|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Prepublished online as a Blood First Edition Paper on August 22, 2002; DOI 10.1182/blood-2002-03-0782.
GENE THERAPY
From the Institut National de la Santé et de la
Recherche Médicale (INSERM) U429, Hôpital
Necker-Enfants Malades; INSERM U277, Institut Pasteur; and
Laboratoire d'Anatomie Pathologique, Hôpital Necker-Enfants
Malades, Paris, France; Genethon III-Unité de Recherche
Associée au Centre National de Recherche Scientifique (CNRS URA)
1923, Evry, France; and the Division of Research Immunology/BMT,
Childrens Hospital, Los Angeles, CA.
Patients with mutations of either RAG-1 or RAG-2 genes
suffer from severe combined immunodeficiency (SCID) characterized by the lack of T and B lymphocytes. The only curative treatment today consists of hematopoietic stem cell (HSC) transplantation, which is
only partially successful in the absence of an HLA genoidentical donor,
thus justifying research to find an alternative therapeutic approach.
To this end, RAG-2-deficient mice were used to test whether
retrovirally mediated ex vivo gene transfer into HSCs could provide
long-term correction of the immunologic deficiency. Murine
RAG-2 Severe combined immunodeficiencies (SCID),
the most severe form of primary immunodeficiencies, consist of a group
of diseases characterized by an early block in T-cell differentiation.
At least 9 different forms of human SCID have now been recognized and
can be grouped according to inheritance, phenotype, and genes involved1 (ie, Approximately 20% of SCID are characterized by a deficiency in both T-
and B-cell lineages (T The RAG-1 and RAG-2 proteins initiate the somatic recombination process
of the gene elements encoding the variable (V), diversity (D), and
joining (J) segments that lead to the generation of a diverse
repertoire of antigen-specific receptors at the surface of T and B
lymphocytes, essential for adaptative immune responses. The RAG-1/2
complex introduces a DNA double-strand break (DSB) in the recombination
signal sequences (RSS) composed of conserved heptamer and nonamer
sequences separated by either 12 or 23 base pairs (bp) flanking all V,
D, and J segments. During the subsequent step, a non-lymphoid-specific
process is responsible for the repair of this DSB.10 RAG-1
and RAG-2 gene knock-out murine models exhibit an identical phenotype
to that of the human condition, with a severe and early blockade of
both T-cell development (at the triple-negative
CD3 Mice
Retroviral supernatant
Transduction of bone marrow cells Bone marrow cells were flushed from both tibias and femora of donor mice and treated with a 0.75% NH4Cl (Sigma-Aldrich, St Louis, MO) solution in Tris (tris(hydroxymethyl)aminomethane buffer) (Sigma-Aldrich) to remove red blood cells (RBCs). Cells were marked with phycoerythrin (PE)-conjugated Sca1 Ly6A/E (D7) antibody (Becton Dickinson, San Jose, CA). Sca-1-positive cells were then purified using an anti-PE magnetic selection kit (Miltenyi Biotech, Auburn, CA).Cells were cultured in serum-free Stemspan medium (Stem Cell
Technologies) for 24 hours at 1 × 106 cells/mL in
flat-bottomed P96 wells coated with 25 µg/mL recombinant human
fibronectin fragment (RetroNectin CH-296; Takara Biomedicals, Shiga,
Japan) in the presence of the following recombinant cytokines: murine
stem cell factor (mSCF) 300 ng/mL (Stem Cell Technologies), human
FMS-like tyrosine kinase 3 ligand (hFlt3-L) 300 ng/mL, and human
megakaryocyte growth and development factor (hMGDF) 100 ng/mL (Amgen,
Thousand Oaks, CA), mIL-6 50 ng/mL, mIL-11 50 ng/mL (R&D, Minneapolis,
MN), and hIL-7 100 ng/mL (kindly provided by Biotech Inflection Point
Company, Paris, France). Then 3 transduction cycles were
performed at 24-hour intervals by replacing the medium with retroviral supernatant supplemented with the same cytokines and
