| |
|
|
|
|
|
|
|||
|
Prepublished online as a Blood First Edition Paper on July 25, 2002; DOI 10.1182/blood-2002-04-1136.
IMMUNOBIOLOGY
From the Department of Pediatrics, Angiogenesis and
Vascular Development, Graduate School of Medical Science and School of
Medicine, Kanazawa University and School of Health Sciences, Faculty of
Medicine, Kanazawa University, Kanazawa, Japan.
Whereas most peripheral CD8+ CD8 is a coreceptor that recognizes the
nonpolymorphic In healthy individuals, most thymocytes and peripheral T cells
highly express the heterodimeric form of CD8.17 These
CD8 Although there has been much controversy as to the origin and the
functional roles of these cells, there is increasing evidence in recent
literature to suggest that CD8 Monoclonal antibodies
Cell preparation and flow cytometric analysis
Flow cytometric detection of cytokine production and intracellular staining for cytotoxic granule constituents TCR![]() -depleted and CD16-depleted PBMNCs
(TCR![]() ![]() CD16 PBMNCs) were stimulated for
6 hours with 10 ng/mL phorbol myristate acetate (PMA) and 500 ng/mL A23187 in the presence of 1 µg/mL monensin (Sigma, St Louis,
MO). After cell surface staining with PE-conjugated CD8 and
RPE-Cy5-conjugated CD8 , cells were fixed and permeabilized with
Cytofix/Cytoperm Plus Kit (BD Pharmingen) per the manufacturer's instruction. Staining of the cytoplasm with FITC-conjugated
anti-IFN- or anti-IL-2 mAb followed. Separately, freshly isolated
TCR![]() ![]() CD16 PBMNCs were treated with
anti-CD8 mAb followed by FITC-conjugated goat antimouse antibodies.
They were further stained with RPE-Cy-5-conjugated anti-CD8 mAbs
after blocking with normal mouse serum. After fixation and
permeabilization, the cells were stained with PE-conjugated antiperforin, antigranzyme B, or anti-TIA-1 mAbs.
RNA extraction and cDNA preparation Total RNA was extracted from separated CD8+![]() T
cells with TRIZOL reagent following the manufacturer's instructions
(Gibco BRL, Bethesda, MD). The RNA was then reverse-transcribed into cDNA in a reaction primed with oligo(dt)12-18 using SuperScript II
reverse transcriptase as recommended by the manufacturer (Gibco BRL).
Sj TREC quantification Sj TRECs were quantified in sorted CD8+![]()
T-cell subsets by a real-time quantitative polymerase chain reaction
(PCR) method as described previously.26,27 Sorted cells
were lysed in 100 µg/mL proteinase K (Wako Pure Chemical Industries,
Osaka, Japan) for 1 hour at 56°C and then 10 minutes at 95°C at
107 cells/mL. Then PCR was carried out on 5 µL cell
lysate in a spectrofluorometric thermal cycler (ABI PRISM 7700, Applied
Biosystems, Osaka, Japan) under the following conditions: 50°C for 2 minutes followed by 95°C for 10 minutes, after which 50 cycles of
amplification were carried out (95°C for 15 seconds, 60°C for 1 minute). The sequences of the primers and probe used were the
following: forward primer GGAAAACACAGTGTGACATGGA, reverse primer
GTCAACAAAGGTGATGCCACAT, and the probe
FAM-CCTGTCTGCTCTTCATTCACCGTTCTCA-TAMRA. A standard curve was plotted,
and Sj TREC values for samples were calculated by ABI PRISM 7700 software.
