SEARCH:   Advanced

Prepublished online as a Blood First Edition Paper on July 25, 2002; DOI 10.1182/blood-2002-04-1136. This Article Abstract Full Text (PDF) All Versions of this Article: 2002-04-1136v1 100/12/4090    most recent Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Konno, A. Articles by Koizumi, S. Search for Related Content PubMed PubMed Citation Articles by Konno, A. Articles by Koizumi, S. Related Collections Immunobiology Social Bookmarking                   What's this?  Previous Article  |  Table of Contents  |  Next Article  Blood, 1 December 2002, Vol. 100, No. 12, pp. 4090-4097 IMMUNOBIOLOGY CD8 memory effector T cells descend directly from clonally expanded CD8+high TCR T cells in vivo Akihiro Konno, Kanae Okada, Kazunori Mizuno, Mika Nishida, Shuya Nagaoki, Tomoko Toma, Takahiro Uehara, Kazuhide Ohta, Yoshihito Kasahara, Hidetoshi Seki, Akihiro Yachie, and Shoichi Koizumi From the Department of Pediatrics, Angiogenesis and Vascular Development, Graduate School of Medical Science and School of Medicine, Kanazawa University and School of Health Sciences, Faculty of Medicine, Kanazawa University, Kanazawa, Japan.     Abstract Top Abstract Introduction Materials and methods Results Discussion References Whereas most peripheral CD8+ T cells highly express CD8 heterodimer in healthy individuals, there is an increase of CD8+low or CD8 T cells in HIV infection or Wiskott-Aldrich syndrome and after bone marrow transplantation. The significance of these uncommon cell populations is not well understood. There has been some question as to whether these subsets and CD8+high cells belong to different ontogenic lineages or whether a fraction of CD8+high cells have down-regulated CD8 chain. Here we assessed clonality of CD8 and CD8+low T cells as well as their phenotypic and functional characteristics. Deduced from surface antigens, cytotoxic granule constituents, and cytokine production, CD8+low cells are exclusively composed of effector memory cells. CD8 cells comprise effector memory cells and terminally differentiated CD45ROCCR7 memory cells. T-cell receptor (TCR) V complementarity-determining region 3 (CDR3) spectratyping analysis and subsequent sequencing of CDR3 cDNA clones revealed polyclonality of CD8+high cells and oligoclonality of CD8+low and CD8 cells. Importantly, some expanded clones within CD8 cells were also identified within CD8+high and CD8+low subpopulations. Furthermore, signal-joint TCR rearrangement excision circles concentration was reduced with the loss of CD8 expression. These results indicated that some specific CD8+high T cells expand clonally, differentiate, and simultaneously down-regulate CD8 chain possibly by an antigen-driven mechanism. Provided that antigenic stimulation directly influences the emergence of CD8 T cells, these cells, which have been previously regarded as of extrathymic origin, may present new insights into the mechanisms of autoimmune diseases and immunodeficiencies, and also serve as a useful biomarker to evaluate the disease activities. (Blood. 2002;100:4090-4097) © 2002 by The American Society of Hematology.     Introduction Top Abstract Introduction Materials and methods Results Discussion References CD8 is a coreceptor that recognizes the nonpolymorphic 3 domain of the major histocompatibility complex (MHC) class I molecules and is necessary for T-cell activation.1,2 It increases the avidity of the interaction between the CD8-bearing T cell and the antigen-presenting cell.1,3,4 With the T-cell receptor (TCR)-peptide-MHC ligation, simultaneous coligation of the coreceptor juxtaposes MHC-engaged TCR complexes with intracellular signaling intermediates, leading to increased tyrosine phosphorylation and further recruitment and activation of downstream signaling effector molecules.2,5-7 CD8 antigen is composed of 2 kinds of molecules,  and  chain, and is expressed either as an homodimer or an heterodimer.8-11 These isoforms are the products of closely linked but