protamine sulfate (3 µg/mL) (Choay, Gentilly, France). One million cells were injected intravenously under halothane
anesthesia to each RAG-2-deficient mouse less than 2 hours after 3-Gy
total body irradiation (described in text as "RAG-2-transduced
mice"). Three positive control groups were obtained by transplanting
1 × 106, 1 × 105, or
1 × 104 mock-transduced wild-type C57BL/6 cells
into 3 Gy irradiated RAG-2-deficient mice. Secondary grafts were
performed 6 months after initial RAG-2-transduced bone marrow
transplantation as follows: bone marrow cells were treated with an
NH4Cl solution, and a total of 5 × 106 bone marrow cells
were reinjected intravenously to 3 Gy irradiated RAG-2 Flow cytometry analysis Cells for flow cytometry analysis were obtained from blood, thymus, bone marrow, spleen, and lymph nodes. All axillary, cervical, abdominal, and mesenteric lymph node cells were taken. Cells were counted and stained with the following rat antimouse monoclonal antibodies (Pharmingen, San Diego, CA): fluorescein isothiocyanate (FITC)-conjugated CD3 (145-2C11),
biotin-conjugated CD4 (GK1.5), PE-conjugated CD8 (53-5.8),
biotin-conjugated T-cell receptor  (TCR) (H57-597),
PE-conjugated CD45R/B220 (RA3-6B2), and goat anti-mouse
FITC-conjugated IgM (Jackson ImmunoResearch Laboratory, West Grove,
PA). When necessary, streptavidin-conjugated tricolor (CALTAG,
Burlingame, CA) was added. To prevent possible binding to Fc receptors,
peripheral blood cells were preincubated with antimouse CD16/CD32
monoclonal antibodies (MoAbs) (2,4G2; Becton Dickinson) and after
staining were treated with fluorescence-activated cell-sorter
(FACS)-lysing solution (Becton Dickinson) to remove RBCs. Analyses
were performed on a FACScalibur (Becton Dickinson) using Cellquest
software (Becton Dickinson).
Serum immunoglobulin quantification and T-cell-dependent responses IgM and IgG immunoglobulin levels were obtained by quantitating serial dilutions of serum samples with an enzyme-linked immunosorbent assay (ELISA) kit according to the manufacturer's instructions (Bethyl Laboratories, Montgomery, TX). T-cell-dependent responses were obtained by immunizing mice intraperitoneally with 50 µg of a keyhole limpet hemocyanin (KLH) (Sigma-Aldrich) solution in Alum (Sigma-Aldrich). Mice were boosted with a 50 µg KLH intraperitoneal injection 21 days after immunization, and serum samples were drawn 28 days after immunization. For local immunization, 50 µg KLH was mixed with 30 µL complete Freund adjuvant (Sigma-Aldrich) and injected in the front footpads of the mice under halothane anesthesia. Mice were killed 8 days after injection, and lymph node cells were isolated and cultured at a concentration of 1 × 106 cells/mL in culture medium supplemented with increasing levels of soluble KLH (0, 0.125, 0.4, 2, 10, 50 ng/mL). Anti-KLH-specific immunoglobulins were detected by precoating the wells with KLH at a concentration of 50 µg/mL before ELISA detection.Lymphocyte proliferation assays Spleen or lymph node cells were cultured at 1 × 106 cells/mL in supplemented Dulbecco modified Eagle medium (DMEM) (GibcoBRL, Renfrewshire, Scotland) with 10% FBS (GibcoBRL) for 3 days in the presence of concanavalin A (conA, 5 µg/mL; Sigma-Aldrich) or for 4 days in the presence of lipopolysaccharide (LPS, 50 µg/mL; Sigma-Aldrich). Mixed lymphocytes reactions were performed with 2 × 106 cells/mL spleen cells for 5 days in the presence of 4.106 cells/mL fully allogenic C3H 20-Gy irradiated spleen cells. Proliferation was assayed by incorporation of [3H] thymidine (2 µCi/mL [0.074 MBq]; Amersham, Saclay, France). After overnight incubation, cells were transferred onto filters and placed in 1-mL scintillation liquid (Packard Biosciences, Groningen, The Netherlands). Uptake of [3H] thymidine was determined with a scintillation-counter (Packard Biosciences).