CDR3 spectratyping CDR3 spectratyping was pursued as previously described.28 Briefly, cDNA was amplified by PCR through 35 cycles (94°C for 1 minute, 55°C for 1 minute, and 72°C for 1 minute) with a primer specific to 24 different BV subfamilies (BVs 1-2029 and BVs21-2430) and a fluorescent BC primer.29 The fluorescent PCR products were mixed with formamide and the size standard (GeneScan-500 TAMRA, Applied Biosystems). After denaturation for 2 minutes at 90°C, the products were analyzed with an automated 310 DNA sequencer (Applied Biosystems), and the data were analyzed with GeneScan software (Applied Biosystems).The overall complexity within a V Cloning and sequencing of PCR-amplified cDNA The PCR products of some BV cDNA were electrophoresed on an agarose gel and purified using QIAquick Gel Extraction Kit (Qiagen, Tokyo, Japan), and then cloned with TOPO TA Cloning (Invitrogen, Carlsbad, CA). Eleven to 19 colonies containing the insert fragment were randomly selected. Purified with QIAprep Spin Miniprep Kit (Qiagen), the recombinant plasmids were subjected to fluorescence dye terminator cycle sequencing, and the sequence reactions were analyzed on a 310 DNA sequencer (Applied Biosystems) after removal of the unincorporated fluorescence dye with Centri-Sep Spin Columns (Applied Biosystems).Statistical analysis Association of the percentage of peripheral CD8 + low and CD8![]() ![]() T cells with
age was analyzed using the Spearman rank correlation coefficient. The
Wilcoxon signed rank test was applied to examine statistically
significant differences of CDR3 complexity scores between
subpopulations of different CD8 expression.
CD8 + low and CD8![]() ![]() T cells are
limited in healthy individuals, we first stained PBMNCs with
anti-TCR![]() , anti-CD8 , and anti-CD8 mAbs conjugated to
different fluorochromes in several healthy individuals including cord
blood. CD8 + TCR![]() + cells could be
classified into 3 groups defined by the level of CD8 expression:
CD8 + high, CD8
+ low, and CD8
+![]() , which is CD8![]() . Although
CD8![]() ![]() T cells were negligible and small numbers of
CD8 + low ![]() T cells existed in cord
blood, these populations increased in a 5-year-old child and even more
in an adult (Figure 1). To assess the
developmental changes of CD8 + low and
CD8![]() ![]() T cells, we evaluated the frequency of these
subpopulations in various age groups using more blood samples. In cord
blood, CD8 + low and CD8![]() ![]()
T cells represented a minor population within CD8 +
![]() T cells. These subpopulations increased with advancing age as
expected (P < .01). However, it is notable that
some adults showed levels of CD8 + low and
CD8![]() ![]() T cells as low as neonates (Figure
2).
Correlation of CD8 + ![]() T cells with different levels of
CD8 expression. Before pursuing 3-color flow cytometric analysis, we
depleted CD16+ NK cells and TCR![]() + T cells
from PBMNCs because these cells contain CD8 + cells. The
depletion of CD16+ and TCR![]() + cells yielded
TCR![]() + or CD3+ cells with more than 98%
purity when gated on CD8 (Figure 3A). CD8 + high cells were heterogeneous for the
expression of all the surface antigens analyzed. In the
CD8 + low subpopulation, CD95+,
CD45RO+, and 2B4+ cells became dominant, and
the subset lost CD62L and CCR7 antigens. Most CD8![]() T cells
expressed CD95 and 2B4, but not CD57, CD62L, or CCR7. Although more
than half of 7 adults analyzed had CD8![]() cells, which exclusively
expressed CD45RO, CD27, and CD28, the rest of the individuals possessed
CD8![]() cells that were as much as 30% negative for these surface
antigens (Figure 3B and data not shown).
Cytotoxic granule proteins and cytokine production To further characterize the subpopulations of CD8+![]() T cells with regard to CD8 -chain expression, we analyzed
CD8+ ![]() T cells for the presence of perforin, granzyme
B, and TIA-1. CD8 + high cells were
heterogeneous for the expression of the cytotoxic granule constituents.
CD8 + low cells were also heterogeneous for
the expression of perforin and granzyme B, but the subset entirely
expressed TIA-1. A large number of CD8![]() T cells possessed perforin
and nearly all the cells contained TIA-1, whereas CD8![]() cells did
not contain granzyme B (Figure 4A).
Because cytokine production capacity is also a major factor determining
cell functions, CD8+ CD8 + high,
CD8 + low, and CD8![]() ![]() T cells was
pursued to define the extent of clonal expansion. About
5 × 105 cells of each subpopulation were isolated, and
their cDNA was subjected to PCR amplification with 24 V -specific
primers. TCR spectratypes of CD8 + high
cells exhibited, with a few exceptions, a gaussianlike distribution, indicating that the subset comprises cells with highly diverse and
polyclonal TCR repertoires. The profile of
CD8 + low cells revealed skewed CDR3 size
distribution in some V subfamilies, but about one third of V
subfamilies remained diverse. To a further extent, the majority of V
subfamilies of CD8![]() cells displayed apparently skewed patterns,
many of them with an almost single peak pattern (Figure
5).
