMA-D6 (III-96);
BIRMA-D56 (III-97); P3G6 (III-101); P3AF6 (III-102); BRAD3 (III-105);
L87.1G7 (III-108); MS26 (III-112); D10 (III-114); HIRO-3 (III-117);
HIRO-4 (III-118); ID6-H8 (III-119); HIRO-7 (III-120); HIRO-8 (III-121);
HIRO-2 (III-122); D6DO2 (III-123); and MCAD-6 (III-124).
Epitope patterns
Agglutination was tested in a gel matrix test (LISS-Coombs
37°C, DiaMed-ID Micro Typing System; DiaMed, Cressier sur Morat, Switzerland) using the following antibodies in addition to those tested
in flow cytometry: B9A4B2 (workshop no. III-1-28); HeM-92 (III-34);
175-2 (III-35); NaTH28-3C11 (III-37); NaTH87-4A5 (III-38); NaTH53-2A7
(III-39); CAZ7-4C5 (III-42); MAR-1F8 (III-52); NAU6-1G6 (III-54); NOU
(III-57); VOL-3F6 (III-61); ZIG-189 (III-62); 819 (III-69); LHM70/45
(III-79); LHM174/102 (III-83); LHM50/3.5 (III-84); LHM59/25 (III-85);
LHM59/20 (III-86); T3D2F7 (III-87); P3187 (III-98); P3F17 (III-99);
P3F20 (III-100); MS201 (III-113); HIRO-1 (III-115); HIRO-6 (III-116);
HS114 (III-134); and BS87 (III-180).
Routine D typing
Reactions of the DAU phenotypes in routine D-typing conditions
were established using commercial anti-D BS226 (Biotest, Dreieich, Germany), BS232 (Biotest), RUM1 (Immucor, Norcross, GA), and D14E11 (Immucor) in tube technique. In addition, P3×61 (Diagast, Loos, France) was tested in a gel matrix test.
Phylogeny of RHD alleles
A possible phylogenetic tree for RHD alleles was
developed which was based on the RHD coding sequence and the
presence of a C or E allele. Nucleotide
substitutions, gene conversions, recombinations, and mutations in the
accompanying RHCE alleles were counted as equivalent single
events. The tree was devised manually to minimize the required number
of events. Within RHCE, only standard C alleles caused by the gene conversion around exon 222 were counted
as C positive. Because of insufficient data, further
intricacies of RHCE alleles like the 16 Trp/Cys, 245 Leu/Val, and 336 Gly/Cys polymorphisms were disregarded. Sequences from
chimpanzee (Pan troglodytes Rh-like protein IIR, nucleic
acid accession number L3705023) were used for external
rooting. The RHD alleles shown in the phylogeny tree were
published previously13,14,16-18,24-31 or described in this
study for DAU-0 to DAU-4 and DIII type
5.
Nomenclature
The name DAU derived from "D of African origin" (in German:
D afrikanischen Ursprungs) and is pronounced like in
"now."
| |
Results |
DAU alleles
There were 5 RHD alleles identified (Table
1). These alleles constituted a
cluster, because they shared a 1136C > T single nucleotide
polymorphism (SNP) causing a T379M substitution. T379M only was found
in DAU-0 which represented the primordial allele of the
DAU allele cluster. The other 4 DAU alleles
harbored one or 2 additional substitutions dispersed in the various
segments of the protein (Figure 1).
View larger version (49K):
[in this window]
[in a new window]
| Figure 1.
Schematic representation of the RhD proteins observed in
the 5 DAU phenotypes.
All DAU types share a T379M substitution (black disk) that is located
in the twelfth transmembrane protein segment. DAU-1 to DAU-4 have
additional substitutions: the S230I substitution of DAU-1 and the E233Q
substitution of DAU-4 are both located in exofacial loop 4; the R70Q
and S333N substitutions of DAU-2 position near the border of
intramembrane and intracellular protein segments; the V279M
substitution of DAU-3 locates at an intramembraneous protein segment
proximate to exofacial loop 5.
|
|
Population frequencies
DAU-1 to DAU-4 samples were referred to our laboratory because of
typing problems or, in the case of DAU-3 (sample RIR no. 38), of an
anti-D immunization. All probands carrying these alleles were, if
known, of African descent (Table 1). To determine the possible presence
of such alleles in Europeans, we screened for the common 1136C > T SNP by PCR-SSP (Figure 2). Among 194 random samples of ccDee phenotype, 3 samples (1.5%) were positive for the 1136C > T SNP. These samples, however, lacked any additional SNP in the coding sequence and represented DAU-0. The
haplotype frequency of the cDe haplotype with
DAU-0 was 1:3159 (95% confidence interval:
1:1170-1:11 587). The frequency of the DAU-0 phenotype in the German
population was calculated to be 1:3843. All 4 other DAU
alleles were infrequent in whites (cumulative frequency < 1:3164,
upper limit of 95% confidence interval according to the Poisson
distribution).
