|
|
 Previous Article | Table of Contents | Next Article 
Blood, 1 July 2002, Vol. 100, No. 1, pp. 96-106
HEMATOPOIESIS
Expression of the  4 integrin subunit induces monocytic
differentiation of 32D/v-Abl cells
Annarita Morena,
Sabrina Riccioni,
Alessandra Marchetti,
Alessandro Tartaglia Polcini,
Arthur M. Mercurio,
Giovanni Blandino,
Ada Sacchi, and
Rita Falcioni
From the Molecular Oncogenesis Laboratory, Regina Elena
Cancer Institute, Via delle Messi d'Oro, Rome, Italy; and the
Department of Pathology Research North, Beth Israel Deaconess Medical
Center and Harvard Medical School, Boston, MA.
 |
Abstract |
The  6 4 integrin is the receptor for various laminin isoforms
and is a component of the hemidesmosome. Increased expression levels of
this integrin correlate with the aggressive phenotype of many
epithelial tumors compared with surrounding normal tissue. Furthermore,
the long cytoplasmic tail of the 4 integrin subunit has been
implicated in several signal transduction pathways that are involved
not only in invasion, but also in proliferation and apoptosis. Here we
report that the exogenous expression of 4 integrin in
32D/v-abl-transformed cells reduces tumor aggressiveness in vivo and strongly inhibits cell proliferation in vitro by inducing monocytic differentiation. These effects are accompanied by growth arrest and p73 protein accumulation. The hypothesis that the inhibition of v-Abl oncogenic capacity could allow the activation of the endogenous c-Abl was tested in RKO cells. The results clearly demonstrated a strong increase of c-Abl phosphorylation that is accompanied by its association with p73 protein. Overall, the reported
findings indicate that 64 integrin promotes growth arrest and
differentiation by modulating Abl kinases and p73 protein pathway(s).
(Blood. 2002;100:96-106)
© 2002 by The American Society of Hematology.
| |
Introduction |
The integrin 64 is expressed by epithelial
and neuroepithelial cells. In epithelia, the distribution of this
molecule is restricted to the basal layer of cells in contact with the
basement membrane1 where it plays an essential role in the
formation and stabilization of hemidesmosomes.2,3 The
ligands for 64 integrin are various laminins
isoforms.4,5 The 64 integrin was originally
identified as a tumor-associated antigen (TSP-180).6 We
and others have shown that the expression of the 4 subunit correlates with the metastatic phenotype of mouse tumors and increases in human invasive carcinomas relative to benign adenomas and normal tissues.7-10 This suggests a role for this integrin during
tumor progression. It was recently observed that androgen receptor
expression in prostate carcinoma cells suppresses 64 expression
and the invasive phenotype,11 suggesting that the loss of
androgen receptor expression, a common feature of aggressive prostate
tumors, stimulates 64 expression and 64-mediated invasion.
Further strong evidence implicating 64 in invasion was provided
by the finding that the expression of the exogenous 4 subunit in
4-deficient colon and breast carcinoma cell lines increased their
ability to invade in vitro.12,13 The 4 cytoplasmic
domain is distinct both in size (approximately 1000 amino acids
[aa]) and structure from any other integrin
subunit.14,15 Although some progress has been made in
identifying the specific regions and motifs within this domain that
mediate 64-specific functions, the characterization is far from
being conclusive.
Our previous work demonstrated that the stimulation of 64
integrin by a monoclonal antibody increases phosphorylation of the 4
subunit and promotes cell growth in vitro.16 We also found
that the addition of insulin to intact carcinoma cells induces a
30-fold increase in the phosphorylation of the 4
subunit.17 This was the first evidence to implicate
64 in a signaling pathway. At present, it is well established
that 64 participates in signaling events that regulate not only
the invasion, but also cell proliferation, gene expression, and
apoptosis.12,13,18-20 However, the molecular mechanisms
underlining 64 activities remain to be elucidated. Recently, we
found that 64 integrin associates in vitro and in vivo with the
ErbB-2 tyrosine kinase receptor in human ovarian and mammary carcinoma
cell lines.21 A significant increase in the proliferative
and invasive capacity of ErbB-2-transformed NIH3T3 cells
overexpressing 64 strongly suggested a role for this association
during tumor progression. Using this model, we identified a specific
region in the 4 cytoplasmic domain that is critical for the ability
of 64 integrin to stimulate invasion. Interestingly, the
extracellular domain of 4 is not necessary for 64 to stimulate
invasion. We also observed a strong activation of PI3K only with those
4 deletion mutants that were able to stimulate invasion upon
expression in the NIH3T3/ErbB-2 cell line.22 These data
agree with the finding that 64 is implicated in carcinoma invasion through its ability to activate PI3K.13,22
In the present work, we investigated the possibility that 64
integrin cooperates with other oncogenes such as v-src and v-abl. For this purpose we used, as a model, 32D diploid
murine hemopoietic cells and their transformed v-src or
v-abl counterparts. The murine myeloid progenitor 32D cells
do not express the 4 integrin subunit and have been extensively used
to study transformation,23,24 cell spreading, and motility
induced by different receptors and ligands.25 It has been
previously reported that v-src and v-abl expression in 32D cells induces transformation,23,24 and
that 32D/v-Abl and 32D/v-src cells originate tumors in syngenic and nude mice.26,27 In these experimental conditions it was
expected that de novo expression of the 4 integrin subunit might
give additional information about its ability in modulating tumor
phenotype.22 Surprisingly, we found that the 4 integrin
subunit does not increase the malignant potential of transformed cells,
but instead counteracts the transformed phenotype inducing
differentiation. Indeed, we found that stable 4 integrin
subunit expression significantly inhibits the proliferative and
tumorigenic capacity of 32D/v-Abl cells. Moreover, morphologic analysis
of 32D/v-Abl/4 cells revealed that 4 expression induces monocytic
differentiation that is accompanied by accumulation of p73 protein.