distinct genes exhibiting only moderate sequence homology.12,13 Studies of CD8 and CD8 have revealed the distinct contributions to the coreceptor function. CD8 can interact with all molecules presently known to be involved in CD8 function by itself. CD8, on the contrary, has roles to make the coreceptor function more efficiently as CD8 heterodimers. Extracellular domain of CD8 increases the avidity of CD8 binding to MHC class I14 and influences specificity of the CD8/MHC/TCR interaction.15 CD8 may also uniquely mediate efficient interaction with the TCR/CD3 complex.16 In addition, the intracellular domain of CD8 enhances association of CD8 with Lck and linker for activation of T cells (LAT).14,17,18 In healthy individuals, most thymocytes and peripheral T cells highly express the heterodimeric form of CD8.17 These CD8+high T cells express not only CD8 heterodimers but also CD8 homodimers on the same cells.9,10 On the other hand, specific subpopulations of natural killer (NK) cells and intestinal T cells exclusively express CD8.17 However, CD8+low and CD8 T cells increase in the periphery in some conditions. Patients with Wiskott-Aldrich syndrome (WAS) are reported to have CD8+ T cells composed mostly of CD8 homodimers.19 Also, a large proportion of CD8+ T cells reconstituted in bone marrow transplant recipients express CD8 homodimers.20,21 In addition, HIV infection is characterized by the appearance of a major CD8 subpopulation with reduced CD8 chains, which exhibits strong antiviral activity.22 Although there has been much controversy as to the origin and the functional roles of these cells, there is increasing evidence in recent literature to suggest that CD8 T cells derive from the thymus after positive selection and that they exhibit distinct functions from conventional CD8 T cells.23,24 Furthermore, it seems that expression of CD8 chains is secondarily regulated by the intestinal microenvironments.25 However, despite the extensive studies of CD8 and  chains in vitro and the studies on a molecular basis, heterogeneity of CD8 isoform expression may not have been examined thoroughly in various human disorders and clinical conditions. Moreover, the in vivo function and clinical significance of CD8 and CD8+low T cells are poorly understood. The purpose of this study is to reveal in vivo cell function and the origin of CD8 and CD8+low T cells. More specifically, we analyzed cell surface antigen expression, cytotoxic granule constituents, and cytokine production of these subpopulations. Furthermore, this study also examined if CD8 and CD8+low T cells comprise distinct clones, or if they descend directly from CD8+high cells by down-regulating CD8 chain after antigen stimulation in vivo.     Materials and methods Top Abstract Introduction Materials and methods Results Discussion References Monoclonal antibodies Fluorescein isothiocyanate (FITC)-conjugated monoclonal antibodies (mAbs) recognizing CD95, CD45RO, and R-phycoerythrin-Cyanine5 (RPE-Cy5)-conjugated anti-CD8 mAb were purchased from Dako (Glostrup, Denmark). FITC-conjugated mAbs against CD16, CD27, CD57, TCR, interleukin 2 (IL-2), interferon  (IFN-), and mouse IgG antibodies as well as nonconjugated anti-CCR7 mAbs were obtained from BD Pharmingen (San Diego, CA). FITC-conjugated anti-CD28, anti-TCR, anti-CD62L, PE-conjugated anti-CD8, anti-2B4, anti-TIA-1 (a cytotoxic granule-associated protein), and nonconjugated anti-CD8 mAbs were products of Beckman Coulter (Tokyo, Japan). PE-conjugated mAbs against perforin and granzyme B were purchased from Ancell (Bayport, MN) and Research Diagnostics (Flanders, NJ), respectively. Cell preparation and flow cytometric analysis Human peripheral blood mononuclear cells (PBMNCs) were isolated from heparinized peripheral blood by Ficoll-Hypaque density centrifugation. CD16+ and TCR+ cells were then depleted using MACS and anti-FITC magnetic beads (Miltenyi Biotec, Bergisch Gladbach, Germany) after staining with FITC-conjugated anti-TCR