| |
|
|
|
|
|
|
|||
|
Prepublished online as a Blood First Edition Paper on July 5, 2002; DOI 10.1182/blood-2002-01-0155.
IMMUNOBIOLOGY
From the Section of Transplantation Immunology,
Department of Blood and Marrow Transplantation, University of Texas
M. D. Anderson Cancer Center, Houston.
Evidence suggests that T lymphocyte-mediated inhibition of
hematopoiesis in myelodysplastic syndrome (MDS) contributes to cytopenia in some patients and can be reversed by treatment with immunosuppression. We examined the T-cell repertoires of 12 patients with MDS before and after antithymocyte globulin (ATG)-based
treatment by T-cell receptor V Myelodysplastic syndrome (MDS) is a bone marrow
disorder characterized by dysplasia, cytopenia, and a propensity for
conversion to acute myeloid leukemia (AML). Although the etiology of
the ineffective hematopoiesis and resultant cytopenia is not certain, evidence suggests that T cell-mediated suppression of hematopoietic precursors contributes to the cytopenia in some
patients.1-4 Similarly, in aplastic anemia there is also
evidence of T cell-mediated inhibition of hematopoietic precursors and
prolonged recovery of hematopoiesis is observed in up to 70% of
patients after immunosuppressive treatment with antithymocyte globulin
(ATG).5-7 In 25 patients with MDS and significant
cytopenia who were treated with ATG, we found that 35% of patients had
recovery of effective hematopoiesis.8 We studied 5 of
those patients for lymphocyte-mediated suppression and found that
removal of CD3+ or CD8+ T cells from bone
marrow progenitor cultures resulted in a significant increase in
granulocyte-macrophage colony-forming units (CFU-GMs) in responders to
ATG, but not in nonresponders. In 1 of 2 patients with refractory
anemia, there also appeared to be increased T-cell polyclonality after
clinical response to ATG treatment when T-cell receptor (TCR) diversity
was crudely analyzed by single-stranded DNA conformational polymorphism
(SSCP), suggesting that diversification of the T-cell
repertoire might occur in patients who respond to immunosuppression.2
To investigate whether dominant T-cell clones are present in patients
with MDS, we studied 12 patients with cytopenia who were enrolled in a
randomized clinical trial of ATG, ATG plus fludarabine, or ATG plus
cyclosporine. We hypothesized that dominant clonal T lymphocytes
contribute to cytopenia by suppressing hematopoietic precursors and
that these clones become less prominent in patients who respond to
immunosuppression. TCR-V Patients
In addition, peripheral blood was collected from 13 healthy individuals
for use in normal control spectratype experiments. Spectratype analysis
was performed on all 13 healthy control subjects and the results were
compared with the results from the 12 patients with MDS. The mean age
of the healthy controls was 52 years.
Mononuclear cell isolation
Polymerase chain reaction and CDR3 size analysis In all instances, 4 to 8 × 106 BMCs or PBMCs were thawed, washed once, and used for RNA extraction. For UPN 3, 11, and 12, BMCs were used for RNA extraction. In all other MDS patients and all healthy controls PBMCs were the source of RNA. RNA was extracted using the RNA Stat 60 kit (Tel Test, Friendswood, TX) according to the manufacturer's instructions. Then, 1 µg of the extracted RNA was treated with DNAse (Gibco BRL, Rockville, MD) to remove contaminating gDNA. All of the DNAse-treated RNA was used to synthesize cDNA by reverse transcription using the manufacturer's protocol with the Gene Amp RNA kit (Perkin Elmer, Foster City, CA).Polymerase chain reaction (PCR) was then performed as previously
described2 by combining 25 pmol of one V The PCR products were next diluted in nuclease-free water so that 1.5 ng of the PCR product from each TCR-V Objective scoring of TCR-V spectratypes in a graph
format and also gives quantitative fluorescence intensity for each peak
in a CDR3 length distribution. The number of peaks within each of the
23 TCR-V family CDR3 length distributions were counted in all 12 patients with MDS and all 13 healthy subjects. Using a previously
established method,10 a peak was defined as a fluorescence signal with at least 15% of the intensity of the strongest signal within its TCR-V family CDR3 length distribution. To be counted as a
peak, a fluorescence signal also had to be separated from the nearest
neighboring signal by at least 2 nucleotides. A TCR-V family was
scored as normal if its CDR3 length distribution contained at least 6 peaks. TCR-V families with fewer than 6 peaks were scored as abnormal.