Provirus integration study Integration study was performed on RAG-2-transduced Sca1+ cells and on 2 different lineage subsets: lymphoid and myeloid. Briefly, 10 months after transplantation, splenocytes from 3 RAG-2-transduced mice were marked with FITC-conjugated CD3
(145-2C11; Pharmingen) and PE-conjugated CD11b (Mac1a, M1/70;
Pharmingen). CD3+ and CD11b+ cells were then
sorted with a FACStar (Becton Dickinson). Genomic DNA was extracted
using a High Pure DNA PCR Template kit (Roche Diagnostics,
Indianapolis, IN). Transgene was detected with a real-time quantitative
PCR system (ABI Prism 7700 Sequence Detector Systems, Applied
Biosystems, Foster City, CA) by using the following primers:
1870MNDRAG2.F (AAGTAGACGGCATCGCAGCT), which is specific for the MND
retroviral sequence, 2014MNDRAG2.R (CAGTGAGAAGCCTGG), located inside
the RAG-2 transgene, and the fluorescent probe: 1903MNDRAG2.P
(CCCACGTGAAGGCTGCCGACC). Total DNA quantification was performed by
using the following primers located in the fifth exon of the murine
Titine gene: M261MEX5.M (TTCAGTCATGCTGCTAGCGC), M139MEX5.A
(AAAACGAGCAGTGACGTGAGC) and probe: M161MEX5.P
(TGCACGGAAGCGTCTCGTCTCAGTC). The results obtained from Titine
quantification were used to normalize the number of copies back to the
number of cells.
Histology For histologic studies, gut, spleen, and thymus tissues were fixed in formaldehyde, embedded in paraffin, and sections were stained with periodic acid-Schiff. For immunohistochemical studies, tissues were frozen in liquid nitrogen and fixed in acetone. Cryostat sections were then stained with rat anti-CD8 supernatant (T1B105; American
Type Culture Collection [ATCC], Manassas, VA) or rat anti-CD4
supernatant (GK1.5; ATCC) followed by biotinylated mouse anti-rat IgG
mAb (Jackson ImmunoResearch Laboratory, West Grove, PA),
streptavidin-biotinylated horseradish peroxidase complex (Amersham),
and diaminonobenzidine reagent (Enzo Diagnostics, New York, NY). Slides
were finally counterstained with methyl green.
Analysis of TCR -specific primer along with 24 V-specific primers. PCR products
were then subjected to a run-off reaction using a fluorescent
C-specific primer.18 Labeled products were resolved on
an automated 373A sequencer (Perkin Elmer, Foster City, CA). The
fluorescent intensity of each band was recorded and analyzed using
Immunoscope software (developed by C. Pannetier, Paris,
France).19
Statistical analysis Results were analyzed by Mann-Whitney tests, using InStat (GraphPad Software, San Diego, CA). Results were considered significant when P < .05.
Immunological development of RAG-2-transduced mice White blood cells were analyzed every month during the first 3 months after transplantation in RAG-2-transduced mice as well as in control mock-transduced mice. In all RAG-2-transduced mice (n = 21), mature T and B cells could be detected 4 to 8 weeks after transplantation and remained detectable at stable levels for more than one year (Figure 1). The kinetics of T- and B-lymphocyte development observed in RAG-2-transduced mice were compared to those observed following transplantation of 1 × 106, 1 × 105, or 1 × 104 mock-transduced C57BL/6 RAG-2+/+ bone marrow Sca1+ cells to 3 Gy-irradiated RAG-2 /mice.