To quantify differences in the TCR V
Identical clones exist among
CD8 + low and CD8![]() ![]() T cells are
oligoclonally proliferated cells. Therefore, the PCR products were then
cloned and the nucleotide sequence of CDR3 was determined (Table
1). This analysis also provides the
information if identical clones exist among the subpopulations of
different CD8 expression. In this experiment, we used the cDNA
samples from one donor so that the pruity of each sorted cell fraction was more than 98% and the number was identical for all BVs within a
given cell fraction. In addition, we selected BV21, BV20, and BV14
because these BVs exhibited distinct patterns of spectratypes within
CD8 + high,
CD8 + low, and CD8![]() ![]() T cells
(BV21: polyclonal, polyclonal, and oligoclonal; BV20: polyclonal,
oligoclonal, and oligoclonal; and BV14: oligoclonal, oligoclonal, and
oligoclonal; Figure 7).
As for BV21, 19 CDR3 cDNA clones of
CD8 In BV20, a major clone, SPVSWA, within CD8 Sj TREC concentrations decreased with the down-regulation of
CD8 ![]() ![]() T cells descend from
CD8 + high ![]() T cells, CD8![]() cells
have undergone cell division more than
CD8 + low, and still more than
CD8 + high ![]() T cells. To assess the
relative proliferative history of CD8+ ![]() T-cell
populations defined by the intensity of CD8 expression, we measured
Sj TREC concentrations in CD8 + high,
CD8 + low, and CD8![]() ![]() T-cell
subsets. In all 3 donors examined, Sj TREC levels were higher in
CD8 + high ![]() T cells, and the number
of Sj TREC copies declined with the loss of CD8 expression (Table
2). These results, supporting the
findings of spectratyping analysis, indicate that
CD8 + high ![]() T cells, at least at the
population level, can differentiate to CD8![]() ![]() T cells but not
the opposite way.
In the present paper, we tried to show that peripheral blood
CD8 In cord blood, CD8 Secondly, surface antigen expression, cytotoxic granule constituents,
and cytokine production of CD8+ Perforin, granzyme B, and TIA-1 expression were compatible with the
surface phenotype of CD8 Thirdly, analysis of CDR3 length diversity can be used to define the
extent of clonal expansion within the TCR repertoire.42,43 The TCR V To prove directly that particular CD8+ T cells change the
levels of In contrast to our data, numerous studies have suggested that CD8 However, most recent studies by Leishman et al23 and Devine
et al24 concerning the fate and function of these unique
CD8+ T-cell subpopulations strongly indicate that they
derive from the thymus and are positively selected. Moreover, CD8 In conclusion, the present study demonstrates that the CD8
We thank Ms Mika Kitakata, Ms Tamae Yonezawa, and Ms Harumi Matsukawa for excellent technical help.
Submitted April 15, 2002; accepted July 8, 2002.
Prepublished online as Blood First Edition Paper, July 25, 2002; DOI 10.1182/blood-2002-04-1136.
Supported by a Grant-in-Aid for Scientific Research from the Ministry of Education, Science, and Culture of Japan; and a grant from the Ministry of Health, Labour, and Welfare of Japan, Tokyo.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Akihiro Yachie, 13-1 Takara-machi, Kanazawa, 920-8641 Japan; e-mail: yachie{at}med.kanazawa-u.ac.jp.