Cloning and sequencing of PCR-amplified cDNA The PCR products were visualized on an agarose gel, then excised and purified using the Qiaquick gel extraction kit (Qiagen, Valencia, CA). Next, the purified PCR product was cloned into the PCR 2.1 vector and expressed in Escherichia coli using the Original TA Cloning Kit (Invitrogen, Carlsbad, CA). Colonies were randomly selected and DNA was obtained by miniprep using the Qiaprep miniprep kit (Qiagen) according to the manufacturer's instructions. DNA from 20 randomly selected colonies containing inserts of the appropriate size was sequenced using M13 primers and an ABI 377 DNA Sequencer (Perkin Elmer). DNA sequences were compared and amino acid sequences deduced using MacVector software (Genetics Computer Group, Madison, WI).Flow cytometry The phenotype of T cells from patients shown to have clonal T-cell expansions was determined by flow cytometry using TCR-V family-specific antibodies combined with antibodies for activation and
memory phenotype. PBMCs were thawed and washed twice and 500 000 cells
were labeled with combinations of the following monoclonal antibodies:
V 6.7 (Immunotech, Marseille, France), CD8 (Caltag, Burlingame, CA),
CD45RO (Immunotech), CD4 (Caltag), CD45 RA (Caltag), HLA-DR
(Pharmingen, San Jose, CA), CD 25 (Caltag), V 1 (Immunotech), CD45
RA (Immunotech), HLA-DR (Caltag), CD8 (Immunotech), and V 8 (Pharmingen). Cells were incubated 30 minutes at 4°C with antibodies and washed once and 6-color analysis was performed using the MoFlo flow
cytometer (Cytomation, Ft Collins, CO).
Detection of specific CDR3 sequences A detailed method for detection of specific CDR3 sequences from reverse-transcribed PCR products has been previously described.11 Target cDNA products, which were reverse-transcribed from the PCR products of a TCR-V family shown to
contain a clonal T-cell expansion with a known CDR3 sequence, were
loaded onto a 1.5% agarose gel and electrophoresed at 70 V for 1 hour.
The cDNA was transferred to a positively charged nylon membrane using
the Gel Blot 758 device (Biorad). Next, an oligonucleotide probe (probe sequence: TCCGACAGGGGGGCTCCTTG) corresponding to the CDR3 sequence of
interest was labeled using the DIG oligonucleotide tailing kit (Roche,
Indianapolis, IN) following the manufacturer's instructions. Prehybridization was carried out using 20 mL buffer made up of 5 ×
standard sodium citrate (SSC), 2 mg poly A, 1% blocking solution (Roche), 0.1% N-lauroylsakosine, and 0.02% sodium dodecyl sulfate (SDS). Next, the prehybridization buffer was discarded and
hybridization buffer was added, along with 0.3 pmol/mL labeled
oligonucleotide probe. Hybridization was carried out for 6 hours at an
incubation temperature specific for each probe. The membrane was washed
2 times for 5 minutes at room temperature in 2 × SSC, 0.1% SDS, and
then 2 times at room temperature for 15 minutes in 0.1% SDS. Finally,
the probe was detected as instructed by the manufacturer using the Dig
Luminesence detection kit (Roche).
Statistical analysis The 2-tailed, unpaired Student t test was used to compare the number of TCR-V families with abnormal CDR3 length
distributions in patients with MDS and healthy control subjects.
Restricted T-cell repertoires in MDS patients are characterized by increased skewing of CDR3 lengths compared with healthy individuals We have previously shown that T lymphocyte-mediated suppression of hematopoiesis occurs in a subset of MDS patients, which is reversed by ATG treatment in clinical responders. In this study, we have examined the T-cell repertoire of 12 MDS patients before and after treatment with ATG-based immunosuppressive regimens using TCR-V
spectratyping of CDR3 lengths. Ordinarily, the CDR3 length
distributions of each TCR-V family in a healthy individual contain
at least 6 peaks in a gaussian distribution, indicating a polyclonal
T-cell population. A markedly nongaussian CDR3 length distribution,
referred to as skewing, suggests a clonal or oligoclonal T-cell
population. For comparison, we also performed TCR-V spectratype analysis on a panel of 13 healthy individuals. An objective scoring method10 was used to determine the number of TCR-V
families with normal (gaussian, diverse) and abnormal (skewed,
restricted) CDR3 length distributions in each MDS patient prior to
treatment and in each of 13 healthy control subjects.