Experiments undertaken to evaluate the role of p73 protein in 32D/v-Abl
differentiation indicate that p73 overexpression induces monocytic
differentiation of these transformed cells. The specificity of v-Abl
and 4 interaction is demonstrated by the observation that 4
expression does not have any detectable effects in the proliferative
and differerentiative capacity of 32D/v-src cells. These results
provide for the first time evidence of a link between 4
integrin signaling and the p73 protein in the differentiation process.
| |
Materials and methods |
Cell lines and cDNAs
The murine myeloid progenitor cell line 32D, depending on
interleukin 3 (IL-3) for growth and viability, was cultured in RPMI 1640 supplemented with 10% fetal calf serum (FCS), penicillin, streptomycin, and glutamine (Invitrogen, Milan, Italy), and 5% WEHI-3B-conditioned medium as a source of murine IL-3. The
v-src- and v-abl-transformed counterparts are
instead IL-3-independent either for survival or cell growth. The
parental cell line, the 32D/v-Abl-transformed cell
line,23,28 and the 32D/src-transformed cell
line24 were transfected, by electroporation, either with the pRC/CMV expression vector alone or carrying the wild-type human
4 integrin subunit cDNA.5 The 32D/v-Abl cells were also transfected with pRC/CMV vector carrying the truncated
cytoplasmic domain of the 4 integrin subunit (4
L).29 Selection of neomycin-positive clones was carried
out using 1 mg/mL G418 (Invitrogen). The human large-cell carcinoma
cell line H1299 stable-transfected with an expression vector encoding
p73 cDNA30 was maintained in RPMI 1640 supplemented with
10% FCS (Invitrogen) and used as positive control (H-p73 cells).
32D cells transfected with the expression vector encoding for a p53 Val
135, maintained in culture as described below, were also used as
positive controls.28 32D/v-Abl cells were also transfected
with the expression vector alone or encoding p73 cDNA which is also
tagged with hemaglutinin (HA) epitope,30 and
maintained as described below. After selection with G418, the
population of 32D/v-Abl/neo and 32D/v-Abl/p73 cells was analyzed by
morphology. Colon carcinoma cell line RKO20 was
cultured in Dulbecco modified Eagle medium (DMEM) and transient
transfected with the expression vector alone or encoding the 4
integrin subunit cDNA.5 After transfection, endogenous
c-Abl phosphorylation level and 4 integrin expression were analyzed
by immunoprecipitation and Western blot analyses.
Antibodies
The rat monoclonal antibodies (mAbs) 439-9B and 135-13C direct
to the human 4 and 6 integrin subunits, respectively, were purified as previously described.6 The rat mAb
346-11A anti-mouse 4 integrin subunit was prepared and purified
from ascitic fluid and used as a negative control.31 Rat
anti-mouse CD11b (MAC-1 M chain) (IgG2b) was from BD
Pharmingen (San Diego, CA). The rat anti-mouse F4/80 (IgG2b) was
kindly provided by Dr P. Giacomini (Regina Elena Cancer Institute,
Italy). The rat anti-mouse CD4 (IgG2b) used as a negative
control was from Southern Biotechnology Associates (Birminghan, AL).
The antiphosphotyrosine (anti-P-tyr) mouse mAb 4G10 was from UBI (Lake
Placid, NY). The rabbit polyclonal antibody against human and mouse
c-Abl was from Santa Cruz (Santa Cruz, CA). The antiactive
mitogen-activated protein kinase (MAPK) polyclonal antibody was from
Promega (Madison, WI). The polyclonal antitotal MAPK was from Santa
Cruz. The polyclonal antibody direct to p73 protein was kindly provided
by Y. Shaul.32 The polyclonal antibodies direct to p73
protein were from Santa Cruz. To detect p53, a mixture of monoclonal
antibodies D01 and 1801 was used.33 The anti-HA monoclonal
antibody was from Roche Molecular Biochemicals (Monza, Italy). The
secondary antibodies (F[ab']2, fluorescein isothiocyanate
[FITC]-conjugated or horseradish peroxidase
[HRP]-conjugated) were from Cappel (Durham, NC).
