Prepublished online as a Blood First Edition Paper on July 25, 2002; DOI 10.1182/blood-2002-04-1136.
Previous Article | Table of Contents | Next Article 
Blood, 1 December 2002, Vol. 100, No. 12, pp. 4090-4097
IMMUNOBIOLOGY
CD8 memory effector T cells descend directly from clonally
expanded CD8 + high TCR T cells
in vivo
Akihiro Konno,
Kanae Okada,
Kazunori Mizuno,
Mika Nishida,
Shuya Nagaoki,
Tomoko Toma,
Takahiro Uehara,
Kazuhide Ohta,
Yoshihito Kasahara,
Hidetoshi Seki,
Akihiro Yachie, and
Shoichi Koizumi
From the Department of Pediatrics, Angiogenesis and
Vascular Development, Graduate School of Medical Science and School of
Medicine, Kanazawa University and School of Health Sciences, Faculty of
Medicine, Kanazawa University, Kanazawa, Japan.
 |
Abstract |
Whereas most peripheral CD8+  T cells highly
express CD8 heterodimer in healthy individuals, there is an
increase of CD8 + low or CD8  T
cells in HIV infection or Wiskott-Aldrich syndrome and after bone
marrow transplantation. The significance of these uncommon cell
populations is not well understood. There has been some question as to
whether these subsets and CD8 + high cells
belong to different ontogenic lineages or whether a fraction of
CD8 + high cells have down-regulated CD8
chain. Here we assessed clonality of CD8 and
CD8 + low  T cells as well as their
phenotypic and functional characteristics. Deduced from surface
antigens, cytotoxic granule constituents, and cytokine production,
CD8 + low cells are exclusively composed of
effector memory cells. CD8 cells comprise effector memory cells
and terminally differentiated CD45RO CCR7
memory cells. T-cell receptor (TCR) V complementarity-determining region 3 (CDR3) spectratyping analysis and subsequent sequencing of
CDR3 cDNA clones revealed polyclonality of
CD8 + high cells and oligoclonality of
CD8 + low and CD8 cells. Importantly,
some expanded clones within CD8 cells were also identified within
CD8 + high and
CD8 + low subpopulations. Furthermore,
signal-joint TCR rearrangement excision circles concentration was
reduced with the loss of CD8 expression. These results indicated
that some specific CD8 + high  T
cells expand clonally, differentiate, and simultaneously down-regulate
CD8 chain possibly by an antigen-driven mechanism. Provided that
antigenic stimulation directly influences the emergence of CD8
 T cells, these cells, which have been previously regarded as of
extrathymic origin, may present new insights into the mechanisms of
autoimmune diseases and immunodeficiencies, and also serve as a useful
biomarker to evaluate the disease activities.
(Blood. 2002;100:4090-4097)
© 2002 by The American Society of Hematology.
 |
Introduction |
CD8 is a coreceptor that recognizes the
nonpolymorphic 3 domain of the major histocompatibility complex
(MHC) class I molecules and is necessary for T-cell
activation.1,2 It increases the avidity of the interaction
between the CD8-bearing T cell and the antigen-presenting
cell.1,3,4 With the T-cell receptor (TCR)-peptide-MHC
ligation, simultaneous coligation of the coreceptor juxtaposes
MHC-engaged TCR complexes with intracellular signaling intermediates,
leading to increased tyrosine phosphorylation and further recruitment
and activation of downstream signaling effector molecules.2,5-7 CD8 antigen is composed of 2 kinds of
molecules, and chain, and is expressed either as an 
homodimer or an  heterodimer.8-11 These isoforms are
the products of closely linked but distinct genes exhibiting only
moderate sequence homology.12,13 Studies of CD8 and
CD8 have revealed the distinct contributions to the coreceptor
function. CD8 can interact with all molecules presently known to be
involved in CD8 function by itself. CD8 , on the contrary, has roles
to make the coreceptor function more efficiently as CD8
heterodimers. Extracellular domain of CD8 increases the avidity of
CD8 binding to MHC class I14 and influences specificity of
the CD8/MHC/TCR interaction.15 CD8 may also uniquely
mediate efficient interaction with the TCR/CD3 complex.16 In addition, the intracellular domain of CD8 enhances association of
CD8 with Lck and linker for activation of T cells
(LAT).14,17,18
In healthy individuals, most thymocytes and peripheral T cells
highly express the heterodimeric form of CD8.17 These
CD8 + high T cells express not only