Briefly, 2 to 6 months after bone marrow transplantation, peripheral
B220+IgM+ cells were found in significantly
higher counts (P < .01) in the blood of mice transplanted
with 1 × 106 mock-transduced cells (more than
1400 cells/mm3, data not shown) than in that of
RAG-2-transduced mice. During the same posttransplantation period,
peripheral T CD4+ and CD8+ cells were in
significantly lower numbers (P < .02) in the blood of
mice transplanted with 1 × 104 mock-transduced
cells than in that of RAG-2-transduced mice. Overall (Figure 1), after
transplantation of RAG-2-transduced cells, peripheral
B220+IgM+, CD4+, and
CD8+ cell counts were not significantly different after
1 × 105 mock-transduced cell transplantation (further
simply referred to as "mock-transduced" mice). Peripheral organs of
both RAG-2-transduced and mock-transduced mice were tested for periods
ranging from 6 months to one year after transplantation. Cellularity of
peripheral organs of RAG-2-transduced mice was of lower magnitude than
that of mock-transduced controls (Table
1), while the distributions of
CD3+CD4+ and CD3+CD8+
subpopulations in lymph nodes and spleen were similar to those of
mock-transduced controls (Figure 2 and
Table 2). In 3 of 11 RAG-2-transduced mice tested, the thymus contained a normal percentage of CD4+CD8+ double-positive cells (Figure 2),
while CD4+CD8+ double-positive cells were
detectable but in low percentage in the thymus of the other mice. To
assess the development of intraepithelial lymphocytes (IEL) in
RAG-2-transduced mice, gut sections were stained with CD4 and CD8
antibodies. This experiment showed the presence of CD4+ and
CD8+ IEL after gene transfer, which are absent in
RAG-2/ mice (Figure 3).
Study of provirus integration Provirus copies were quantified in Sca1+ cells before injection. RAG-2-transduced Sca1+ cells contained a mean of 0.6 copy/cell, indicating an overall low transduction rate. To assess the possible existence of a selective advantage of RAG-2-transduced cells over nontransduced RAG-2-deficient cells, provirus copies were quantified by real-time quantitative PCR in both lymphoid (CD3+) and nonlymphoid (Mac1+) lineages 9 months after gene transfer. The CD3+ fraction of RAG-2-transduced mice spleen cells contained a mean of 2.4 copies/cell, while the Mac1+ fraction contained a mean of 0.02 copy/cell. The ratio of transduced cells is thus many-fold greater in the lymphoid fraction than in the myeloid fraction, indicating that a selective advantage was conferred to RAG-2-transduced lymphoid cells. Provirus copies were also quantified in Sca1+ cells before injection.TCR repertoire study and T-cell function Immunoscope analyses of splenocytes from C57BL/6 wild-type mice, mock-transduced mice, and RAG-2-transduced mice were performed to analyze the TCR V diversity of peripheral T cells. No significative difference in V diversity was observed, showing that RAG-2 gene transfer had restored a broad T-cell differentiation capacity with a
diverse T-cell repertoire (Figure 4).
Recovered T lymphocytes were functional, as proven by the observed
proliferative response of splenocytes stimulated with conA (Figure 5A)
or with allogeneic cells (Figure 5B) when
tested 4 to 6 months after gene transfer. As expected, RAG-2/
lymphocytes failed to proliferate with any of these stimuli. After
subcutaneous KLH immunization, lymphocytes isolated from draining lymph
nodes of RAG-2-transduced mice were shown to proliferate in the
presence of KLH (Figure 6). Although the
cellularity of the lymphoid organs of RAG-2-transduced mice was less
than that of mock-transduced mice (Table 1), these results provide
evidence for restored T-lymphocyte function and a diverse TCR
repertoire of RAG-2/ mice after RAG-2 gene transfer.
B-cell function B220+sIgM+ B cells developed in all animals after gene transfer, with variable B-cell numbers in the different compartments (blood, spleen, and lymph nodes). B-cell counts remained stable throughout the study. Serum levels of IgG and IgM immunoglobulins were found to be close to those of C57BL/6 control mice from 2 to 4 months after gene transfer (Figure 7A-B) and remained stable until the last time point of analysis (ie, one year after gene transfer), while RAG-2/ mice sera did not contain any detectable immunoglobulins.
Splenocytes from RAG-2-transduced mice proliferated in the presence of
LPS (data not shown). RAG-2-transduced mice immunized with KLH
produced antigen-specific IgM and IgG antibodies 28 days after
immunization with titers similar to immunized C57BL/6 control mice
(Figure 7B).