View larger version (39K):
[in this window]
[in a new window]
| Figure 2.
Specific detection of the T379M substitution by PCR-SSP.
A PCR-SSP was devised that amplified a specific 140-bp product from the
aberrant RHD exon 8 in all DAU alleles tested
(lane 1: DAU-0; lane 2: DAU-1; lane 3:
DAU-2; lane 4: DAU-3; lane 5: DAU-4).
In a normal D-positive sample (lane 6), only the 434-bp control product
deriving from the human growth hormone gene is
amplified.
|
|
Phenotypes of DAU alleles
Antigen density and Rhesus index.
As previously noted for weak D samples,16 there was no
simple relation of the type of substitution (Figure 1) to the antigen density or to the Rhesus index (Table 2).
Both the antigen density and the Rhesus index of the DAU-0 phenotype
were about normal, rendering it indistinguishable from the normal
antigen D-positive phenotype. However, the extracellular substitutions
in the DAU-1 and DAU-4 phenotypes correlated well with their much
diminished Rhesus index, which is typical for partial D. The DAU-2 with
its low antigen density was reminiscent of weak D because its 2 unique substitutions were located at the inner boundary of the red cell membrane. The Rhesus index of DAU-3 indicated its propensity to anti-D
immunization, while its antigen D density at the lower end of the
normal range would render DAU-3 carriers being transfused with
D-positive blood units.
Epitope patterns.
The D epitope patterns of the DAU phenotypes were distinct (Table
3). Despite DAU-1 having a much higher
antigen density than DAU-2, more anti-D antibodies agglutinated DAU-2
than DAU-1 red blood cells. The profile of DAU-4 was almost identical
to that reported for DHK,32 alias DYO,33
which shared the E233K substitution. DAU-0 had a normal D-positive
epitope pattern.
Routine D-typing issues.
Applying routine methods for D typing,34 DAU-0 typed D
positive, whereas DAU-1, DAU-2, and DAU-4 were not agglutinated by most
commercial monoclonal IgM anti-D antibodies (Table
4). Hence, DAU-1, DAU-2, and DAU-4 would
usually be typed as D-negative, triggering D-negative transfusions,
which is the clinically favored management.
DIII type 5
Sequencing of DNA sample 95-013 revealed 6 nucleotide
substitutions, 186G > T, 410C > T, 455A > C,
692C > G, 667T > G, 819G > A. This result predicted
the homozygous or hemizygous presence of an RHD (L62F,
A137V, N152T, T201R, F223V) allele that was dubbed DIII type
5, because of its similarity to the molecular structure described
for mditDIIIa.12
Phylogeny of RHD alleles in humans
Based on the molecular structure of the DAU alleles,
the phylogenetic models35,36 of the RHD alleles
were extended (Figure 3). The
DAU alleles, which were characterized by a cDe
haplotype and a T379M substitution, formed a separate cluster of
RHD alleles. There were 2 other allele clusters also
associated with the cDe haplotype: the weak D type 4 cluster
was characterized by a common F223V substitution. The DIVa cluster
comprising DIII type 4, DIVa, Ccdes, and DIII type 5 was
characterized by a common N152T substitution. In addition, DIII
type 4 and type 5 as well as all
DIVa24 and Ccdes14,37 samples investigated by
us carried L62F and A137V. The remaining RHD alleles could
be derived from the RHD allele prevalent in Eurasians by a
single event (point mutation, gene conversion, or deletion) and formed
the Eurasian D cluster.
View larger version (43K):
[in this window]
[in a new window]
| Figure 3.