CD8 heterodimers but also CD8 homodimers on the same
cells.9,10 On the other hand, specific subpopulations of
natural killer (NK) cells and intestinal  T cells exclusively express CD8 .17 However,
CD8 + low and CD8  T cells
increase in the periphery in some conditions. Patients with
Wiskott-Aldrich syndrome (WAS) are reported to have CD8+ T
cells composed mostly of CD8 homodimers.19 Also, a
large proportion of CD8+ T cells reconstituted in bone
marrow transplant recipients express CD8
homodimers.20,21 In addition, HIV infection is
characterized by the appearance of a major CD8 subpopulation with
reduced CD8 chains, which exhibits strong antiviral
activity.22
Although there has been much controversy as to the origin and the
functional roles of these cells, there is increasing evidence in recent
literature to suggest that CD8  T cells derive from the
thymus after positive selection and that they exhibit distinct functions from conventional CD8  T cells.23,24
Furthermore, it seems that expression of CD8 chains is secondarily
regulated by the intestinal microenvironments.25 However,
despite the extensive studies of CD8 and chains in vitro and the
studies on a molecular basis, heterogeneity of CD8 isoform expression may not have been examined thoroughly in various human disorders and
clinical conditions. Moreover, the in vivo function and clinical significance of CD8 and CD8 + low
 T cells are poorly understood. The purpose of this study is to
reveal in vivo cell function and the origin of CD8 and
CD8 + low  T cells. More
specifically, we analyzed cell surface antigen expression, cytotoxic
granule constituents, and cytokine production of these subpopulations.
Furthermore, this study also examined if CD8 and
CD8 + low  T cells comprise distinct
clones, or if they descend directly from
CD8 + high cells by down-regulating CD8
chain after antigen stimulation in vivo.
 |
Materials and methods |
Monoclonal antibodies
Fluorescein isothiocyanate (FITC)-conjugated monoclonal
antibodies (mAbs) recognizing CD95, CD45RO, and
R-phycoerythrin-Cyanine5 (RPE-Cy5)-conjugated anti-CD8 mAb were
purchased from Dako (Glostrup, Denmark). FITC-conjugated mAbs against
CD16, CD27, CD57, TCR , interleukin 2 (IL-2), interferon (IFN- ), and mouse IgG antibodies as well as nonconjugated anti-CCR7
mAbs were obtained from BD Pharmingen (San Diego, CA). FITC-conjugated
anti-CD28, anti-TCR , anti-CD62L, PE-conjugated anti-CD8 ,
anti-2B4, anti-TIA-1 (a cytotoxic granule-associated
protein), and nonconjugated anti-CD8 mAbs were
products of Beckman Coulter (Tokyo, Japan). PE-conjugated mAbs against
perforin and granzyme B were purchased from Ancell (Bayport, MN) and
Research Diagnostics (Flanders, NJ), respectively.
Cell preparation and flow cytometric analysis
Human peripheral blood mononuclear cells (PBMNCs) were isolated
from heparinized peripheral blood by Ficoll-Hypaque density centrifugation. CD16+ and TCR + cells were
then depleted using MACS and anti-FITC magnetic beads (Miltenyi Biotec,
Bergisch Gladbach, Germany) after staining with FITC-conjugated
anti-TCR and anti-CD16 mAbs. The negatively sorted cells (purity
> 99%) were stained with PE-conjugated anti-CD8 and
RPE-Cy5-conjugated anti-CD8 mAb in combination with FITC-conjugated anti-TCR , anti-CD62L, anti-CD57, anti-CD95, anti-HLA-DR, or anti-CD45RO mAbs. For the analysis of CCR7 expression, nonconjugated anti-CCR7 mAbs were used with FITC-conjugated goat antimouse
antibodies. Similarly, 2B4 expression was analyzed using
FITC-conjugated goat antimouse antibodies with the staining with
nonconjugated anti-CD8 mAbs and PE-conjugated anti-2B4 mAbs. These
stained cells, after washing with phosphate-buffered saline (PBS), were
analyzed on a FACSCalibur flow cytometer (BD Biosciences, Tokyo,
Japan). In addition, for signal-joint TCR rearrangement excision
circles (Sj TRECs) quantification and TCR complementarity-determining region 3 (CDR3) spectratyping and sequencing, CD8 +
 T cells with different (high, low, or negative) CD8
expression were separated using an Epics ELITE flow cytometer (Coulter
Electronics, Hialeah, FL) after depletion of CD4+,
CD14+, CD16+, CD20+, and
TCR + cells with MACS (purity > 98%). Patterns of
flow cytometric analysis pursued for 3 to 6 independent donors were
similarly otherwise noted, and the representative results were presented.