Stability of lymphoid reconstitution after RAG-2 gene transfer RAG-2-transduced mice maintained functional levels of lymphocytes in all peripheral organs 10 to 13 months after gene transfer (n = 4). Six months after gene transfer, 4 RAG-2-transduced mice were maintained in a normal nonpathogen-free animal facility and survived well for an additional 3 months until being killed. To assess the presence of RAG-2-transduced HSCs, bone marrow cells from 7-month-old RAG-2-transduced mice were used to perform secondary transplantations into RAG-2/ mice. Two months later, the thymuses of 2 of 7 mice that received transplants were repopulated by
double-positive CD4+CD8+ cells (Figure 2).
Peripheral T- and B-cell compartments were restored, as well as
antibody production in all secondary treated mice (Figure
7A-B).
Toxicity No lymphoid malignancies were observed in the 11 RAG-2-transduced mice killed between 6 months and one year after gene transfer. No pathologic changes (diarrhea, loss of weight, hair color, and aspect) associated with RAG-2 transduction was observed during this study, which included 21 mice. No macroscopic alterations, either in volume or in color, of the different organs were noticed following treatment. The histologic study of spleen, lymph nodes, and thymuses of RAG-2-transduced mice showed no structural anomalies after gene transfer (data not shown). Follicles were present in the spleen of RAG-2-transduced mice, and no tumors or abnormal lymphoid infiltrations were detected.
We have shown that ex vivo RAG-2 retroviral gene transfer into
RAG-2 Importantly, this protocol matches as closely as possible the
conditions currently used in human settings since no 5'-fluorouracile was used prior to bone marrow harvesting, and Sca1+
purification is a procedure partially comparable to CD34+
human bone marrow purification. It should also be noticed that both
primary and secondary RAG-2 Another major concern raised by RAG-2 retroviral gene transfer was the potential toxicity related to the uncontrolled expression of the RAG-2 gene in several different lineages. The fact that RAG-2 protein is exclusively functional in cooperation with the RAG-1 protein argued against this possibility. Indeed, 2 models of double transgenic mice carrying both RAG-1 and RAG-2 genes under the control of the proximal lck promoter25 or the ubiquitous major histocompatibility complex (MHC) class I H2k promoter,26 respectively, showed pathologic changes (ie, lymphoadenopathy, splenomegaly, and small body weight), whereas no pathologic changes were reported in single transgenic mice. It is also worth mentioning that in the former study,25 no case of lymphoma was reported in more than 300 lck-driven single transgenic RAG-1 and RAG-2 mice maintained over a period of two and a half years. In our experience, no evidence of myeloproliferation or lymphoproliferation or of autoimmune manifestations was found in the long-term reconstituted animals. Further investigations are pending to exclude the presence of illegitimate V(D)J recombination events in reconstituted animals. Overall, it is shown that retroviral-mediated RAG-2 gene transfer leads
to development of competent T- and B-cell compartments in RAG-2
The authors wish to thank Françoise Selz for the FACS sorting, Corinne Evra for her help at the animal facility, and Nicole Brousse, Michèle Leborgne, and Gerard Pivert for histology. We also are grateful to Frédérique Carlier, Christophe Hue, Fabian Gross, and Chantal Lagresle for their helpful assistance, to Dr Isabelle André-Schmutz for her help in the statistical analysis of the data, and to Dr Benedita Rocha for helpful discussions during the course of this work.
Submitted March 13, 2002; accepted July 1, 2002.
Prepublished online as Blood First Edition Paper, August 22, 2002; DOI 10.1182/blood-2002-03-0782.
Supported in part by INSERM, the Association Française contre les Myopathies, the Fondation Louis Jeantet, the Jeffrey Modell Foundation, and a grant from the Agence Nationale de Recherches sur le Syndrome d'Immunodéficience Acquise (SIDA) (ANRS) (F.Y.).
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Marina Cavazzana-Calvo, INSERM U429, Hôpital Necker-Enfants Malades, 149 rue de Sèvres, 75743 Paris Cedex 15, France; e-mail: cavazzan{at}necker.fr.
1. Fischer A. Primary immunodeficiency diseases: an experimental model for molecular medicine. Lancet. 2001;357:1863-1869[CrossRef][Medline] [Order article via Infotrieve]. 2. Bertrand Y, Landais P, Friedrich W, et al. Influence of severe combined immunodeficiency phenotype on the outcome of HLA nonidentical, T-cell-depleted bone marrow transplantation: a retrospective European survey from the European group for bone marrow transplantation and the European society for immunodeficiency. J Pediatr. 1999;134:740-748[CrossRef][Medline] [Order article via Infotrieve].