1. Gao GF, Tormo J, Gerth UC, et al. Crystal structure of the complex between human CD8alpha(alpha) and HLA-A2. Nature. 1997;387:630-634[CrossRef][Medline] [Order article via Infotrieve]. 2. Zamoyska R. CD4 and CD8: modulators of T-cell receptor recognition of antigen and of immune responses? Curr Opin Immunol. 1998;10:82-87[CrossRef][Medline] [Order article via Infotrieve]. 3. Norment AM, Salter RD, Parham P, Engelhard VH, Littman DR. Cell-cell adhesion mediated by CD8 and MHC class I molecules. Nature. 1988;336:79-81[CrossRef][Medline] [Order article via Infotrieve]. 4. Salter RD, Benjamin RJ, Wesley PK, et al. A binding site for the T-cell co-receptor CD8 on the alpha 3 domain of HLA-A2. Nature. 1990;345:41-46[CrossRef][Medline] [Order article via Infotrieve]. 5. Veillette A, Bookman MA, Horak EM, Bolen JB. The CD4 and CD8 T cell surface antigens are associated with the internal membrane tyrosine-protein kinase p56lck. Cell. 1988;55:301-308[CrossRef][Medline] [Order article via Infotrieve].
6.
Barber EK, Dasgupta JD, Schlossman SF, Trevillyan JM, Rudd CE.
The CD4 and CD8 antigens are coupled to a protein-tyrosine kinase (p56lck) that phosphorylates the CD3 complex.
Proc Natl Acad Sci U S A.
1989;86:3277-3281 7. Wange RL, Samelson LE. Complex complexes: signaling at the TCR. Immunity. 1996;5:197-205[CrossRef][Medline] [Order article via Infotrieve]. 8. Baume DM, Caligiuri MA, Manley TJ, Daley JF, Ritz J. Differential expression of CD8 alpha and CD8 beta associated with MHC-restricted and non-MHC-restricted cytolytic effector cells. Cell Immunol. 1990;131:352-365[CrossRef][Medline] [Order article via Infotrieve]. 9. Moebius U, Kober G, Griscelli AL, Hercend T, Meuer SC. Expression of different CD8 isoforms on distinct human lymphocyte subpopulations. Eur J Immunol. 1991;21:1793-1800[Medline] [Order article via Infotrieve]. 10. Norment AM, Littman DR. A second subunit of CD8 is expressed in human T cells. EMBO J. 1988;7:3433-3439[Medline] [Order article via Infotrieve]. 11. Terry LA, DiSanto JP, Small TN, Flomenberg N. Differential expression and regulation of the human CD8 alpha and CD8 beta chains. Tissue Antigens. 1990;35:82-91[Medline] [Order article via Infotrieve]. 12. Nakayama K, Shinkai YI, Okumura K, Nakauchi H. Isolation and characterization of the mouse CD8 beta-chain (Ly-3) genes: absence of an intervening sequence between V- and J-like gene segments. J Immunol. 1989;142:2540-2546[Abstract]. 13. Parnes JR. Molecular biology and function of CD4 and CD8. Adv Immunol. 1989;44:265-311[Medline] [Order article via Infotrieve]. 14. Bosselut R, Kubo S, Guinter T, et al. Role of CD8beta domains in CD8 coreceptor function: importance for MHC I binding, signaling, and positive selection of CD8+ T cells in the thymus. Immunity. 2000;12:409-418[CrossRef][Medline] [Order article via Infotrieve].
15.
Renard V, Romero P, Vivier E, Malissen B, Luescher IF.
CD8 beta increases CD8 coreceptor function and participation in TCR-ligand binding.
J Exp Med.
1996;184:2439-2444
16.
Wheeler CJ, Chen JY, Potter TA, Parnes JR.
Mechanisms of CD8beta-mediated T cell response enhancement: interaction with MHC class I/beta2-microglobulin and functional coupling to TCR/CD3.
J Immunol.
1998;160:4199-4207
17.
Irie HY, Mong MS, Itano A, et al.
The cytoplasmic domain of CD8 beta regulates Lck kinase activation and CD8 T cell development.
J Immunol.
1998;161:183-191
18.
Irie HY, Ravichandran KS, Burakoff SJ.
CD8 beta chain influences CD8 alpha chain-associated Lck kinase activity.
J Exp Med.