Phylogeny of
RHD in humans. A phylogenetic tree of
RHD is shown for most "African" alleles and
representative "Eurasian" alleles. There are 4 main clusters that
may be discerned. The DIVa cluster encompasses the DIVa,
DIII type 4, and Ccdes
alleles. Most samples harboring these alleles share 3 characteristic amino acids (62F, 137V, 152T) that are ancestral,
because they are also observed in chimpanzee RH (Pan troglodytes
Rh-like protein IIR). The weak D type 4 cluster encompasses
DAR, DOL, and RHD , too. For this
cluster, the RHD (F223V) allele is postulated36
but has yet to be shown extant. DIII type 5, a new
RHD allele resembling DIIIa, evolved by a
recombination between alleles of the DIVa and the weak D type 4 clusters. For the DAU cluster, its primitive type DAU-0 has
been found and was shown to be the most frequent DAU allele
in Europeans. All enumerated alleles occurred in a cDe
haplotype and were predominantly observed in Africans. In
contrast, most other RHD alleles were typical for Eurasians,
derived from standard Eurasian RHD by a single event,
occurred in a CDe or cDE haplotype, and formed
the Eurasian D cluster. The tree was mainly based on
RHD allelic variability, and dismisses the largely unknown
RHCE variability beyond the C and E polymorphism. For each
evolutionary step, the event is indicated; the depicted
distances of the alleles are arbitrary.
|
|
| |
Discussion |
We found 5 RHD alleles that shared a T379M missense
mutation and formed a previously unknown cluster. There were 4 of these alleles that had one or 2 additional mutations and were observed in
individuals of African descent. The fifth allele, RHD
(T379M), was detected in Europeans by screening blood donors.
DAU alleles may be a major cause of antigen D variability
and anti-D immunization in patients of African descent.
Anti-D immunization in transfusion recipients and pregnant women
harboring "African" partial D is a continuing problem. For example,
11% of anti-D in pregnancies in the Cape Town area, South Africa,
occurred in D-positive women.10 Current D-typing
strategies are tuned to detect partial D phenotypes that are
typical for white populations.9,34 Although carriers of
partial D are more frequent in African populations,25 more
than 25 partial D alleles are predominantly observed in Europeans and
to date only 5 partial D alleles were typical for
Africans.12,16,24-26 Thus, the identification of the
DAU cluster increased the number of "African" partial D
considerably. Because anti-D immunization may occur in carriers of
DAU alleles, our molecular characterization is instrumental
for evaluating the clinical relevance in transfusion recipients.
All of the more than 50 known aberrant RHD alleles expressed
variant D antigens.6,36 Unexpectedly, DAU-0
encoded a normal phenotype despite its intramembraneous T379M
substitution. DAU-0 may be the first example of a host of alleles
harboring an amino acid substitution that does not affect their antigen
D. The other 4 DAU phenotypes, however, had a low Rhesus index and
qualify as partial D. The partial D phenotype was most obvious for
DAU-3, in which an anti-D immunization was documented. If such
immunizations were frequently occurring in populations with African
admixture, the specific detection of the involved DAU
alleles might be warranted.
A phylogeny model for the RH haplotypes was originally
presented by Carritt et al35 in 1997 which explained the
mechanisms shaping RH heterogeneity in Eurasian populations.
More recently, these haplotypes were recognized to represent just one
branch separated from 2 different clusters of RHD alleles
that are primarily observed in African populations.36
Alleles of the DAU cluster added to this diversity and represented a
third "African" cluster (Figure 3). Each of these 3 "African"
allele clusters was characterized by a specific amino acid substitution
relative to the "Eurasian" RHD allele: (1) T379M in the
DAU cluster, (2) F223V in the weak D type 4 cluster, which included
RHD, DOL, and many alleles sharing F223V and
T201R, and (3) N152T in the DIVa cluster, which included DIII
type 4, DIVa, and Ccdes.
Recently, Rh-related proteins, including RhAG, have been shown to
transport ammonia.38 It is tempting to speculate that amino acid substitutions located in transmembraneous Rh protein segments, like T379M in DAU, F223V and T201R in weak D type 4, and
L245V and G336C in Ccdes, may affect the
function of the Rh protein. Even a substitution that does not alter the
D antigen, like T379M in DAU-0, may still be functionally effective.
Malaria and other blood-borne diseases endemic in Africa may favor
functional and antigenic variability, as exemplified by
glucose-6-phosphate dehydrogenase deficiency39 and lack of
Duffy protein expression in red cells,40
respectively. Similar processes might confer evolutionary
advantages to carriers of aberrant RH alleles.