All MDS patients showed skewing of TCR-V
Loss of T-cell clonal dominance on CDR3 spectratype analysis occurs in responders to ATG-based treatment All of the MDS patients showed skewing on pretreatment spectratypes, and complete spectratypes prior to ATG-based treatment and again 3 to 6 months after treatment are shown for comparison in Figure 3 for one responder and one nonresponder. This skewing persisted for at least 3 to 6 months after treatment in all nonresponders. In some cases, in addition to the same predominant peak, new peaks appeared in the spectratypes of previously skewed TCR-V families, as represented in the TCR-V 18 family from
UPN 8 (Figure 3). Four patients responded to therapy with ATG-based
therapies with recovery of effective hematopoiesis (UPN 1-3, and UPN
5). In all 4 patients, complete loss or marked diminution of a dominant
skewed peak on spectratype analysis occurred in at least one TCR-V
family. Figure 4 shows the persistence of
skewed spectratypes in the nonresponders (Figure 4A), and the loss of
skewing in the responders (Figure 4B).
Presence of skewing on spectratype analysis suggests, but does not
conclusively demonstrate, a clonal T-cell expansion. Therefore, we
further analyzed several TCR-V In UPN 11, the TCR-V
In UPN 8, 2 clonal expansions were demonstrated, 1 in the TCR V In UPN 3, a transient responder to immunosuppression, 4 of 20 clones
from the TCR-V Persistent clonal dominance in TCR-V 18 family of UPN 8 was shown to contain a dominant
clonal expansion by spectratype and sequence analysis (Figure 5). To
confirm that the predominant clonal T lymphocyte was still present
after treatment with immunosuppression, a DNA probe specific for the
dominant CDR3 sequence was designed. As shown by Southern blot in
Figure 6, this dominant CDR3 sequence
persisted 6 months after immunosuppression in this patient. This
demonstrates the persistence of a dominant clonal T-cell expansion in a
patient who did not have hematologic improvement after
immunosuppressive therapy.
The prominent clonal T-cell expansion found in UPN 11 has a naive CD8+ phenotype The TCR-V 8 family of UPN 11 was shown to contain a large
clonal population with 16 of 19 clones sharing an identical CDR3 sequence, as shown in Figure 5. We further analyzed this
TCR-V family by flow cytometry, as shown in Figure
7. The TCR-V 8 family in UPN 11 was
78% CD8+CD4 . The CD8+
subpopulation of this TCR-V family was a naive lymphocyte population with 96% CD45RA+ exhibiting low HLA-DR expression of
0.6%.
The PBMCs from 3 patients, UPN 3, UPN 8, and UPN 11, were expanded 3- to 5-fold after 7 to 10 days of coincubation with anti-CD3/anti-CD28 beads and analyzed again by flow cytometry. The percentage of T cells
that expressed the skewed TCR-V
In this study, we evaluated the total T-cell repertoire of 12 MDS
patients using TCR spectratype analysis before and after treatment with
ATG-based therapy to look for evidence of T-lymphocyte clonality. This
analysis showed that all 12 patients exhibited extensive skewing of
their pretreatment TCR spectratypes, suggesting clonal or oligoclonal
T-cell expansions. Furthermore, we demonstrated a statistically
significant increase in the number of TCR-V Dominant T-cell clones have also been found in other closely related
bone marrow failure syndromes with cytopenia that are thought to be
immune-mediated in part, such as aplastic anemia (AA)12,13
and PNH.14 Like some patients with MDS, patients with
these disorders frequently respond to treatment with ATG and other
immunosuppressive drugs with restored effective hematopoiesis. This
suggests a common immune pathogenesis for the development of cytopenia
in these different disorders. In cases of PNH, overrepresented T-cell
expansions within TCR-V Myelodysplastic syndrome occurs more commonly among older individuals and increasing T-cell clonality has been demonstrated to occur in normal healthy individuals with increasing age.15-17 The T-cell clones found in aged healthy individuals are most commonly long-lived memory CD8+ T lymphocytes that are anergic.18 In contrast, the CD8+ clonal T cells in one MDS patient showed a naive phenotype and were not anergic. Our findings are similar to other reports demonstrating autoreactive clonal T-cell expansions in the blood and inflamed joint spaces of patients with rheumatoid arthritis.19 Importantly, the loss or reduction of T-cell clonality was associated with response to immunosuppressive treatment and recovery from cytopenia. Because most of the patients in this study received multiple