Flow cytometry
The expression levels of cell surface receptors were
analyzed by flow cytometric analysis (FACS) of stained cells. Cells
were washed twice with cold phosphate buffered saline (PBS) containing 0.002% ethylenediaminetetraacetic acid (EDTA) and 10 mM
NaN3 (washing buffer). Samples of 1 × 106
control and transfected cells were incubated for 1 hour at 4°C with
primary antibody diluted in PBS containing 0.5% bovine serum albumin
(BSA). Cells were then washed 3 times with washing buffer (PBS
containing 0.5% BSA) and incubated for 1 hour at 4°C with 50 µL
FITC-conjugated secondary antibodies diluted 1:20 in PBS/BSA. After 3 washes, the cells were suspended in 1 mL washing buffer. Cell
suspensions were analyzed by a flow cytometer (Epics XL analyzer; Coulter Corporation, Miami, FL) after addition of 5 µL propidium iodide (1 mg/mL stock solution) to exclude nonviable cells. The negative controls were treated as described below. At least
1 × 104 cells per sample were analyzed.
Total cell lysates and immunoprecipitation
In brief, as previously described,6
2 × 107 cells from each control and 4- transfected
cells were labeled with 1 mCi (37 MBq) of 125I in
the presence of 10 µL lactoperoxidase (2 mg/mL in 50% of glycerol)
(Calbiochem, La Jolla, CA) and 5 µL of a 1:1000 dilution of
H2O2 (30%). After labeling, cells were washed
with PBS and solubilized in lysis buffer containing 5 mg/mL BSA, 1%
NP-40, 1 mM NaN3, 1 mM phenylmethylsulfonylfluoride (Sigma,
St Louis, MO), 5 µg/mL leupeptin, 10 µg/mL aprotinin (Sigma), and
10 mM EDTA. The lysates were clarified by centrifugation
(30 000g) for 3 hours at 4°C and solubilized proteins
(5 × 106 cpm) were immunoprecipitated. Direct
immunoprecipitations were performed using primary mAb 439-9B collected
with 50 µL protein G-agarose beads (Pierce, Rockford, IL) suspended
in lysis buffer (50% vol/vol). The immunoprecipitates were washed at
4°C in lysis buffer, boiled, and analyzed by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The
autoradiography was performed with X-Omat RP film (Kodak,
Rochester, NY).
Cell proliferation and viability curves
Exponentially growing cells were plated
(3 × 104/mL) in RPMI 1640 with 10% FCS in the presence
or absence of IL-3. Cell numbers were determined at daily intervals in
triplicate with a Thoma hemocytometer (Marienfeld, Germany). Cells
viability was determined by trypan blue exclusion.
In vivo studies
32D/v-Abl and 32D/v-Abl/4 cells (2 × 107) were
injected subcutaneously into 6-week-old female nu/nu mice. The mice
were examined every day for the appearance of tumor masses. Tumor
volume was measured every other day until day 37 from the first
tumor appearance, when the first mouse died (Table
1).
ApoTag staining
Cells (1 × 106) were plated for 48 hours on
dishes coated with Poly-L-lysine, fibronectin (FN), vitronectin (VN),
and laminin (LM) obtained from Invitrogen or on dishes coated
with 10 µg/mL 439-9B and/or 135-13C mAbs in normal culture condition.
Then the cells were harvested, washed in PBS, fixed in 1%
paraformaldehyde in PBS, permeabilized in 70% ethanol, and stained
with ApoTag reagent (Oncor, Gaithersburg, MD) and propidium iodide (PI)
as described above. The stained cells were analyzed by FACS.
Cell cycle analysis
Analyses of DNA content of 32D control cells and 4
transfectans were done by FACS. In brief, the cells were fixed in cold methanol and acetone (1:4) for 30 minutes at 4°C and stained
in PBS containing 50 µg/mL PI and 0.2 mg/mL RNAse A for 30 minutes at
RT. DNA content was measured by the Epics XL analyzer.
Morphology
Approximately 2 × 104 cells were spun onto a
glass slide in a cytocentrifuge. For morphologic analysis, cytospin
preparations were fixed and stained with May-Grunwald-Giemsa stain
(Sigma) and observed under a light microscope.
Western blot analyses
32D/v-Ab cells and/or 4-transduced cells were lysed in lysis
buffer (50 mM Tris, pH 8, 100 mM NaCl, 10% glycerol, 1% Triton X-100,
1 mM EDTA, 1 mM MgCl2, 2 mM phenylmethylsulfonyl fluoride, and protease inhibitors mixture). The extracts were sonicated for 10 seconds and centrifuged at 14 000 rpm for 10 minutes to remove the
debris. Protein concentration was determined by a coloritrimetic analysis assay (Bio-Rad, Milan, Italy). Total cell lysates (200 µg/lane) were resolved by SDS-PAGE. Protein gels were transferred to
nitrocellulose membranes (Bio-Rad). The western blot analyses were
resolved by the enhanced chemiluminescence (ECL) system (Amersham Pharmacia Biotech, Milan, Italy).
Reverse transcription-polymerase chain reaction analyses of
mouse p73 mRNA
Expression of mouse p73 mRNA was analyzed by reverse
transcription-polymerase chain reaction (RT-PCR) amplification. Total RNA was prepared from 32D/v-Abl/neo, 32D/v-Abl/4 wild type,
and 32D/v-Abl/4 L cells using RNAzol B (Biotech, Rome, Italy)
according to the manufacturer's procedure. Total RNA (7 µg) was
reverse transcribed at 37°C for 1 hour in the presence of random
hexamers and Moloney murine leukemia virus reverse transcriptase
(Invitrogen). Mouse p73 mRNA quantitative analysiswas carried out
by PCR amplification of a fragment of 298 base pair (bp) for a total of
36, 38, and 40 cycles using the follow specific primers:
5'GAGCACCTGTGGAGTTCTCTAGAG3' and 5'GGTATTGGAAGGGATGACAGGCG-3'.