The RHD alleles of the 3 "African" clusters generally
occurred in a cDe haplotype, which indicated that the
cE and Ce alleles of RHCE evolved
in the "Eurasian" branch after its divergence from the other
branches. However, haplotypes of the "Eurasian" cluster represented
a sizeable fraction of haplotypes extant in Africans. For example, the
frequency of antigen E-encoding "Eurasian" haplotypes is 9.01%
among Barotse in Zambia.41 In contrast, even the most
frequent alleles of the "African" clusters are very rare among
Europeans. This was shown for DAU-0 in the present study
(population frequency of 1:3159) and previously determined for
weak D type 4 (1:15 000).17 The knowledge of
RH phylogeny is of practical importance because it defines
the framework for determining the clinically relevant
RH alleles in any population.
In populations without African admixture, including whites, Asians,
Arabs, and probably American Indians, partial D phenotypes are
likely to be rare and to derive from the limited and serologically well-characterized set of alleles of the Eurasian D cluster. For these
populations, the current D-typing strategies applied in Europe9 appear to be appropriate and sufficient. Typing
strategies for African populations and those with African admixture may
take account of the various frequently occurring alleles of the
"African" clusters. Several of these alleles characterized by
multiple dispersed amino acid substitutions are difficult to discern by
serologic means and may in the future warrant genotyping approaches for detection in patients and donors.
| |
Acknowledgments |
We are greatly indebted to all contributors of the 3rd
International Workshop on Monoclonal Antibodies against Human Red Blood Cells and Related Antigens in Nantes, France, 1996, who
provided most other monoclonal anti-D antibodies. We thank John
J. Moulds and Joann M. Moulds, Philadelphia, PA, for rare DNA samples
from the SCARF Exchange program. We acknowledge the expert technical assistance of Marianne Lotsch, Anita Hacker, Sabine Kaiser, and Sabine Zahn.
| |
Footnotes |
Submitted January 31, 2002; accepted March 1, 2002.
Prepublished online
as Blood First Edition Paper, April 17, 2002; DOI
10.1182/blood-2002-01-0320.
Supported by the DRK-Blutspendedienst Baden-Württemberg-Hessen,
Mannheim; by the University of Ulm (Forschungsförderungsprojekt P. 531); and by the Deutsche Gesellschaft für Transfusionsmedizin und Immunhämatologie (project DGTI/fle/00-01).
The publication costs of this
article were defrayed in part by
page charge payment. Therefore,
and solely to indicate this fact,
this article is hereby marked
"advertisement"
in accordance with 18 U.S.C.
section 1734.
Reprints: Willy A. Flegel, Abteilung Transfusionsmedizin,
Universitätsklinikum Ulm, and DRK Blutspendedienst
Baden-Württemberg-Hessen, Institut Ulm, Helmholtzstrasse 10, D-89081 Ulm, Germany; e-mail: waf{at}ucsd.edu.
| |
References |
1.
Urbaniak SJ, Robertson AE.
A successful program of immunizing Rh-negative male volunteers for anti-D production using frozen/thawed blood.
Transfusion.
1981;21:64-69[CrossRef][Medline]
[Order article via Infotrieve].
2.
Filbey D, Hanson U, Wesstrom G.
The prevalence of red cell antibodies in pregnancy correlated to the outcome of the newborn: a 12 year study in central Sweden.
Acta Obstet Gynecol Scand.
1995;74:687-692[Medline]
[Order article via Infotrieve].
3.
Bowman J.
The management of hemolytic disease in the fetus and newborn.
Semin Perinatol.
1997;21:39-44[CrossRef][Medline]
[Order article via Infotrieve].
4.
Flegel WA, Wagner FF.
The frequency of RHD protein variants in Caucasians [abstract].
Transfus Clin Biol.
1996;3:10s.
5.
Roubinet F, Apoil PA, Blancher A.
Frequency of partial D phenotypes in the south western region of France.
Transfus Clin Biol.
1996;3:247-255[CrossRef][Medline]
[Order article via Infotrieve].
6.
Avent ND, Reid ME.
The Rh blood group system: a review.
Blood.
2000;95:375-387[Abstract/Free Full Text].
7.
Colin Y, Cherif-Zahar B, Le Van Kim C, Raynal V, van Huffel V, Cartron JP.
Genetic basis of the RhD-positive and RhD-negative blood group polymorphism as determined by southern analysis.
Blood.