Flow cytometric detection of cytokine production and intracellular
staining for cytotoxic granule constituents
TCR -depleted and CD16-depleted PBMNCs
(TCR  CD16 PBMNCs) were stimulated for
6 hours with 10 ng/mL phorbol myristate acetate (PMA) and 500 ng/mL A23187 in the presence of 1 µg/mL monensin (Sigma, St Louis,
MO). After cell surface staining with PE-conjugated CD8 and
RPE-Cy5-conjugated CD8 , cells were fixed and permeabilized with
Cytofix/Cytoperm Plus Kit (BD Pharmingen) per the manufacturer's instruction. Staining of the cytoplasm with FITC-conjugated
anti-IFN- or anti-IL-2 mAb followed. Separately, freshly isolated
TCR  CD16 PBMNCs were treated with
anti-CD8 mAb followed by FITC-conjugated goat antimouse antibodies.
They were further stained with RPE-Cy-5-conjugated anti-CD8 mAbs
after blocking with normal mouse serum. After fixation and
permeabilization, the cells were stained with PE-conjugated antiperforin, antigranzyme B, or anti-TIA-1 mAbs.
RNA extraction and cDNA preparation
Total RNA was extracted from separated CD8+  T
cells with TRIZOL reagent following the manufacturer's instructions
(Gibco BRL, Bethesda, MD). The RNA was then reverse-transcribed into cDNA in a reaction primed with oligo(dt)12-18 using SuperScript II
reverse transcriptase as recommended by the manufacturer (Gibco BRL).
Sj TREC quantification
Sj TRECs were quantified in sorted CD8+ 
T-cell subsets by a real-time quantitative polymerase chain reaction
(PCR) method as described previously.26,27 Sorted cells
were lysed in 100 µg/mL proteinase K (Wako Pure Chemical Industries,
Osaka, Japan) for 1 hour at 56°C and then 10 minutes at 95°C at
107 cells/mL. Then PCR was carried out on 5 µL cell
lysate in a spectrofluorometric thermal cycler (ABI PRISM 7700, Applied
Biosystems, Osaka, Japan) under the following conditions: 50°C for 2 minutes followed by 95°C for 10 minutes, after which 50 cycles of
amplification were carried out (95°C for 15 seconds, 60°C for 1 minute). The sequences of the primers and probe used were the
following: forward primer GGAAAACACAGTGTGACATGGA, reverse primer
GTCAACAAAGGTGATGCCACAT, and the probe
FAM-CCTGTCTGCTCTTCATTCACCGTTCTCA-TAMRA. A standard curve was plotted,
and Sj TREC values for samples were calculated by ABI PRISM 7700 software.
CDR3 spectratyping
CDR3 spectratyping was pursued as previously
described.28 Briefly, cDNA was amplified by PCR through 35 cycles (94°C for 1 minute, 55°C for 1 minute, and 72°C for 1 minute) with a primer specific to 24 different BV subfamilies (BVs
1-2029 and BVs21-2430) and a fluorescent BC
primer.29 The fluorescent PCR products were mixed with
formamide and the size standard (GeneScan-500 TAMRA, Applied
Biosystems). After denaturation for 2 minutes at 90°C, the products
were analyzed with an automated 310 DNA sequencer (Applied Biosystems),
and the data were analyzed with GeneScan software (Applied Biosystems).
The overall complexity within a V subfamily was determined by
counting the numbers of discrete peaks and determining their relative
size on the spectratype histogram. We used a complexity scoring
system31 with our interpretation, that is, complexity score = (sum of all the peak heights/sum of the major peak
heights) × (number of the major peaks). Major peaks were defined
as those peaks on the spectratype histogram whose amplitude was at
least 10% of the sum of all the peak heights.