The housekeeping aldolase mRNA, used as an internal control, was
amplified from the same cDNA reaction mixture for a total of 25, 30, and 35 cycles using the follow specific primers:
5'-TGGATCGGCTGTCTCAACGCTGT-3', and 5'-TCACTGTCGTCCCCCGTGACA-3' to
amplify a fragment of 413 bp.
Amplified PCR products were electrophoresed on a 2% agarose gel
containing ethidium bromide (0.5 µg/mL) and visualized under UV light.
| |
Results |
The cytoplasmic domain of the 4 integrin subunit influences the
cell proliferation of 32D/v-Abl-transformed cells
We stable transfected 32D cells, 32D/v-src-, and
32D/v-Abl-transformed cells with the expression vector pRC/CMV alone
or carrying the 4 integrin subunit cDNA. The 32D/v-Abl cells were
also transfected with the expression vector encoding the 4 integrin
subunit devoid of its cytoplasmic domain (4 L). Clones of
transfected 32D, 32D/v-src, and 32D/v-Abl cells expressing a high level
of either 4 wild type or 4 L molecules were isolated and analyzed
by flow cytometry (Figure 1A) or by
immunoprecipitation of surface-labeled proteins (Figure 1B). The
expression of wild-type and truncated 4 proteins on the cell surface
of selected clones is evident whereas the same were absent in clones
transfected with the vector alone (neo) (Figure 1A-B).
View larger version (23K):
[in this window]
[in a new window]
| Figure 1.
Expression of the 4 integrin subunit in 32D cell lines.
32D cells and v-src- or v-abl-transformed
counterparts were transduced with pRC/CMV expression vector alone
and/or carrying wild-type 4 integrin subunit and cytoplasmic-deleted
4 molecule (4 L) cDNAs. Neo cells and 4-transduced cells were
analyzed by FACS for the expression of exogenous 4 molecules (A).
Control and 4-transduced cells were exogenous-labeled and
immunoprecipitated with the anti-4 monoclonal antibody 439-9B
(B).
|
|
We asked whether the proliferative capacity of different 32D
transfectans might be influenced by the expression of 4 protein. Proliferation rates were determined by daily counting the number of
living cells. The data obtained showed that the expression of the
wild-type 4 integrin subunit, but not the 4 L truncated protein,
strongly inhibited the proliferation of 32D/v-Abl cells (Figure
2A-B). Unlike 32D/v-Abl cells, the
expression of the 4 subunit did not influence the proliferation
capacity of nontransformed 32D and 32D/v-src-transformed
cells (Figure 2C-D). Cell viability curves, obtained by trypan blue
exclusion experiments, showed that all 32D 4-transfected cell lines
survived as well as control cells (Figure 2, right panels). Similar
results were also obtained when transformed v-src and
v-abl control cells (neo) and 4-transduced cells were
treated with IL-3 (data not shown). All analyses were performed with 2 clones for each 4 transfectant. The in vitro data were also
confirmed by in vivo experiments (Table 1). The tumors were detectable
at the site of injection 25 days after the injection of 32D/v-Abl/4
cells, showing a delay of tumor appearance of 15 days compared with
32D/v-Abl cells. Furthermore, by evaluating tumor masses, we observed
that 32D/v-Abl/4 cells grow significantly less than parental
32D/v-Abl cells. The value of tumor masses indicates that
32D/v-Abl/4-induced tumors grow 7-fold less than the
32D/v-Abl-induced ones. These data were interpreted hypothesizing that
some 32D/v-Abl/4 cells resistant to the selection but negative for
4 expression (Figure 1) grow in vivo, exhibiting a strong delay of
tumor appearance.
View larger version (19K):
[in this window]
[in a new window]
| Figure 2.
Cell proliferation of 32D, 32D/v-src, 32D/v-Abl neo cells and/or
transduced with wild-type and truncated 4 molecules.
Cells (3 × 104) were plated in triplicate and counted at
daily intervals. The number of viable cells was determined by trypan
blue exclusion. Panels show cell proliferation and viability of:  32D/v-Abl/neo and  32D/v-Abl/4 cells (A); 32D/v-Abl/neo and
32D/v-Abl/4 L (B); 32D/neo and 32D/4 (C); 32D/v-src/neo and 32D/v-src/4 (D).
|
|
The expression of the 4 integrin subunit induces growth arrest
in 32D/v-abl-transformed cells
We analyzed the DNA content of control and 4-transfected cells.