1991;78:2747-2752[Abstract/Free Full Text].
8.
Wagner FF, Flegel WA.
RHD gene deletion occurred in the Rhesus box.
Blood.
2000;95:3662-3668[Abstract/Free Full Text].
9.
Wagner FF, Kasulke D, Kerowgan M, Flegel WA.
Frequencies of the blood groups ABO, Rhesus, D category VI, Kell, and of clinically relevant high-frequency antigens in South-Western Germany.
Infusionsther Transfusionsmed.
1995;22:285-290[Medline]
[Order article via Infotrieve].
10.
du Toit ED, Martell RW, Botha I, Kriel CJ.
Anti-D antibodies in Rh-positive mothers.
S Afr Med J.
1989;75:452[Medline]
[Order article via Infotrieve].
11.
Scott M.
Rh serology coordinator's report.
Transfus Clin Biol.
1996;3:333-337[CrossRef][Medline]
[Order article via Infotrieve].
12.
Huang CH, Chen Y, Reid M.
Human DIIIa erythrocytes: RhD protein is associated with multiple dispersed amino acid variations.
Am J Hematol.
1997;55:139-145[CrossRef][Medline]
[Order article via Infotrieve].
13.
Singleton BK, Green CA, Avent ND, et al.
The presence of an RHD pseudogene containing a 37 base pair duplication and a nonsense mutation in Africans with the Rh D-negative blood group phenotype.
Blood.
2000;95:12-18[Abstract/Free Full Text].
14.
Faas BHW, Becker EAM, Wildoer P, et al.
Molecular background of VS and weak C expression in blacks.
Transfusion.
1997;37:38-44[CrossRef][Medline]
[Order article via Infotrieve].
15.
Miller SA, Dykes DD, Polesky HF.
A simple salting-out procedure for extracting DNA from human nucleated cells.
Nucl Acids Res.
1988;16:1215[Free Full Text].
16.
Wagner FF, Frohmajer A, Ladewig B, et al.
Weak D alleles express distinct phenotypes.
Blood.
2000;95:2699-2708[Abstract/Free Full Text].
17.
Wagner FF, Gassner C, Müller TH, Schönitzer D, Schunter F, Flegel WA.
Molecular basis of weak D phenotypes.
Blood.
1999;93:385-393[Abstract/Free Full Text].
18.
Wagner FF, Frohmajer A, Flegel WA.
RHD positive haplotypes in D negative Europeans.
BMC Genet.
2001;2:10[CrossRef][Medline]
[Order article via Infotrieve].
19.
Gassner C, Schmarda A, Kilga-Nogler S, et al.
RhesusD/CE typing by polymerase chain reaction using sequence-specific primers.
Transfusion.
1997;37:1020-1026[CrossRef][Medline]
[Order article via Infotrieve].
20.
Flegel WA, Curin-Serbec V, Delamaire M, et al.
Rh flow cytometrycoordinator's report. Rhesus index and antigen density: an analysis of the reproducibility of flow cytometric determination.
Transfus Clin Biol.
2002;9:33-42[CrossRef][Medline]
[Order article via Infotrieve].
21.
Rouger P, Muller J-Y.
Third International Workshop and Symposium on Monoclonal Antibodies against Human Red Cells and Related Antigens: Section RH.
Transfus Clin Biol.
1996;3:329-541[CrossRef][Medline]
[Order article via Infotrieve].
22.
Poulter M, Kemp TJ, Carritt B.
DNA-based Rhesus typing: simultaneous determination of RHC and RHD status using the polymerase chain reaction.
Vox Sang.
1996;7:164-168.
23.
Salvignol I, Blancher A, Calvas P, et al.
Molecular genetics of chimpanzee Rh-related genes: their relationship with the R-C-E-F blood group system, the chimpanzee counterpart of the human rhesus system.
Biochem Genet.
1994;32:201-221[CrossRef][Medline]
[Order article via Infotrieve].
24.
Rouillac C, Colin Y, Hughes-Jones NC, et al.
Transcript analysis of D category phenotypes predicts hybrid Rh D-CE-D proteins associated with alteration of D epitopes.
Blood.
1995;85:2937-2944[Abstract/Free Full Text].
25.
Hemker MB, Ligthart PC, Berger L, van Rhenen DJ, van der Schoot CE, Wijk PA.
DAR, a new RhD variant involving exons 4, 5, and 7, often in linkage with ceAR, a new rhce variant frequently found in African blacks.