Cloning and sequencing of PCR-amplified cDNA
The PCR products of some BV cDNA were electrophoresed on an
agarose gel and purified using QIAquick Gel Extraction Kit (Qiagen, Tokyo, Japan), and then cloned with TOPO TA Cloning (Invitrogen, Carlsbad, CA). Eleven to 19 colonies containing the insert fragment were randomly selected. Purified with QIAprep Spin Miniprep Kit (Qiagen), the recombinant plasmids were subjected to fluorescence dye
terminator cycle sequencing, and the sequence reactions were analyzed
on a 310 DNA sequencer (Applied Biosystems) after removal of the
unincorporated fluorescence dye with Centri-Sep Spin Columns (Applied Biosystems).
Statistical analysis
Association of the percentage of peripheral
CD8 + low and CD8  T cells with
age was analyzed using the Spearman rank correlation coefficient. The
Wilcoxon signed rank test was applied to examine statistically
significant differences of CDR3 complexity scores between
subpopulations of different CD8 expression.
 |
Results |
CD8 + low and CD8  T cells
expand with advancing age
To ensure that the number of peripheral
CD8 + low and CD8  T cells are
limited in healthy individuals, we first stained PBMNCs with
anti-TCR , anti-CD8 , and anti-CD8 mAbs conjugated to
different fluorochromes in several healthy individuals including cord
blood. CD8 + TCR + cells could be
classified into 3 groups defined by the level of CD8 expression:
CD8 + high, CD8
+ low, and CD8
+ , which is CD8 . Although
CD8  T cells were negligible and small numbers of
CD8 + low  T cells existed in cord
blood, these populations increased in a 5-year-old child and even more
in an adult (Figure 1). To assess the
developmental changes of CD8 + low and
CD8  T cells, we evaluated the frequency of these
subpopulations in various age groups using more blood samples. In cord
blood, CD8 + low and CD8 
T cells represented a minor population within CD8 +
 T cells. These subpopulations increased with advancing age as
expected (P < .01). However, it is notable that
some adults showed levels of CD8 + low and
CD8  T cells as low as neonates (Figure
2).

View larger version (18K):
[in this window]
[in a new window]
| Figure 1.
CD8 expression on CD8 +  T cells
in healthy individuals.
PBMNCs from healthy individuals and cord blood were stained with
FITC-conjugated anti-TCR , PE-conjugated anti-CD8 , and
RPE-Cy5-conjugated anti-CD8 mAbs. TCR and CD8 gated cells
were analyzed for the expression of CD8 (y-axis) versus CD8
(x-axis). Representative data are displayed.
|
|

View larger version (10K):
[in this window]
[in a new window]
| Figure 2.
Developmental change of
CD8 + low and CD8 fractions within
CD8 +  T cells.
CD8 +  T cells were analyzed for CD8 expression,
and the total frequencies of CD8 + low and
CD8 fractions were plotted along different age groups.
|
|
Correlation of CD8 expression with other surface
markers
We next compared the expression of the various surface antigen
markers on CD8 +  T cells with different levels of
CD8 expression. Before pursuing 3-color flow cytometric analysis, we
depleted CD16+ NK cells and TCR + T cells
from PBMNCs because these cells contain CD8 + cells. The
depletion of CD16+ and TCR + cells yielded
TCR + or CD3+ cells with more than 98%
purity when gated on CD8 (Figure 3A). CD8 + high cells were heterogeneous for the
expression of all the surface antigens analyzed. In the
CD8 + low subpopulation, CD95+,
CD45RO+, and 2B4+ cells became dominant, and
the subset lost CD62L and CCR7 antigens. Most CD8 T cells
expressed CD95 and 2B4, but not CD57, CD62L, or CCR7. Although more
than half of 7 adults analyzed had CD8 cells, which exclusively
expressed CD45RO, CD27, and CD28, the rest of the individuals possessed
CD8 cells that were as much as 30% negative for these surface
antigens (Figure 3B and data not shown).

View larger version (63K):
[in this window]
[in a new window]
| Figure 3.
Analysis of surface antigen expression on CD8 +  T
cells.
TCR  CD16 PBMNCs were stained with
CD8 , CD8 , and TCR or CD3 (A), or other various surface
antigens as indicated (B). CD8 gated cells are displayed.
|
|
Cytotoxic granule proteins and cytokine production
To further characterize the subpopulations of CD8+
 T cells with regard to CD8 -chain expression, we analyzed
CD8+  T cells for the presence of perforin, granzyme
B, and TIA-1. CD8 + high cells were
heterogeneous for the expression of the cytotoxic granule constituents.