transfusions of red blood cells and platelets, it is possible that
T-cell clones might have emerged as a consequence of alloimmunization. However, Karadimitris et al investigated this possibility in their report of increased T-cell clonality among patients with PNH and they
found no TCR-V Although hematopoiesis in MDS patients is also clonal in the majority of patients, it is unlikely that the clonal T-cell expansions are part of the MDS clone. In previous studies where T cells have been evaluated by studying the pattern of inactivation of X chromosomes in female patients, the majority of T lymphocytes were found to be polyclonal and therefore not derived from the clonal dysplastic hematopoietic precursors.20,21 Moreover, the clonal T-cell expansions evaluated in this study appear to have undergone normal development. The sequences of the CDR3 regions from these clonal populations contained nucleotide changes consistent with the normal junctional diversity that occurs during thymic development.22 Surprisingly, the dominant clonal T lymphocytes in MDS patients may constitute up to 9.3% of the total T-cell population, which suggests a dominant antigen-driven expansion of these cells. It is likely that the dominant clonal T cells retain effector function because they can be expanded in vitro and thus are not anergic. We have previously shown that T lymphocytes contribute to cytopenia in MDS patients by directly inhibiting CFU-GM hematopoietic precursors and that restored effective hematopoiesis after ATG treatment is associated with loss of T cell-mediated inhibition.2,8 Taken together with the results from the current study, we hypothesize that clonal T lymphocytes expand in response to a hematopoietic antigen-driven stimulus, which results in T cell-mediated inhibition of hematopoietic progenitors contributing to cytopenia. This may be a common mechanism of the cytopenia associated with other bone marrow failure disorders such as AA,7,12 PNH,14 T-LGL lymphoproliferative disorder,23 pure red cell aplasia,24 and perhaps hairy cell leukemia.25 Formal proof of this hypothesis depends on demonstrating suppression of hematopoietic progenitors by the dominant clonal T lymphocytes, work that is currently underway in our laboratory.
Submitted January 18, 2002; accepted June 24, 2002.
Prepublished online as Blood First Edition Paper, July 5, 2002; DOI 10.1182/blood-2002-01-0155.
Supported by United States Public Health Service grant CA85843 to J.J.M. and by National Cancer Institute grant CA16672 to the DNA Core Facility of the M. D. Anderson Cancer Center. J.N.K. is supported by National Institutes of Health training grant TA-3209666.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Jeffrey J. Molldrem, Section of Transplantation Immunology, Department of Blood and Marrow Transplantation, University of Texas M. D. Anderson Cancer Center, 1515 Holcombe Blvd, Box 448, Houston, TX 77030; e-mail: jmolldre{at}notes.mdacc.tmc.edu.
1. Iwase O, Aizawa S, Kuriyama Y, Yaguchi M, Nakano M, Toyama K. Analysis of bone marrow and peripheral blood immunoregulatory lymphocytes in patients with myelodysplastic syndrome. Ann Hematol. 1995;71:293-299[Medline] [Order article via Infotrieve]. 2. Molldrem JJ, Jiang YZ, Stetler-Stevenson M, Mavroudis D, Hensel N, Barrett AJ. Haematological response of patients with myelodysplastic syndrome to antithymocyte globulin is associated with a loss of lymphocyte-mediated inhibition of CFU-GM and alterations in T-cell receptor Vbeta profiles. Br J Haematol. 1998;102:1314-1322[CrossRef][Medline] [Order article via Infotrieve]. 3. Sugawara T, Endo K, Shishido T, et al. T-cell-mediated inhibition of erythropoiesis in myelodysplastic syndromes. Am J Hematol. 1992;41:304-305[Medline] [Order article via Infotrieve]. 4. Smith MA, Smith JG. The occurrence subtype and significance of haemopoietic inhibitory T-cells (HIT cells) in myelodysplasia: an in vitro study. Leuk Res. 1991;15:597-601[CrossRef][Medline] [Order article via Infotrieve].
5.
Zeng W, Nakao S, Takamatsu H, et al.
Characterization of T-cell repertoire of the bone marrow in immune-mediated aplastic anemia: evidence for the involvement of antigen-driven T-cell response in cyclosporine-dependent aplastic anemia.
Blood.