and anti-CD16 mAbs. The negatively sorted cells (purity > 99%) were stained with PE-conjugated anti-CD8 and RPE-Cy5-conjugated anti-CD8 mAb in combination with FITC-conjugated anti-TCR, anti-CD62L, anti-CD57, anti-CD95, anti-HLA-DR, or anti-CD45RO mAbs. For the analysis of CCR7 expression, nonconjugated anti-CCR7 mAbs were used with FITC-conjugated goat antimouse antibodies. Similarly, 2B4 expression was analyzed using FITC-conjugated goat antimouse antibodies with the staining with nonconjugated anti-CD8 mAbs and PE-conjugated anti-2B4 mAbs. These stained cells, after washing with phosphate-buffered saline (PBS), were analyzed on a FACSCalibur flow cytometer (BD Biosciences, Tokyo, Japan). In addition, for signal-joint TCR rearrangement excision circles (Sj TRECs) quantification and TCR complementarity-determining region 3 (CDR3) spectratyping and sequencing, CD8+ T cells with different (high, low, or negative) CD8 expression were separated using an Epics ELITE flow cytometer (Coulter Electronics, Hialeah, FL) after depletion of CD4+, CD14+, CD16+, CD20+, and TCR+ cells with MACS (purity > 98%). Patterns of flow cytometric analysis pursued for 3 to 6 independent donors were similarly otherwise noted, and the representative results were presented. Flow cytometric detection of cytokine production and intracellular staining for cytotoxic granule constituents TCR-depleted and CD16-depleted PBMNCs (TCR CD16 PBMNCs) were stimulated for 6 hours with 10 ng/mL phorbol myristate acetate (PMA) and 500 ng/mL A23187 in the presence of 1 µg/mL monensin (Sigma, St Louis, MO). After cell surface staining with PE-conjugated CD8 and RPE-Cy5-conjugated CD8, cells were fixed and permeabilized with Cytofix/Cytoperm Plus Kit (BD Pharmingen) per the manufacturer's instruction. Staining of the cytoplasm with FITC-conjugated anti-IFN- or anti-IL-2 mAb followed. Separately, freshly isolated TCRCD16 PBMNCs were treated with anti-CD8 mAb followed by FITC-conjugated goat antimouse antibodies. They were further stained with RPE-Cy-5-conjugated anti-CD8 mAbs after blocking with normal mouse serum. After fixation and permeabilization, the cells were stained with PE-conjugated antiperforin, antigranzyme B, or anti-TIA-1 mAbs. RNA extraction and cDNA preparation Total RNA was extracted from separated CD8+ T cells with TRIZOL reagent following the manufacturer's instructions (Gibco BRL, Bethesda, MD). The RNA was then reverse-transcribed into cDNA in a reaction primed with oligo(dt)12-18 using SuperScript II reverse transcriptase as recommended by the manufacturer (Gibco BRL). Sj TREC quantification Sj TRECs were quantified in sorted CD8+ T-cell subsets by a real-time quantitative polymerase chain reaction (PCR) method as described previously.26,27 Sorted cells were lysed in 100 µg/mL proteinase K (Wako Pure Chemical Industries, Osaka, Japan) for 1 hour at 56°C and then 10 minutes at 95°C at 107 cells/mL. Then PCR was carried out on 5 µL cell lysate in a spectrofluorometric thermal cycler (ABI PRISM 7700, Applied Biosystems, Osaka, Japan) under the following conditions: 50°C for 2 minutes followed by 95°C for 10 minutes, after which 50 cycles of amplification were carried out (95°C for 15 seconds, 60°C for 1 minute). The sequences of the primers and probe used were the following: forward primer GGAAAACACAGTGTGACATGGA, reverse primer GTCAACAAAGGTGATGCCACAT, and the probe FAM-CCTGTCTGCTCTTCATTCACCGTTCTCA-TAMRA. A standard curve was plotted, and Sj TREC values for samples were calculated by ABI PRISM 7700 software. CDR3 spectratyping CDR3 spectratyping was pursued as previously described.28 Briefly, cDNA was amplified by PCR through 35 cycles (94°C for 1 minute, 55°C for 1 minute, and 72°C for 1 minute) with a primer specific to 24 different BV subfamilies (BVs 1-2029 and BVs21-2430) and a fluorescent BC primer.29 The fluorescent PCR products were mixed with formamide and the size standard (GeneScan-500 TAMRA, Applied Biosystems). After denaturation for 2 