3.
Buckley RH, Schiff SE, Schiff RI, et al.
Hematopoietic stem-cell transplantation for the treatment of severe combined immunodeficiency.
N Engl J Med.
1999;340:508-516
4.
Cavazzana-Calvo M, Hacein-Bey S, de Saint Basile G.
Gene therapy of human severe combined immunodeficiency (SCID)-X1 disease.
Science.
2000;288:669-672
5.
Hacein-Bey-Abina S, Le Deist F, Carlier F.
Sustained correction of X-linked severe combined immunodeficiency by ex vivo gene therapy.
N Engl J Med.
2002;346:1185-1193
6.
Schwarz K, Gauss GH, Ludwig L, et al.
RAG mutations in human B cell-negative SCID.
Science.
1996;274:97-99
7.
Corneo B, Moshous D, Gungor T, et al.
Identical mutations in RAG1 or RAG2 genes leading to defective V(D)J recombinase activity can cause either T-B-severe combined immune deficiency or Omenn syndrome.
Blood.
2001;97:2772-2776
8.
Corneo B, Moshous D, Callebaut I, et al.
Three-dimensional clustering of human RAG2 gene mutations in severe combined immune deficiency.
J Biol Chem.
2000;275:12672-12675
9.
Villa A, Sobacchi C, Notarangelo LD, et al.
V(D)J recombination defects in lymphocytes due to RAG mutations: severe immunodeficiency with a spectrum of clinical presentations.
Blood.
2001;97:81-88
10.
Oettinger MA, Schatz DG, Gorka C, Baltimore D.
RAG-1 and RAG-2, adjacent genes that synergistically activate V(D)J recombination.
Science.
1990;248:1517-1523 11. Mombaerts P, Iacomini J, Johnson RS, Herrup K, Tonegawa S, Papaioannou VE. RAG-1-deficient mice have no mature B and T lymphocytes. Cell. 1992;68:869-877[CrossRef][Medline] [Order article via Infotrieve]. 12. Shinkai Y, Rathbun G, Lam KP, et al. RAG-2-deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement. Cell. 1992;68:855-867[CrossRef][Medline] [Order article via Infotrieve]. 13. Hiom K, Melek M, Gellert M. DNA transposition by the RAG1 and RAG2 proteins: a possible source of oncogenic translocations. Cell. 1998;94:463-470[CrossRef][Medline] [Order article via Infotrieve].
14.
Robbins PB, Skelton DC, Yu XJ, Halene S, Leonard EH, Kohn DB.
Consistent, persistent expression from modified retroviral vectors in murine hematopoietic stem cells.
Proc Natl Acad Sci U S A.
1998;95:10182-10187 15. Hacein-Bey S, Gross F, Nusbaum P, et al. Optimization of retroviral gene transfer protocol to maintain the lymphoid potential of progenitor cells. Hum Gene Ther. 2001;12:291-301[CrossRef][Medline] [Order article via Infotrieve].
16.
Matsunaga T, Hirayama F, Yonemura Y, Murray R, Ogawa M.
Negative regulation by interleukin-3 (IL-3) of mouse early B-cell progenitors and stem cells in culture: transduction of the negative signals by betac and betaIL-3 proteins of IL-3 receptor and absence of negative regulation by granulocyte-macrophage colony-stimulating factor.
Blood.
1998;92:901-907 17. Kondo M, Weissman IL, Akashi K. Identification of clonogenic common lymphoid progenitors in mouse bone marrow. Cell. 1997;91:661-672[CrossRef][Medline] [Order article via Infotrieve]. 18. Pannetier C, Even J, Kourilsky P. T-cell repertoire diversity and clonal expansions in normal and clinical samples. Immunol Today. 1995;16:176-181[CrossRef][Medline] [Order article via Infotrieve].
19.
Pannetier C, Cochet M, Darche S, Casrouge A, Zoller M, Kourilsky P.