This analysis revealed that 4 expression in 32D/v-Abl cells causes
an accumulation of the cells in G1 phase of the cell cycle (Figure
3D). This effect was not evident in
32D/v-Abl cells transfected with either the 4 L molecule (data not
shown) or the expression vector alone (Figure 3C). Moreover, the
expression of 4 protein does not cause growth arrest in 32D as well
as in 32D/v-src cells compared with the neo transfected ones (Figure
3A-B,E-F). Subsequently, we assessed whether 4 expression promotes
apoptosis of 32D/v-Abl cells. The results showed that the level of
apoptosis in 32D/v-Abl/neo cells was very low (approximately 3%) and
that the expression of 4 did not increase this apoptotic feature
(data not shown). Experiments were performed either in suspension or
when the cells were allowed to adhere to various substrates or
antibodies ("Materials and methods"), thus indicating that the
reduced proliferative capacity induced by 4 expression was not due
to an apoptotic event, in good agreement with the cell viability
profile reported in Figure 2.
View larger version (49K):
[in this window]
[in a new window]
| Figure 3.
Effects of 4 integrin expression on the cell cycle of 32D,
32D/v-src, 32D/v-Abl neo cells and their counterparts transduced with
wild-type 4 molecule.
(A) 32D/neo cells; (B) 32D/4 cells; (C) 32D/v-Abl/neo cells; (D)
32D/v-Abl/4 cells; (E) 32D/v-src/neo cells; (F) 32D/src/4 cells.
The DNA contents were measured by fluorimetric analysis of fixed and
PI-stained cells.
|
|
The expression of the wild-type 4 integrin subunit promotes the
monocytic differentiation of 32D/v-Abl cells
Since reduced proliferation capacity induced by 4 expression in
32D/v-Abl cells could not be attributed to a reduced cell viability, we
verified whether these cells underwent differentiation. The morphologic
analysis showed that 32D and 32D/v-src neo or 4-transduced cells did
not differentiate (Figure 4A-D). In
contrast, 32D/v-Abl cells expressing the 4 integrin subunit
underwent monocytic differentiation independently whether the cells
were grown in the absence or in the presence of IL-3 (Figure 4F,H). The
latest result is in agreement with the fact that v-abl
oncogene expression in 32D cells abrogates their requirement for IL-3
and their capacity to differentiate in the presence of
granulocyte-colony-stimulating factor (G-CSF).23
Interestingly, since 32D/v-Abl cells transduced with the 4-truncated
molecule (Figure 4G) did not differentiate, it is inferred that the
cytoplasmic domain of the 4 subunit is directly involved in
signaling events that generate monocytic differentiation of
32D/v-abl-transformed cells. To further confirm the
monocytic differentiation observed in 32D/v-Abl/4 cells, we tested,
by FACS analysis, the expression levels of CD11b and F4/80 antigens,
whose expression levels increase during monocytic differentiation. A
strong up-regulation of CD11b (Figure 5A,
lower panel) and F4/80 (Figure 5B, lower panel) antigens were found in
32D/v-Abl/4 cells, confirming the differentiated status we observed
in these cells by morphologic analysis. The results obtained from 2 different 32D/v-Abl/4 clones used (A and B) were
comparable. Conversely, the expression levels of CD11b and F4/80
antigens of the neo transfectans (Figure 5A-B, upper panels) were
similar to their parental 32D/v-Abl counterparts (data not
shown).
View larger version (88K):
[in this window]
[in a new window]
| Figure 4.
Representative samples of morphologic analyses of 32D,
32D/v-src, 32D/v-Abl control neo, and derivatives of 4-transduced
cells.
(A) 32D/neo cells; (B) 32D/4 cells; (C) 32D/v-src/neo cells; (D)
32D/src/4 cells; (E) 32D/v-Abl/neo cells; (F) 32D/v-Abl/4 cells;
(G) 32D/v-Abl/4 L cells; (H) 32D/vAbl cells maintained in IL-3 and
transduced with wild-type 4 molecule. The morphology of the
cytospin-fixed cells was analyzed by May-Grunwald-Giemsa
stain. Original magnification × 630.
|
|
View larger version (18K):
[in this window]
[in a new window]
| Figure 5.
Cytofluorimetric analysis of CD11b and F4/80 antigens in
32D/v-Abl/neo and 32D/v-Abl/4 cells.
32D/v-Abl/neo and 32D/v-Abl/4 cells (clone a) were stained with
anti-CD11b and/or F4/80 monoclonal antibodies and analyzed by flow
cytometry. (A) Samples of 1 × 106 of control (neo) and
4-transduced cells were incubated with purified rat anti-mouse
CD11b, and (B) with rat anti-mouse F4/80 primary antibodies. The cells
were washed, incubated with FITC-conjugated secondary antibody, and
analyzed by a flow cytometer after addition of 5 µL PI. (A,B)
Negative controls were stained with rat anti-mouse CD4 monoclonal
antibody and processed as described in "Materials and
methods."