1999;93:3008-3016
6.
Paquette RL, Tebyani N, Frane M, et al.
Long-term outcome of aplastic anemia in adults treated with antithymocyte globulin: comparison with bone marrow transplantation.
Blood.
1995;85:283-290 7. Zoumbos NC, Gascon P, Djeu JY, Trost SR, Young NS. Circulating activated suppressor T lymphocytes in aplastic anemia. N Engl J Med. 1985;312:257-265[Abstract]. 8. Molldrem JJ, Caples M, Mavroudis D, Plante M, Young NS, Barrett AJ. Antithymocyte globulin for patients with myelodysplastic syndrome. Br J Haematol. 1997;99:699-705[CrossRef][Medline] [Order article via Infotrieve].
9.
Loughran TP.
Clonal diseases of large granular lymphocytes.
Blood.
1993;82:1-14
10.
Verfuerth S, Peggs K, Paulomi V, Barnett L, O'Reilly RJ, Mackinnon S.
Longitudinal monitoring of immune reconstitution by CDR3 size spectratyping after T-cell-depleted allogeneic bone marrow transplant and the effect of donor lymphocyte infusions on T-cell repertoire.
Blood.
2000;95:3990-3995
11.
Hong J, Zang YC, Tejada-Simon MV, et al.
A common TCR V-D-J sequence in V beta 13.1 T-cells recognizing an immunodominant peptide of myelin basic protein in multiple sclerosis.
J Immunol.
1999;163:3530-3538
12.
Zeng W, Nakao S, Takamatsu H, et al.
Characterization of T-cell repertoire of the bone marrow in immune-mediated aplastic anemia: evidence for the involvement of antigen-driven T-cell response in cyclosporine-dependent aplastic anemia.
Blood.
1999;93:3008-3016 13. Zeng W, Maciejewski JP, Chen G, Young NS. Limited heterogeneity of T-cell receptor BV usage in aplastic anemia. J Clin Invest. 2001;108:765-773[CrossRef][Medline] [Order article via Infotrieve].
14.
Karadimitris A, Manavalan JS, Thaler HT, et al.
Abnormal T-cell repertoire is consistent with immune process underlying the pathogenesis of paroxysmal nocturnal hemoglobinuria.
Blood.
2000;96:2613-2620 15. Batliwalla F, Monteiro J, Serrano D, Gregersen PK. Oligoclonality of CD8+ T-cells in health and disease: aging, infection, or immune regulation. Hum Immunol. 1996;48:68-76[CrossRef][Medline] [Order article via Infotrieve]. 16. Ruiz M, Esparza B, Perez C, Barranquero M, Sabino E, Merino F. CD8+ T-cell subsets in aging. Immunol Invest. 1995;24:891-895[Medline] [Order article via Infotrieve]. 17. Morley JK, Batliwalla FM, Hingorani R, Gregersen PK. Oligoclonal CD8+ T-cells are preferentially expanded in the CD57+ subset. J Immunol. 1995;154:6182-6190[Abstract]. 18. Wedderburn LR, Patel A, Varsani H, Woo P. The developing human immune system: T-cell receptor repertoire of children and young adults shows a wide discrepancy in the frequency of persistent oligoclonal T-cell expansions. Immunology. 2001;102:301-309[CrossRef][Medline] [Order article via Infotrieve].
19.
Schmidt D, Goronzy JJ, Weyand CM.
CD4+ CD7
20.
van Kamp H, Fibbe WE, Jansen RP, et al.
Clonal involvement of granulocytes and monocytes, but not of T and B lymphocytes and natural killer cells in patients with myelodysplasia: analysis by X-linked restriction fragment length polymorphisms and polymerase chain reaction of the phosphoglycerate kinase gene.
Blood.
1992;80:1774-1780 21. Delforge M, Demuynck H, Verhoef G, et al. Patients with high-risk myelodysplastic syndrome can have polyclonal or clonal haemopoiesis in complete haematological remission. Br J Haematol. 1998;102:486-494[Medline] [Order article via Infotrieve]. 22. Rowen L, Koop BF, Hood L. The complete 685-kilobase DNA sequence of the human beta T-cell receptor locus. Science. 1996;272:1755-1762[Abstract]. 23. Saunthararajah Y, Molldrem JL, Rivera M, et al. Coincident myelodysplastic syndrome and T-cell large granular lymphocytic disease: clinical and pathophysiological features. Br J Haematol. 2001;112:195-200[CrossRef][Medline] [Order article via Infotrieve].