minutes at 90°C, the products were analyzed with an automated 310 DNA sequencer (Applied Biosystems), and the data were analyzed with GeneScan software (Applied Biosystems). The overall complexity within a V subfamily was determined by counting the numbers of discrete peaks and determining their relative size on the spectratype histogram. We used a complexity scoring system31 with our interpretation, that is, complexity score = (sum of all the peak heights/sum of the major peak heights) × (number of the major peaks). Major peaks were defined as those peaks on the spectratype histogram whose amplitude was at least 10% of the sum of all the peak heights. Cloning and sequencing of PCR-amplified cDNA The PCR products of some BV cDNA were electrophoresed on an agarose gel and purified using QIAquick Gel Extraction Kit (Qiagen, Tokyo, Japan), and then cloned with TOPO TA Cloning (Invitrogen, Carlsbad, CA). Eleven to 19 colonies containing the insert fragment were randomly selected. Purified with QIAprep Spin Miniprep Kit (Qiagen), the recombinant plasmids were subjected to fluorescence dye terminator cycle sequencing, and the sequence reactions were analyzed on a 310 DNA sequencer (Applied Biosystems) after removal of the unincorporated fluorescence dye with Centri-Sep Spin Columns (Applied Biosystems). Statistical analysis Association of the percentage of peripheral CD8+low and CD8 T cells with age was analyzed using the Spearman rank correlation coefficient. The Wilcoxon signed rank test was applied to examine statistically significant differences of CDR3 complexity scores between subpopulations of different CD8 expression.     Results Top Abstract Introduction Materials and methods Results Discussion References CD8+low and CD8 T cells expand with advancing age To ensure that the number of peripheral CD8+low and CD8 T cells are limited in healthy individuals, we first stained PBMNCs with anti-TCR, anti-CD8, and anti-CD8 mAbs conjugated to different fluorochromes in several healthy individuals including cord blood. CD8+ TCR+ cells could be classified into 3 groups defined by the level of CD8 expression: CD8+high, CD8 +low, and CD8 +, which is CD8. Although CD8 T cells were negligible and small numbers of CD8+low T cells existed in cord blood, these populations increased in a 5-year-old child and even more in an adult (Figure 1). To assess the developmental changes of CD8+low and CD8 T cells, we evaluated the frequency of these subpopulations in various age groups using more blood samples. In cord blood, CD8+low and CD8 T cells represented a minor population within CD8+ T cells. These subpopulations increased with advancing age as expected (P < .01). However, it is notable that some adults showed levels of CD8+low and CD8 T cells as low as neonates (Figure 2). View larger version (18K): [in this window] [in a new window]   Figure 1. CD8 expression on CD8+ T cells in healthy individuals. PBMNCs from healthy individuals and cord blood were stained with FITC-conjugated anti-TCR, PE-conjugated anti-CD8, and RPE-Cy5-conjugated anti-CD8 mAbs. TCR and CD8 gated cells were analyzed for the expression of CD8 (y-axis) versus CD8 (x-axis). Representative data are displayed. View larger version (10K): [in this window] [in a new window]   Figure 2. Developmental change of CD8+low and CD8 fractions within CD8+ T cells. CD8+ T cells were analyzed for CD8 expression, and the total frequencies of CD8+low and CD8 fractions were plotted along different age groups. Correlation of CD8 expression with other surface markers We next compared the expression of the various surface antigen markers on CD8+ T cells with different levels of CD8 expression. Before pursuing 3-color flow cytometric analysis, we depleted CD16+ NK cells and TCR+ T cells from PBMNCs because these cells contain CD8+ cells. The depletion of CD16+ and TCR+ cells yielded TCR+ or CD3+ cells with more than 98% purity when gated on CD8 (Figure 3A). CD8+high cells were heterogeneous for the