|
|
The expression of 4 in 32D/v-Abl cells promotes monocytic
differentiation by p73 protein accumulation
It has been previously reported that p53 family members induce
cell cycle arrest, differentiation and apoptosis. Furthermore, the p73
protein, a new member of p53 family, is able to activate p53 target
genes as well as to induce cell cycle arrest and
apoptosis.30,33-36 It has recently been reported that (1)
p73 protein accumulates during epithelial
differentiation,37 (2) p73 protein accumulates during
myeloid leukemia and neuroblastoma cells upon treatment with
differentiating agents,38,39 and (3) p73-null mice exhibit severe defects in development.40 In accordance with these
results, we asked whether monocytic differentiation induced by 4
expression in 32D/v-Abl cells involves p73 and/or p53 proteins. To
answer this issue, we tested by Western blot the expression level of p73 proteins in different transfectans. The H1299 cell line
stable-expressing p73 protein was used as a positive control (Figure
6, lane 1).32 We found that
the expression of 4 integrin in 32D/v-Abl cells promotes the
accumulation of p73 protein (Figure 6A, lane 3). Conversely, p73
protein was not detectable in control cells (32D/v-Abl/neo) and
in cells expressing the truncated 4 protein (32D/v-Abl/4 L)
(Figure 6A, lanes 2 and 4). The lower panel of Figure 6A shows that the
amount of total protein loaded in each lane was identical. To assess
whether the accumulation of p73 protein was paralleled by its induction
at the transcriptional level, p73 mRNA was measured by semiquantitative
RT-PCR. As an internal control, the housekeeping aldolase gene was used
(Figure 6C, lower panel). The reported data showed that the expression
of 4 does not modulate the level of p73 mRNA of 32D/v-Abl/4 cells
(Figure 6C, lanes 2, 5, and 8, upper panel) compared with 32D/v-Abl/neo
(Figure 6C, lanes 1, 4, and 7) and 32D/v-Abl/4 L cells (Figure 6C,
lanes 3, 6, and 9). These results indicate that 4 expression induces
p73 protein accumulation in 32D/v-Abl cells and, apparently, does not
modulate its transcriptional activation. The level of p53 protein in
32D/v-Abl/4 cells was also evaluated. The reported data show, as
expected, a high level of p53 protein in 32D/tsp53 control cells
(Figure 6B, lane 1). By contrast, p53 protein was not detectable either
in 32D/v-Abl/neo or in 4-transduced 32D/v-Abl cells (Figure 6B,
lanes 2, 3, and 4), indicating that p53 might not be involved
in the monocytic differentiation of 32D/v-Abl cells. These data agree
with the finding that the overexpression of p53 in 32D/v-Abl cells
induces growth arrest but not differentiation.28
View larger version (36K):
[in this window]
[in a new window]
| Figure 6.
Analyses of p73 protein and mRNA in 32D/v-Abl/neo cells and 32D/v-Abl
cells expressing either wild-type or truncated 4 molecules.
(A) Total cell lysates from 32D/v-Abl/neo (lane 2), 32D/v-Abl/4 wild
type (lane 3), and 32D/v-Abl/4 L (lane 4) were analyzed by SDS-PAGE
and probed with anti-p73 antibody. H-p73, stably transduced with
p73 cDNA, was used as a positive control (lane 1). (B) Total cell
lysates from 32D/v-Abl/neo (lane 2), 32D/v-Abl/4 wild type (lane 3),
and 32D/v-Abl/4 L (lane 4) were analyzed by SDS-PAGE and probed with
anti-mouse p53 antibody. 32D transduced with the expression vector
encoding for a p53 Val 135 was used as a positive control (lane 1). The
nitrocellulose used to probe p73 and p53 proteins was stripped and
probed again with the anti-tubulin antibody to normalize equal loading
of proteins (lanes 2, 3, and 4). (C) Total mRNA was extracted from
32D/v-Abl/neo (lanes 1, 4, and 7), from 32D/v-Abl/4 wild type (lanes
2, 5, and 8), and from 32D/v-Abl/4 L (lanes 3, 6, and 9). RT-PCR
analysis was performed using primers specific for mouse p73 and the
housekeeping aldolase gene to amplify 2 fragments of 298 bp and 413 bp,
respectively. The conditions are described in "Materials and
methods." Molecular sizes of the 2 fragments are indicated.
|
|
To further investigate the involvement of p73 in monocytic
differentiation we transfected 32D/v-Abl cells with pcDNA3 expression vector carrying p73 cDNA. After selection, 3 different p73-positive populations (Figure 7, lanes 3, 4, and 5)
were analyzed morphologically. The results showed that the 3 32D/v-Abl/p73 cell populations differentiated in monocytes at day 8 after selection. The percentage of differentiating cells was 55% (± 5% SD) compared with 32D/v-Abl/neo control cells (< 1%). After
longer selection we found that almost 90% of the cells differentiated
in monocytes as shown in Figure 7B (right panel). This result,
indicating that p73 expression is sufficient to induce the monocytic
differentiation of 32D/v-Abl cells, strongly suggests that p73
accumulation mediates 4-induced monocytic differentiation.
View larger version (55K):
[in this window]
[in a new window]
| Figure 7.
Expression and morphologic analysis of 32D/v-Abl/neo and
32D/v-Abl/p73 cells.