1995;181:1267-1273 19. Kawabata K, Nagasawa M, Morio T, Okawa H, Yata J. Decreased alpha/beta heterodimer among CD8 molecules of peripheral blood T cells in Wiskott-Aldrich syndrome. Clin Immunol Immunopathol. 1996;81:129-135[CrossRef][Medline] [Order article via Infotrieve]. 20. Dulude G, Brochu S, Fontaine P, et al. Thymic and extrathymic differentiation and expansion of T lymphocytes following bone marrow transplantation in irradiated recipients. Exp Hematol. 1997;25:992-1004[Medline] [Order article via Infotrieve]. 21. Honda K, Takada H, Nagatoshi Y, et al. Thymus-independent expansion of T lymphocytes in children after allogeneic bone marrow transplantation. Bone Marrow Transplant. 2000;25:647-652[CrossRef][Medline] [Order article via Infotrieve].
22.
Schmitz JE, Forman MA, Lifton MA, et al.
Expression of the CD8alpha beta-heterodimer on CD8(+) T lymphocytes in peripheral blood lymphocytes of human immunodeficiency virus 23. Leishman AJ, Gapin L, Capone M, et al. Precursors of functional MHC class I- or class II-restricted CD8aa T cells are positively selected in the thymus by agonist self-peptides. Immunity. 2002;16:355-364[CrossRef][Medline] [Order article via Infotrieve].
24.
Devine L, Rogozinski L, Naidenko OV, et al.
The complementarity-determining region-like loops of CD8a interact differently with b2-microglobulin of the class I molecules H-2Kb and thymic leukemia antigen, while similarly with their a3 domains.
J Immunol.
2002;168:3881-3886
25.
Imhof BA, Dunon D, Courtois D, et al.
Intestinal CD8aa and CD8ab intraepithelial lymphocytes are thymus derived and exhibit subtle differences in TCRb repertoires.
J Immunol.
2000;165:6716-6722 26. Hazenberg MD, Otto SA, Cohen Stuart JW, et al. Increased cell division but not thymic dysfunction rapidly affects the T-cell receptor excision circle content of the naive T cell population in HIV-1 infection. Nat Med. 2000;6:1036-1042[CrossRef][Medline] [Order article via Infotrieve].
27.
McFarland RD, Douek DC, Koup RA, Picker LJ.
Identification of a human recent thymic emigrant phenotype.
Proc Natl Acad Sci U S A.
2000;97:4215-4220
28.
Zeng W, Nakao S, Takamatsu H, et al.
Characterization of T-cell repertoire of the bone marrow in immune-mediated aplastic anemia: evidence for the involvement of antigen-driven T-cell response in cyclosporine-dependent aplastic anemia.
Blood.
1999;93:3008-3016
29.
Choi YW, Kotzin B, Herron L, Callahan J, Marrack P, Kappler J.
Interaction of Staphylococcus aureus toxin "superantigens" with human T cells.
Proc Natl Acad Sci U S A.
1989;86:8941-8945
30.
Labrecque N, McGrath H, Subramanyam M, Huber BT, Sekaly RP.
Human T cells respond to mouse mammary tumor virus-encoded superantigen: V beta restriction and conserved evolutionary features.
J Exp Med.
1993;177:1735-1743
31.
Bomberger C, Singh-Jairam M, Rodey G, et al.
Lymphoid reconstitution after autologous PBSC transplantation with FACS-sorted CD34+ hematopoietic progenitors.
Blood.
1998;91:2588-2600 32. Clement LT. Isoforms of the CD45 common leukocyte antigen family: markers for human T-cell differentiation. J Clin Immunol. 1992;12:1-10[CrossRef][Medline] [Order article via Infotrieve]. 33. Young JL, Ramage JM, Gaston JS, Beverley PC. In vitro responses of human CD45RObrightRA- and CD45RO-RAbright T cell subsets and their relationship to memory and naive T cells. Eur J Immunol. 1997;27:2383-2390[Medline] [Order article via Infotrieve].
34.
Sempowski G, Thomasch J, Gooding M, et al.
Effect of thymectomy on human peripheral blood T cell pools in myasthenia gravis.
J Immunol.
2001;166:2808-2817
35.
Fagnoni FF, Vescovini R, Passeri G, et al.
Shortage of circulating naive CD8(+) T cells provides new insights on immunodeficiency in aging.
Blood.
2000;95:2860-2868
36.
Hamann D, Baars PA, Rep MH, et al.
Phenotypic and functional separation of memory and effector human CD8+ T cells.
J Exp Med.