24.
Handa SI, Schofield KP, Sivakumaran M, Short M, Pumphrey RS.
Pure red cell aplasia associated with malignant thymoma, myasthenia gravis, polyclonal large granular lymphocytosis and clonal thymic T-cell expansion.
J Clin Pathol.
1994;47:676-679
25.
Kluin-Nelemans JC, Kester MG, Melenhorst JJ, et al.
Persistent clonal excess and skewed T-cell repertoire in T-cells from patients with hairy cell leukemia.
Blood.
1996;87:3795-3802
© 2002 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
A. J. Barrett and E. Sloand Autoimmune mechanisms in the pathophysiology of myelodysplastic syndromes and their clinical relevance Haematologica, April 1, 2009; 94(4): 449 - 451. [Full Text] [PDF] |
||||
![]() |
M. E.D. Chamuleau, T. M. Westers, L. van Dreunen, J. Groenland, A. Zevenbergen, C. M. Eeltink, G. J. Ossenkoppele, and A. A. van de Loosdrecht Immune mediated autologous cytotoxicity against hematopoietic precursor cells in patients with myelodysplastic syndrome Haematologica, April 1, 2009; 94(4): 496 - 506. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Y. Kordasti, W. Ingram, J. Hayden, D. Darling, L. Barber, B. Afzali, G. Lombardi, M. W. Wlodarski, J. P. Maciejewski, F. Farzaneh, et al. CD4+CD25high Foxp3+ regulatory T cells in myelodysplastic syndrome (MDS) Blood, August 1, 2007; 110(3): 847 - 850. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Chen, F. M. Ellison, M. A. Eckhaus, A. L. Smith, K. Keyvanfar, R. T. Calado, and N. S. Young Minor Antigen H60-Mediated Aplastic Anemia Is Ameliorated by Immunosuppression and the Infusion of Regulatory T Cells J. Immunol., April 1, 2007; 178(7): 4159 - 4168. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Melchert and A. F. List Management of RBC-Transfusion Dependence Hematology, January 1, 2007; 2007(1): 398 - 404. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. W. Wlodarski, L. P. Gondek, Z. P. Nearman, M. Plasilova, M. Kalaycio, E. D. Hsi, and J. P. Maciejewski Molecular strategies for detection and quantitation of clonal cytotoxic T-cell responses in aplastic anemia and myelodysplastic syndrome Blood, October 15, 2006; 108(8): 2632 - 2641. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Schiffer Clinical Issues in the Management of Patients with Myelodysplasia Hematology, January 1, 2006; 2006(1): 205 - 210. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. M. Sloand, L. Mainwaring, M. Fuhrer, S. Ramkissoon, A. M. Risitano, K. Keyvanafar, J. Lu, A. Basu, A. J. Barrett, and N. S. Young Preferential suppression of trisomy 8 compared with normal hematopoietic cell growth by autologous lymphocytes in patients with trisomy 8 myelodysplastic syndrome Blood, August 1, 2005; 106(3): 841 - 851. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. R. Martins, L. S. St. John, R. E. Champlin, E. D. Wieder, J. McMannis, J. J. Molldrem, and K. V. Komanduri Functional assessment and specific depletion of alloreactive human T cells using flow cytometry Blood, December 1, 2004; 104(12): 3429 - 3436. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Liesveld, C. T. Jordan, and G. L. Phillips II The Hematopoietic Stem Cell in Myelodysplasia Stem Cells, July 1, 2004; 22(4): 590 - 599. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. G. Rose and N. Berliner T-Cell Large Granular Lymphocyte Leukemia and Related Disorders Oncologist, June 1, 2004; 9(3): 247 - 258. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Giannouli, M. Voulgarelis, E. Zintzaras, A. G. Tzioufas, and H. M. Moutsopoulos Autoimmune phenomena in myelodysplastic syndromes: a 4-yr prospective study Rheumatology, May 1, 2004; 43(5): 626 - 632. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. C. Bagby, J. M. Lipton, E. M. Sloand, and C. A. Schiffer Marrow Failure Hematology, January 1, 2004; 2004(1): 318 - 336. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Mufti, A. F. List, S. D. Gore, and A. Y.L. Ho Myelodysplastic Syndrome Hematology, January 1, 2003; 2003(1): 176 - 199. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2002 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||