(A) 32D/v-Abl cells were transduced with an expression vector alone
and/or encoding p73 cDNA. After selection, total cell lysates from
32D/v-Abl/neo (lane 2), 3 derived 32D/v-Abl/p73 populations (lanes
3, 4, and 5), and H-p73 stably transduced with p73 cDNA (lane 1)
used as a positive control were analyzed by SDS-PAGE and probed with
anti-HA monoclonal antibody. (B) The morphology of the cytospin-fixed
32D/v-Abl/neo (left panel) and 32D/v-Abl/p73 (right panel) cells was
analyzed by May-Grunwald-Giemsa stain as described in "Materials and
methods." Original magnification × 630.
|
|
4 expression affects Abl and MAPK phosphorylation
Based on the above reported findings that 4 integrin expression
in 32D/v-Abl cells induces growth arrest and monocytic differentiation, we investigated whether 4 expression could affect v-Abl and MAPK phosphorylation. Both conditions are reported to be essential for
transformation and cell proliferation.23,41 To this end, v-Abl protein was immunoprecipitated from 32D/v-Abl/neo cells, wild-type 4-transfected cells, and 32D/v-Abl/4 L cells, and then,
after SDS-PAGE, the phosphorylation level of the protein was evaluated
by an antiphosphotyrosine antibody. As shown in Figure
8A, the expression of the wild-type 4
molecule caused a clear decrease of v-Abl phosphorylation (lanes 2 and
3) compared with 32D/v-Abl/neo (lane 1), or 32D/v-Abl/4 L (lane 4).
The lower part of Figure 8A shows that the amount of v-Abl
immunoprecipitated and loaded in each lane was identical. By using a
specific antibody that recognizes the active isoforms of ERK1 and ERK2,
we also found a complete inhibition of MAPK phosphorylation in
32D/v-Abl/4 clones (Figure 8B, lanes 4 and 5). No modulation of MAPK
phosphorylation was evident in control 32D/v-Abl/neo cells (lane 3), in
cells expressing the truncated form of 4 (32D/v-Abl/4 L) (lane
6), and in the 32D untransformed counterparts (32D/neo, and 32D/4) (lanes 1 and 2). The lower part of Figure 8B shows that the amount of
total protein used in each lane was identical. We conclude that 4
expression in 32D/v-Abl cellular context inhibits both v-Abl and MAPK
phosphorylation and modulates these events through its cytoplasmic
domain. We interpreted these results, hypothesising that the inhibition
of v-Abl function that we reported, upon expression of the 4
integrin subunit, could allow the endogenous tyrosine kinase c-Abl
activation to induce growth arrest and differentiation. Indeed, it has
been found that the induction of G1 arrest and apoptosis, by different
stimuli, requires the kinase activity of c-Abl.36,42,43
Since we have previously demonstrated that the expression of the 4
integrin subunit in RKO colon carcinoma cells induces growth arrest and
apoptosis and it is known that carcinoma cells express the tyrosine
kinase c-Abl, we asked whether 4 expression in these epithelial
cells could activate endogenous c-Abl.20 We analyzed the
phosphorylation status of endogenous c-Abl in RKO colon carcinoma cells
transfected with the vector alone (Figure
9A, lane 1) or carrying 4 cDNA (Figure
9A, lane 2).20 Cell lysates from RKO/neo and RKO/4 were
immunoprecipitated with c-Abl antibody and blotted with an
antiphosphotyrosine antibody. As shown in Figure 9B, the expression of
the 4 molecule caused a clear increase of c-Abl phosphorylation
(upper panel B, lane 2) compared with RKO/neo (upper panel B, lane 1)
where the phosphorylation level of this kinase was undetectable. The
lower part of Figure 9B shows that the amount of c-Abl
immunoprecipitated and loaded in each lane was identical. Since it has
been shown that in epithelial cells activated c-Abl induces growth
arrest and apoptosis by its interaction with p73,42,43 we
asked whether we were able to observe similar interaction in RKO cells
upon 4 transduction. To this end, we immunoprecipitated p73 protein
from RKO/neo and RKO/4 cells (Figure 9C) and blotted with an
anti-c-Abl antibody. We found an increase of association between p73
and c-Abl in RKO cells expressing the 4 integrin subunit (upper
panel C, lane 2) compared with untrasfected 4 cells (upper panel C,
lane 1). We also found that the interaction of c-Abl and p73 correlates with the accumulation of p73 protein (lower panel C, lane 2). These
results are in good agreement with a previous finding showing that
c-Abl/p73 interaction occurs when different stimuli activate c-Abl to
induce G1 arrest and apoptosis.36,42,43
View larger version (24K):
[in this window]
[in a new window]
| Figure 8.
Analyses of v-Abl and MAPK phosphorylation on 32D neo
and 4 transfectans.
(A) Total cell lysates from 32D/v-Abl/neo cells (lane 1), 2 derived
32D/v-Abl/4 clones (lanes 2 and 3), and 32D/v-Abl/4 L clone (lane
4), were immunoprecipitated with anti-Abl monoclonal antibody. The
immunoprecipitated Abl proteins were analyzed by SDS-PAGE and probed
with antiphosphotyrosine monoclonal antibody (upper panel A). The
nitrocellulose was stripped and probed again with the anti-Abl
polyclonal antibody (lower panel A). (B) Total cell lysates from
32D/neo (lane 1), 32D/4 (lane 2), 32D/v-Abl/neo (lane 3),
32D/v-Abl/4 (lanes 4 and 5), and 32D/v-Abl/4 L cells (lane 6)
were analyzed by SDS-PAGE and probed with an antibody to the active
doubly phosphorylated forms of the MAPK (ERK 1 and 2) (upper panel B).