1997;186:1407-1418 37. Sallusto F, Lenig D, Forster R, Lipp M, Lanzavecchia A. Two subsets of memory T lymphocytes with distinct homing potentials and effector functions. Nature. 1999;401:708-712[CrossRef][Medline] [Order article via Infotrieve].
38.
Richards SJ, Jones RA, Roberts BE, Patel D, Scott CS.
Relationships between 2H4 (CD45RA) and UCHL1 (CD45RO) expression by normal blood CD4+CD8 39. Champagne P, Ogg GS, King AS, et al. Skewed maturation of memory HIV-specific CD8 T lymphocytes. Nature. 2001;410:106-111[CrossRef][Medline] [Order article via Infotrieve].
40.
Speiser DE, Colonna M, Ayyoub M, et al.
The activatory receptor 2B4 is expressed in vivo by human CD8(+) effector alphabeta T cells.
J Immunol.
2001;167:6165-6170 41. de Jong R, Brouwer M, Miedema F, van Lier RA. Human CD8+ T lymphocytes can be divided into CD45RA+ and CD45RO+ cells with different requirements for activation and differentiation. J Immunol. 1991;146:2088-2094[Abstract].
42.
Pannetier C, Cochet M, Darche S, Casrouge A, Zoller M, Kourilsky P.
The sizes of the CDR3 hypervariable regions of the murine T-cell receptor beta chains vary as a function of the recombined germ-line segments.
Proc Natl Acad Sci U S A.
1993;90:4319-4323 43. Kou ZC, Puhr JS, Rojas M, McCormack WT, Goodenow MM, Sleasman JW. T-Cell receptor Vbeta repertoire CDR3 length diversity differs within CD45RA and CD45RO T-cell subsets in healthy and human immunodeficiency virus-infected children. Clin Diagn Lab Immunol. 2000;7:953-959[CrossRef][Medline] [Order article via Infotrieve]. 44. Kong F, Chen CH, Cooper MD. Thymic function can be accurately monitored by the level of recent T cell emigrants in the circulation. Immunity. 1998;8:97-104[CrossRef][Medline] [Order article via Infotrieve]. 45. Livak F, Schatz DG. T-cell receptor alpha locus V(D)J recombination by-products are abundant in thymocytes and mature T cells. Mol Cell Biol. 1996;16:609-618[Abstract]. 46. Breit TM, Verschuren MC, Wolvers-Tettero IL, Van Gastel-Mol EJ, Hahlen K, van Dongen JJ. Human T cell leukemias with continuous V(D)J recombinase activity for TCR-delta gene deletion. J Immunol. 1997;159:4341-4349[Abstract].
47.
Wu CJ, Chillemi A, Alyea EP, et al.
Reconstitution of T-cell receptor repertoire diversity following T-cell depleted allogeneic bone marrow transplantation is related to hematopoietic chimerism.
Blood.
2000;95:352-359 48. Degano M, Garcia KC, Apostolopoulos V, Rudolph MG, Teyton L, Wilson IA. A functional hot spot for antigen recognition in a superagonist TCR/MHC complex. Immunity. 2000;12:251-261[CrossRef][Medline] [Order article via Infotrieve]. 49. Jorgensen JL, Esser U, Fazekas de St Groth B, Reay PA, Davis MM. Mapping T-cell receptor-peptide contacts by variant peptide immunization of single-chain transgenics. Nature. 1992;355:224-230[CrossRef][Medline] [Order article via Infotrieve]. 50. Pannetier C, Even J, Kourilsky P. T-cell repertoire diversity and clonal expansions in normal and clinical samples. Immunol Today. 1995;16:176-181[CrossRef][Medline] [Order article via Infotrieve]. 51. Gorski J, Yassai M, Zhu X, et al. Circulating T cell repertoire complexity in normal individuals and bone marrow recipients analyzed by CDR3 size spectratyping: correlation with immune status. J Immunol. 1994;152:5109-5119[Abstract].
52.
Arstila T, Arstila TP, Calbo S, et al.
Identical T cell clones are located within the mouse gut epithelium and lamina propria and circulate in the thoracic duct lymph.
J Exp Med.
2000;191:823-834
53.