CD8 + low cells were also heterogeneous for
the expression of perforin and granzyme B, but the subset entirely
expressed TIA-1. A large number of CD8 T cells possessed perforin
and nearly all the cells contained TIA-1, whereas CD8 cells did
not contain granzyme B (Figure 4A).

View larger version (43K):
[in this window]
[in a new window]
| Figure 4.
Cytotoxic granule constituents and cytokine production.
(A) TCR  CD16 PBMNCs were stained with
anti-CD8 mAbs recognized by FITC-conjugated goat-antimouse
antibodies, RPE-Cy5-conjugated anti-CD8 , and PE-conjugated
antiperforin, antigranzyme B, or anti-TIA-1 mAbs. (B) After the
stimulation with PMA and A23187 in the presence of monensin,
TCR  CD16 PBMNCs were stained with
PE-conjugated anti-CD8 , RPE-Cy5-conjugated anti-CD8 , and
FITC-conjugated anti-IL-2 or anti-IFN- mAbs. CD8 gated cells
are displayed.
|
|
Because cytokine production capacity is also a major factor determining
cell functions, CD8+  T cells were stimulated for 6 hours with PMA and calcium ionophore in the presence of monensin for
analysis of IFN- and IL-2 production. Heterogeneity for the cytokine
production was observed in the CD8 + high
subset. Entire CD8 + low cells produced
IFN- , and some proportion of the cells produced IL-2. CD8
cells exclusively expressed IFN- , but not IL-2 (Figure 4B).
CD8 + low and CD8  T cells
exhibit less clonal diversity
Sequence analysis of CDR3 length diversity in
CD8 + high,
CD8 + low, and CD8  T cells was
pursued to define the extent of clonal expansion. About
5 × 105 cells of each subpopulation were isolated, and
their cDNA was subjected to PCR amplification with 24 V -specific
primers. TCR spectratypes of CD8 + high
cells exhibited, with a few exceptions, a gaussianlike distribution, indicating that the subset comprises cells with highly diverse and
polyclonal TCR repertoires. The profile of
CD8 + low cells revealed skewed CDR3 size
distribution in some V subfamilies, but about one third of V
subfamilies remained diverse. To a further extent, the majority of V
subfamilies of CD8 cells displayed apparently skewed patterns,
many of them with an almost single peak pattern (Figure
5).

View larger version (51K):
[in this window]
[in a new window]
| Figure 5.
Spectratypes of the T-cell repertoire within
CD8 + high,
CD8 + low, and CD8  T
cells.
Histograms of the relative sizes of the PCR-amplified CDR3 region
within CD8 + high,
CD8 + low, and CD8  T cells in
one donor are shown. The y-axis is relative quantity of RNA bearing the
specific TCR V . The x-axis represents the nucleotide length of
the PCR-amplified TCR gene products.
|
|
To quantify differences in the TCR V gene repertoire among
the T-cell subsets, we assigned complexity scores to each sample analyzed. Samples from 2 donors were presented; one of them (donor 1)
did not possess CD8  T cells enough to be isolated. In donor 1, complexity scores of CD8 + low
cells were significantly lower than
CD8 + high cells (P < .01).
Likewise, complexity scores of CD8 +  T cells in
donor 2 decreased as they lost CD8 expression (CD8 + high versus
CD8 + low cells, P < .05;
CD8 + low versus CD8 cells,
P < .001; Figure 6). These
results suggest that CD8 + low and, to a
larger extent, CD8  T cells comprise oligoclonally proliferated cells.

View larger version (25K):
[in this window]
[in a new window]
| Figure 6.
Comparison of TCR V CDR3 complexity scores among
CD8 +  T cells with different CD8 expression.