The nitrocellulose was stripped and probed again with an antibody
specific to the native unmodified form of ERK/MAPK (lower panel
B).
|
|
View larger version (17K):
[in this window]
[in a new window]
| Figure 9.
Analyses of c-Abl activation on RKO/neo and
4-transfected cells.
(A) Total cell lysates (500 µg) from RKO/neo (lane 1) and RKO/4
(lane 2) cells were immunoprecipitated with anti-4 monoclonal
antibody. The immunoprecipitated 4 proteins were analyzed by
SDS-PAGE and probed with an antibody direct to the 4 integrin
subunit. (B) Equal amounts of cell lysates from RKO/neo cells (lane 1)
and RKO/4 cells (lanes 2) were immunoprecipitated with anti-Abl
monoclonal antibody. The immunoprecipitated Abl proteins were analyzed
by SDS-PAGE and probed with antiphosphotyrosine monoclonal antibody
(upper panel B). The nitrocellulose was stripped and probed again with
the anti-Abl polyclonal antibody (lower panel B). (C) Equal amounts of
cell lysates from RKO/neo cells (lane 1) and RKO/4 cells (lanes 2)
were immunoprecipitated with anti-p73 polyclonal antibody and probed
with anti-cAbl antibody (upper panel C). The nitrocellulose was
stripped and probed again with the anti-p73 antibody (lower panel
C).
|
|
| |
Discussion |
In addition to many studies indicating that integrins promote
survival,44-47 we previously demonstrated that 64
can also inhibit the proliferation of p53 wild-type carcinoma cell
lines and induce their apoptosis by activating p5320 and
increasing the expression of the cell cycle inhibitor
p21.48,49 For the first time, we report that expression of
the 4 integrin subunit promotes monocytic differentiation of
32D/v-Abl cells by a mechanism that involves 4-mediated growth
arrest and p73 protein accumulation.
The p73 protein, which is a member of the p53 family, is a
transcription factor whose functions recapitulate those of
p53.35,50 Indeed, it has been shown that p73 induces cell
cycle arrest at G1 phase and apoptosis when it is overexpressed either
in p53+/+ and p53 /
cells.30,33-36,42,50 Recently, it was demonstrated that
p73 protein plays an important role in
differentiation.37-40,51 Although it has been described
that p53 is a regulator of cell differentiation, at least in part by
its transcriptional activity,52-54 we did not find any
accumulation of p53 protein in 32D/v-Abl/4 cells. Additional support
for the hypothesis that accumulation of p73 protein in 32D/v-Abl/4
cells promotes monocytic differentiation is the finding that the
overexpression of p73 protein in 32D/v-Abl cells actually induces
monocytic differentiation. Moreover, our results are in agreement with
previous data indicating that the induction of p73 protein occurs
during differentiation of the myeloid leukemia cell
line.38 Further support for the role of p73 in
differentiation has also been provided by the phenotype of
p73-deficient mice that exhibit neurologic and inflammatory
defects.40 These studies suggest a direct involvement of
p73 in the proper development of white lineage. The murine myeloid
progenitor cell line 32D does not express the 4 integrin subunit
that is instead expressed by adult, neonatal, and fetal mouse
thymocytes.55 We used 32D cells and v-src- or
v-abl-transformed 32D cells as a model to study a possible
cooperation between 4 integrin and the above-mentioned oncogenes as
we previously demonstrated with ErbB-2.17,22 Surprisingly, we found that 4 expression inhibits the transformed phenotype of
32D/v-Abl cells inducing growth arrest, differentiation, and p73
protein accumulation. To gain more insight into the mechanism by which
4 expression interferes with the oncogenic potential of
v-abl, we observed strong reduction of v-Abl
phosphorylation. Furthermore, the fact that the expression of a
truncated 4 molecule in 32D/v-abl cells does not affect
the level of either v-Abl or MAPK phosphorylation strongly indicates
the involvement of the 4 cytoplasmic domain in these events.
Recently, an immune T-cell inhibitory motif (ITIM) in the 4
cytoplasmic domain has been identified, which is a potential binding
site for SHP-1/2 (src-homology 2 domains protein tyrosine phosphatases)
protein tyrosine phosphatases.56 Accordingly, it might be
that the binding of SHP-1/2 phosphatases to the 4 cytoplasmic domain
could induce directly or indirectly a down-regulation of v-Abl
phosphorylation. As a consequence, the strong reduction of v-Abl
phosphorylation in 32D/v-Abl cells by 4 might cause the inhibition
of cell cycle progression. Based on the fact that during cell
proliferation MAPK proteins are highly active,41 the
strong inhibition of MAPK phopshorylation we found on 32D/v-Abl/4
cells is in agreement with v-Abl phosphorylation status and the growth
arrest of these cells. The observation that 4 integrin expression
does not inhibit cell proliferation either of
32D/v-src-transformed cells or parental cells indicates a
specific interference of 64 receptor signaling on
v-abl oncogenic pathways. These results suggested the
possibility that the inhibition of v-abl oncogenic capacity
upon expression of the 4 integrin subunit could allow the endogenous
c-Abl activation and its cooperation with p73 to induce growth arrest
and differentiation. This hypothesis was confirmed by the fact that the
expression of the |
Top
Abstract
Introduction