Mugnaini EN, Egeland T, Spurkland A, Brinchmann JE.
The T cell receptor repertoire of CD8+CD28
54.
Horiuchi T, Hirokawa M, Kawabata Y, et al.
Identification of the T cell clones expanding within both CD8(+)CD28(+) and CD8(+)CD28( 55. Leclercq G, Plum J. Thymic and extrathymic T cell development. Leukemia. 1996;10:1853-1859[Medline] [Order article via Infotrieve].
56.
Fung-Leung WP, Kundig TM, Ngo K, et al.
Reduced thymic maturation but normal effector function of CD8+ T cells in CD8 beta gene-targeted mice.
J Exp Med.
1994;180:959-967
57.
Nakayama K, Negishi I, Kuida K, et al.
Requirement for CD8 beta chain in positive selection of CD8-lineage T cells.
Science.
1994;263:1131-1133
58.
Rocha B, Vassalli P, Guy-Grand D.
Thymic and extrathymic origins of gut intraepithelial lymphocyte populations in mice.
J Exp Med.
1994;180:681-686 59. Hamerman JA, Page ST, Pullen AM. Distinct methylation states of the CD8 beta gene in peripheral T cells and intraepithelial lymphocytes. J Immunol. 1997;159:1240-1246[Abstract].
60.
Regnault A, Cumano A, Vassalli P, Guy-Grand D, Kourilsky P.
Oligoclonal repertoire of the CD8 alpha alpha and the CD8 alpha beta TCR-alpha/beta murine intestinal intraepithelial T lymphocytes: evidence for the random emergence of T cells.
J Exp Med.
1994;180:1345-1358
© 2002 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
A. Berndt, J. Pieper, and U. Methner Circulating {gamma}{delta} T Cells in Response to Salmonella enterica Serovar Enteritidis Exposure in Chickens Infect. Immun., July 1, 2006; 74(7): 3967 - 3978. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-R. Kim, M. S. Hong, J. M. Dan, and I. Kang Altered IL-7R{alpha} expression with aging and the potential implications of IL-7 therapy on CD8+ T-cell immune responses Blood, April 1, 2006; 107(7): 2855 - 2862. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Takahashi, S. Dejbakhsh-Jones, and S. Strober Expression of CD161 (NKR-P1A) Defines Subsets of Human CD4 and CD8 T Cells with Different Functional Activities J. Immunol., January 1, 2006; 176(1): 211 - 216. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Wada, S. H. Schurman, E. K. Garabedian, A. Yachie, and F. Candotti Analysis of T-cell repertoire diversity in Wiskott-Aldrich syndrome Blood, December 1, 2005; 106(12): 3895 - 3897. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Wada, T. Toma, H. Okamoto, Y. Kasahara, S. Koizumi, K. Agematsu, H. Kimura, A. Shimada, Y. Hayashi, M. Kato, et al. Oligoclonal expansion of T lymphocytes with multiple second-site mutations leads to Omenn syndrome in a patient with RAG1-deficient severe combined immunodeficiency Blood, September 15, 2005; 106(6): 2099 - 2101. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Attinger, L. Devine, Y. Wang-Zhu, D. Martin, J.-h. Wang, E. L. Reinherz, M. Kronenberg, H. Cheroutre, and P. Kavathas Molecular Basis for the High Affinity Interaction between the Thymic Leukemia Antigen and the CD8{alpha}{alpha} Molecule J. Immunol., March 15, 2005; 174(6): 3501 - 3507. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Nishimura, M. Shimojima, E. Sato, Y. Izumiya, Y. Tohya, T. Mikami, and T. Miyazawa Downmodulation of CD3{varepsilon} expression in CD8{alpha}+{beta}- T cells of feline immunodeficiency virus-infected cats J. Gen. Virol., September 1, 2004; 85(9): 2585 - 2589. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. T. Madakamutil, U. Christen, C. J. Lena, Y. Wang-Zhu, A. Attinger, M. Sundarrajan, W. Ellmeier, M. G. von Herrath, P. Jensen, D. R. Littman, et al. CD8{alpha}{alpha}-Mediated Survival and Differentiation of CD8 Memory T Cell Precursors Science, April 23, 2004; 304(5670): 590 - 593. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2002 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||