expression of all the surface antigens analyzed. In the CD8+low subpopulation, CD95+, CD45RO+, and 2B4+ cells became dominant, and the subset lost CD62L and CCR7 antigens. Most CD8 T cells expressed CD95 and 2B4, but not CD57, CD62L, or CCR7. Although more than half of 7 adults analyzed had CD8 cells, which exclusively expressed CD45RO, CD27, and CD28, the rest of the individuals possessed CD8 cells that were as much as 30% negative for these surface antigens (Figure 3B and data not shown). View larger version (63K): [in this window] [in a new window]   Figure 3. Analysis of surface antigen expression on CD8+ T cells. TCR CD16 PBMNCs were stained with CD8, CD8, and TCR or CD3 (A), or other various surface antigens as indicated (B). CD8 gated cells are displayed. Cytotoxic granule proteins and cytokine production To further characterize the subpopulations of CD8+ T cells with regard to CD8-chain expression, we analyzed CD8+ T cells for the presence of perforin, granzyme B, and TIA-1. CD8+high cells were heterogeneous for the expression of the cytotoxic granule constituents. CD8+low cells were also heterogeneous for the expression of perforin and granzyme B, but the subset entirely expressed TIA-1. A large number of CD8 T cells possessed perforin and nearly all the cells contained TIA-1, whereas CD8 cells did not contain granzyme B (Figure 4A). View larger version (43K): [in this window] [in a new window]   Figure 4. Cytotoxic granule constituents and cytokine production. (A) TCR CD16 PBMNCs were stained with anti-CD8 mAbs recognized by FITC-conjugated goat-antimouse antibodies, RPE-Cy5-conjugated anti-CD8, and PE-conjugated antiperforin, antigranzyme B, or anti-TIA-1 mAbs. (B) After the stimulation with PMA and A23187 in the presence of monensin, TCRCD16 PBMNCs were stained with PE-conjugated anti-CD8, RPE-Cy5-conjugated anti-CD8, and FITC-conjugated anti-IL-2 or anti-IFN- mAbs. CD8 gated cells are displayed. Because cytokine production capacity is also a major factor determining cell functions, CD8+ T cells were stimulated for 6 hours with PMA and calcium ionophore in the presence of monensin for analysis of IFN- and IL-2 production. Heterogeneity for the cytokine production was observed in the CD8+high subset. Entire CD8+low cells produced IFN-, and some proportion of the cells produced IL-2. CD8 cells exclusively expressed IFN-, but not IL-2 (Figure 4B). CD8+low and CD8 T cells exhibit less clonal diversity Sequence analysis of CDR3 length diversity in CD8+high, CD8+low, and CD8 T cells was pursued to define the extent of clonal expansion. About 5 × 105 cells of each subpopulation were isolated, and their cDNA was subjected to PCR amplification with 24 V-specific primers. TCR spectratypes of CD8+high cells exhibited, with a few exceptions, a gaussianlike distribution, indicating that the subset comprises cells with highly diverse and polyclonal TCR repertoires. The profile of CD8+low cells revealed skewed CDR3 size distribution in some V subfamilies, but about one third of V subfamilies remained diverse. To a further extent, the majority of V subfamilies of CD8 cells displayed apparently skewed patterns, many of them with an almost single peak pattern (Figure 5). View larger version (51K): [in this window] [in a new window]   Figure 5. Spectratypes of the T-cell repertoire within CD8+high, CD8+low, and CD8 T cells. Histograms of the relative sizes of the PCR-amplified CDR3 region within CD8+high, CD8+low, and CD8 T cells in one donor are shown. The y-axis is relative quantity of RNA bearing the specific TCR V. The x-axis represents the nucleotide length of the PCR-amplified TCR gene products. To quantify differences in the TCR V gene repertoire among the T-cell subsets, we assigned complexity scores to each sample analyzed. Samples from 2 donors were presented; one of them (donor 1) did not possess CD8 T cells enough to be isolated. In donor 1, complexity scores of CD8+low cells were significantly lower than CD8+high cells (P < .01). Likewise, complexity scores of CD8+ T cells in donor 2 decreased as they lost CD8 expression (CD8+high versus CD8+low cells, P < .05; CD8+low versus CD8 cells, P < .001; Figure 6). These results suggest that CD8+low and, to a larger extent, CD8 T cells comprise oligoclonally proliferated cells. View larger version (25K): [in this window] [in a new window]   Figure 6. Comparison of TCR V CDR3 complexity scores among CD8+ T cells with different CD8 expression. Complexity scores were generated for each TCR BV from the CDR3 spectratype analysis. The individual complexity scores were plotted along CD8 expression, and the dots for the same BVs were connected with lines. Representative data of 2 donors are shown. Identical clones exist among CD8+high, CD8+low, and CD8 cells It needs to be confirmed directly that CD8+low and CD8 T cells are oligoclonally proliferated cells. Therefore, the PCR products were then cloned and the nucleotide sequence of CDR3 was determined (Table 1). This analysis also provides the information if identical clones exist among the subpopulations of different CD8 expression. In this experiment, we used the cDNA samples from one donor so that the pruity of each sorted cell fraction was more than 98% and the number was identical for all BVs within a given cell fraction. In addition, we selected BV21, BV20, and BV14 because these BVs exhibited distinct patterns of spectratypes within CD8+high, CD8+low, and CD8 T cells (BV21: polyclonal, polyclonal, and oligoclonal; BV20: polyclonal, oligoclonal, and oligoclonal; and BV14: oligoclonal, oligoclonal, and oligoclonal; Figure 7).                                View this table: [in this window] [in a new window]   Table 1. The amino acid composition of the CDR3 region within CD8+high, CD8+low, and CD8 T cells View larger version (23K): [in this window] [in a new window]   Figure 7. Spectratypes of TCR BV21, BV20, and BV14. Spectratyping analysis of T cells within CD8+high, CD8+low, and CD8 subpopulations was pursued in another healthy donor. Histograms of BV21, BV20, and BV14 are displayed as Figure 5. As for BV21, 19 CDR3 cDNA clones of CD8+high cells were randomly selected and sequenced. Consistent with spectratyping, heterogeneous CDR3 clones were sequenced, which indicated that CD8+high cells possessing TCR V21 were polyclonal. Conversely, a large number of cDNA clones were determined to be identical in CD8 cells; in 9 of 16 clones the amino acid sequence of the N-D-N region was PVSGRL (designated as clone PVSGRL; single-letter amino acid codes). This clone was also identified in CD8+low cells (3 of 16 clones). However, this clone PVSGRL was not found in the CD8+high subpopulation. Although an additional 46 cDNA clones within CD8+high cells were analyzed, this clone was not detected (data not shown). In contrast, another clone, LDPSQGH, was detected within CD8+high cells and CD8+low cells in the frequency of 2 of 19 and 3 of 16, respectively, but not within CD8 cells. Notably, the third clone, FVSGS, was found within CD8+high, CD8+low, and CD8 cells, although the clone was not dominant within these subpopulations (1 of 19, 3 of 16, and 2 of 16, respectively). In BV20, a major clone, SPVSWA, within CD8 cells (10 of 14 clones) dominated within CD8+low cells (9 of 11 clones). This clone was also detected within CD8+high cells (2 of 15 clones). In BV14, where spectratypes of CD8+high, CD8+low, and CD8 subpopulations were all oligoclonal, clone GQSR was identified predominantly within the cells of all the subpopulations. To ensure that sharing of the identical clones among CD8+high, CD8+low, and CD8 subpopulations holds true for other individuals, we determined CDR3 sequences of BV17 from a different healthy donor; a dominant clone, SATVSYEQY, (7 of 10 clones) and a clone KPAGTFVLF (2 of 10 clones) within CD8 cells were also detected within CD8+high cells at a frequency of 3 of 18 and 1 of 18, respectively (data not shown). Taken together, it is proved that