The sizes of the CDR3 hypervariable regions of the murine T-cell receptor beta chains vary as a function of the recombined germ-line segments.
Proc Natl Acad Sci U S A.
1993;90:4319-4323 20. Rocha B, Penit C, Baron C, Vasseur F, Dautigny N, Freitas AA. Accumulation of bromodeoxyuridine-labeled cells in central and peripheral lymphoid organs: minimal estimates of production and turnover rates of mature lymphocytes. Eur J Immunol. 1990;20:1697-1708[Medline] [Order article via Infotrieve].
21.
Agenes F, Freitas AA.
Transfer of small resting B cells into immunodeficient hosts results in the selection of a self-renewing activated B cell population.
J Exp Med.
1999;189:319-330
22.
Soudais C, Shiho T, Sharara LI, et al.
Stable and functional lymphoid reconstitution of common cytokine receptor gamma chain deficient mice by retroviral-mediated gene transfer.
Blood.
2000;95:3071-3077 23. Bunting KD, Sangster MY, Ihle JN, Sorrentino BP. Restoration of lymphocyte function in Janus kinase 3-deficient mice by retroviral-mediated gene transfer. Nat Med. 1998;4:58-64[CrossRef][Medline] [Order article via Infotrieve]. 24. Kohn DB, Hershfield MS, Carbonaro D, et al. T lymphocytes with a normal ADA gene accumulate after transplantation of transduced autologous umbilical cord blood CD34+ cells in ADA-deficient SCID neonates. Nat Med. 1998;4:775-780[CrossRef][Medline] [Order article via Infotrieve]. 25. Wayne J, Suh H, Misulovin Z, Sokol KA, Inaba K, Nussenzweig MC. A regulatory role for recombinase activating genes, RAG-1 and RAG-2, in T cell development. Immunity. 1994;1:95-107[CrossRef][Medline] [Order article via Infotrieve]. 26. Barreto V, Marques R, Demengeot J. Early death and severe lymphopenia caused by ubiquitous expression of the Rag1 and Rag2 genes in mice. Eur J Immunol. 2001;31:3763-3772[CrossRef][Medline] [Order article via Infotrieve]. 27. Moshous D, Callebaut I, de Chasseval R, et al. Artemis, a novel DNA double-strand break repair/V(D)J recombination protein, is mutated in human severe combined immune deficiency. Cell. 2001;105:177-186[CrossRef][Medline] [Order article via Infotrieve].
© 2002 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  G. Mostoslavsky, A. J. Fabian, S. Rooney, F. W. Alt, and R. C. Mulligan Complete correction of murine Artemis immunodeficiency by lentiviral vector-mediated gene transfer PNAS, October 31, 2006; 103(44): 16406 - 16411. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Neff, B. C. Beard, and H.-P. Kiem Survival of the fittest: in vivo selection and stem cell gene therapy Blood, March 1, 2006; 107(5): 1751 - 1760. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Lagresle-Peyrou, F. Yates, M. Malassis-Seris, C. Hue, E. Morillon, A. Garrigue, A. Liu, P. Hajdari, D. Stockholm, O. Danos, et al. Long-term immune reconstitution in RAG-1-deficient mice treated by retroviral gene therapy: a balance between efficiency and toxicity Blood, January 1, 2006; 107(1): 63 - 72. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. S. Strom, S. J. Turner, S. Andreansky, H. Liu, P. C. Doherty, D. K. Srivastava, J. M. Cunningham, and A. W. Nienhuis Defects in T-cell-mediated immunity to influenza virus in murine Wiskott-Aldrich syndrome are corrected by oncoretroviral vector-mediated gene transfer into repopulating hematopoietic cells Blood, November 1, 2003; 102(9): 3108 - 3116. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2002 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
/
Top
Abstract
Introduction
c, ADA, Artemis, ZAP-70, JAK-3, IL7R
CD4
) or presence (
) of
concanavalin A. (B) Splenocyte proliferation in the absence (
100-fold enrichment of
provirus copies in the T-cell population as compared to the myeloid
cell population of RAG-2-transduced mice supports the likelihood
of a strong selective advantage of RAG-2-transduced cells over
nontransduced cells, as reported in 2 other immunodeficient mouse
models