Blood.
1999;94:4337-4342[Abstract/Free Full Text].
26.
Avent ND, Poole J, Singleton BK, et al.
Studies of two partial Ds: DMH and DOL [abstract].
Transfus Med.
1999;9:33.
27.
Rouillac C, Le Van Kim C, Beolet M, Cartron JP, Colin Y.
Leu110Pro substitution in the RhD polypeptide is responsible for the DVII category blood group phenotype.
Am J Hematol.
1995;49:87-88[Medline]
[Order article via Infotrieve].
28.
Wagner FF, Gassner C, Müller TH, Schönitzer D, Schunter F, Flegel WA.
Three molecular structures cause Rhesus D category VI phenotypes with distinct immunohematologic features.
Blood.
1998;91:2157-2168[Abstract/Free Full Text].
29.
Avent ND, Liu W, Jones JW, et al.
Molecular analysis of Rh transcripts and polypeptides from individuals expressing the DVI variant phenotype: an RHD gene deletion event does not generate all DVIccEe phenotypes.
Blood.
1997;89:1779-1786[Abstract/Free Full Text].
30.
Jones JW, Finning KM, Mattock R, Voak D, Scott ML, Avent ND.
The serological profile and molecular basis of a new partial D phenotype, DHR.
Vox Sang.
1997;73:252-256[CrossRef][Medline]
[Order article via Infotrieve].
31.
Faas BHW, Beckers EAM, Simsek S, et al.
Involvement of Ser103 of the Rh polypeptides in G epitope formation.
Transfusion.
1996;36:506-511[CrossRef][Medline]
[Order article via Infotrieve].
32.
Omi T, Takahashi J, Tsudo N, et al.
The genomic organization of the partial D category DVa: the presence of a new partial D associated with the DVa phenotype.
Biochem Biophys Res Commun.
1999;254:786-794[CrossRef][Medline]
[Order article via Infotrieve].
33.
Hyodo H, Ishikawa Y, Kashiwase K, et al.
Polymorphisms of RhDVa and a new RhDVa-like variant found in Japanese individuals.
Vox Sang.
2000;78:122-125[CrossRef][Medline]
[Order article via Infotrieve].
34.
Wissenschaftlicher Beirat der Bundesärztekammer, Paul-Ehrlich-Institut.
Richtlinien zur Gewinnung von Blut und Blutbestandteilen und zur Anwendung von Blutprodukten (Hämotherapie). Köln: Deutscher Ärzte-Verlag; 2000.
35.
Carritt B, Kemp TJ, Poulter M.
Evolution of the human RH (rhesus) blood group genes: a 50 year old prediction (partially) fulfilled.
Hum Mol Genet.
1997;6:843-850[Abstract/Free Full Text].
36.
Flegel WA, Wagner FF.
Molecular genetics of RH.
Vox Sang.
2000;78:109-115.
37.
Daniels GL, Faas BH, Green CA, et al.
The VS and V blood group polymorphisms in Africans: a serologic and molecular analysis.
Transfusion.
1998;38:951-958[CrossRef][Medline]
[Order article via Infotrieve].
38.
Marini AM, Matassi G, Raynal V, et al.
The human Rhesus-associated RhAG protein and a kidney homologue promote ammonium transport in yeast.
Nat Genet.
2000;26:341-344[CrossRef][Medline]
[Order article via Infotrieve].
39.
Ruwende C, Khoo SC, Snow RW, et al.
Natural selection of hemi- and heterozygotes for G6PD deficiency in Africa by resistance to severe malaria.
Nature.
1995;376:246-249[CrossRef][Medline]
[Order article via Infotrieve].
40.
Miller LH, Mason SJ, Clyde DF, McGinniss MH.
The resistance factor to Plasmodium vivax in blacks: the Duffy-blood-group genotype, FyFy.
N Engl J Med.
1976;295:302-304[Abstract].
41.
Mourant AE, Kopec AC, Domaniewska-Sobczak K.
The distribution of the human blood groups and other polymorphisms. London United Kingdom: Oxford University Press; 1976.
42.
Lomas C, McColl K, Tippett P.
Further complexities of the Rh antigen D disclosed by testing category DII cells with monoclonal anti-D.
Transfus Med.
1993;3:67-69[Medline]
[Order article via Infotrieve].
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
|
Top
Abstract
Introduction