Complexity scores were generated for each TCR BV from the CDR3
spectratype analysis. The individual complexity scores were plotted
along CD8 expression, and the dots for the same BVs were connected
with lines. Representative data of 2 donors are shown.
|
|
Identical clones exist among
CD8 + high,
CD8 + low, and CD8 cells
It needs to be confirmed directly that
CD8 + low and CD8  T cells are
oligoclonally proliferated cells. Therefore, the PCR products were then
cloned and the nucleotide sequence of CDR3 was determined (Table
1). This analysis also provides the
information if identical clones exist among the subpopulations of
different CD8 expression. In this experiment, we used the cDNA
samples from one donor so that the pruity of each sorted cell fraction was more than 98% and the number was identical for all BVs within a
given cell fraction. In addition, we selected BV21, BV20, and BV14
because these BVs exhibited distinct patterns of spectratypes within
CD8 + high,
CD8 + low, and CD8  T cells
(BV21: polyclonal, polyclonal, and oligoclonal; BV20: polyclonal,
oligoclonal, and oligoclonal; and BV14: oligoclonal, oligoclonal, and
oligoclonal; Figure 7).

View larger version (23K):
[in this window]
[in a new window]
| Figure 7.
Spectratypes of TCR BV21, BV20, and BV14.
Spectratyping analysis of  T cells within
CD8 + high,
CD8 + low, and CD8 subpopulations was
pursued in another healthy donor. Histograms of BV21, BV20, and BV14
are displayed as Figure 5.
|
|
As for BV21, 19 CDR3 cDNA clones of
CD8 + high cells were randomly selected and
sequenced. Consistent with spectratyping, heterogeneous CDR3 clones
were sequenced, which indicated that
CD8 + high cells possessing TCR V 21 were
polyclonal. Conversely, a large number of cDNA clones were determined
to be identical in CD8 cells; in 9 of 16 clones the amino acid
sequence of the N-D-N region was PVSGRL (designated as clone PVSGRL;
single-letter amino acid codes). This clone was also identified in
CD8 + low cells (3 of 16 clones). However,
this clone PVSGRL was not found in the
CD8 + high subpopulation. Although an
additional 46 cDNA clones within CD8 + high
cells were analyzed, this clone was not detected (data not shown). In
contrast, another clone, LDPSQGH, was detected within
CD8 + high cells and
CD8 + low cells in the frequency of 2 of 19 and 3 of 16, respectively, but not within CD8 cells. Notably, the
third clone, FVSGS, was found within
CD8 + high,
CD8 + low, and CD8 cells, although
the clone was not dominant within these subpopulations (1 of 19, 3 of
16, and 2 of 16, respectively).
In BV20, a major clone, SPVSWA, within CD8 cells (10 of 14 clones) dominated within CD8 + low cells (9 of 11 clones). This clone was also detected within
CD8 + high cells (2 of 15 clones). In BV14,
where spectratypes of CD8 + high,
CD8 + low, and CD8 subpopulations
were all oligoclonal, clone GQSR was identified predominantly within
the cells of all the subpopulations. To ensure that sharing of the
identical clones among CD8 + high,
CD8 + low, and CD8 subpopulations
holds true for other individuals, we determined CDR3 sequences of BV17
from a different healthy donor; a dominant clone, SATVSYEQY, (7 of 10 clones) and a clone KPAGTFVLF (2 of 10 clones) within CD8 cells
were also detected within CD8 + high cells
at a frequency of 3 of 18 and 1 of 18, respectively (data not shown).
Taken together, it is proved that the cells with skewed BV
spectratypes, frequently observed in
CD8 + low and CD8 subpopulations,
comprise oligoclonally proliferated cells. More importantly,
CD8 + high,
CD8 + low, and CD8  T cells can
possess the same cell clones. Some of these clones also become dominant
with the loss of CD8 chains. These results suggest that some cell
clones proliferate while down-regulating CD8 chains.
Sj TREC concentrations decreased with the down-regulation of
CD8
If CD8  T cells descend from
CD8 + high  T cells, CD8 cells
have undergone cell division more than
CD8 + low, and still more than
CD8 + high  T cells. To assess the
relative proliferative history of CD8+  T-cell
populations defined by the intensity of CD8 expression, we measured
Sj TREC concentrations in CD8 + high,
CD8 + low, and CD8  T-cell
subsets. In all 3 donors examined, Sj TREC levels were higher in
CD8 + high  T cells, and the number
of Sj TREC copies declined with the loss of CD8 expression (Table
2). These results, supporting the
findings of spectratyping analysis, indicate that
CD8 + high  T cells, at least at the
population level, can differentiate to CD8  T cells but not
the opposite way.
|