the cells with skewed BV spectratypes, frequently observed in CD8+low and CD8 subpopulations, comprise oligoclonally proliferated cells. More importantly, CD8+high, CD8+low, and CD8 T cells can possess the same cell clones. Some of these clones also become dominant with the loss of CD8 chains. These results suggest that some cell clones proliferate while down-regulating CD8 chains. Sj TREC concentrations decreased with the down-regulation of CD8 If CD8 T cells descend from CD8+high T cells, CD8 cells have undergone cell division more than CD8+low, and still more than CD8+high T cells. To assess the relative proliferative history of CD8+ T-cell populations defined by the intensity of CD8 expression, we measured Sj TREC concentrations in CD8+high, CD8+low, and CD8 T-cell subsets. In all 3 donors examined, Sj TREC levels were higher in CD8+high T cells, and the number of Sj TREC copies declined with the loss of CD8 expression (Table 2). These results, supporting the findings of spectratyping analysis, indicate that CD8+high T cells, at least at the population level, can differentiate to CD8 T cells but not the opposite way.                                View this table: [in this window] [in a new window]   Table 2. Quantification of Sj TREC within CD8+high, CD8+low, and CD8 T cells     Discussion Top Abstract Introduction Materials and methods Results Discussion References In the present paper, we tried to show that peripheral blood CD8 or CD8+low T cells derive directly from CD8+high T cells, presumably by an antigen-driven mechanism. Three different approaches were undertaken. At first, age-dependent changes in the proportions of CD8 and CD8+low T cells were examined. In cord blood, CD8 T cells were negligible and relatively small numbers of CD8+low T cells were detected. These populations increased with advancing age. They made up even about a half of the CD8+ T cells in some healthy adults. Neonatal T cells are exclusively composed of naive cells, and in repeated antigenic stimulations with age, infection and autoreactivity convert the naive cells to effector and memory cells.32 Therefore, CD8 and CD8+low T cells may represent antigen-experienced cells. A wide range of the variation in the frequencies of these cells among adult individuals supports this notion. Secondly, surface antigen expression, cytotoxic granule constituents, and cytokine production of CD8+ T cells were assessed to characterize phenotype and functional features. The results of surface marker analysis were consistent with previous data that assessed surface expression of CD8 heterodimer on the positive and negative fractions of various antigens within CD8+ T cells.22 Several surface markers have been proposed for identification of naive, effector, and memory T cells. Although the CD45RA isoform can revert from CD45RO,33 double labeling with CD45RA and CD62L is frequently used for the identification of the cell phenotype.34,35 Alternatively, it is reported that simultaneous staining with CD45RA and CD27 mAbs can separate the majority of human CD8+ T cells into 3 functionally distinct subpopulations: CD45RA+ CD27+ cells, CD45RA+ CD27 cells, and CD45RA CD27+ cells, which are naive, effector, and memory phenotype, respectively.36 Recently, naive T cells were identified as CD95 T lymphocytes.35 In addition, CCR7+ memory T cells were designated as central memory cells with the counterpart as effector memory cells.37 Considering data from these reports and that T cells reciprocally express CD45RA or CD45RO,38 the CD8+low subpopulation contains effector memory cells. Although the CD8 subpopulation exclusively comprised cells of the same surface phenotype as CD8+low cells in more than half of the individuals analyzed, there were appreciable CD45ROCCR7 cells within the CD8 subpopulation in others. Because of the skewed spectratypes and low Sj TREC concentration, these CD45ROCCR7 cells may represent terminally differentiated memory cells.39 Perforin, granzyme B, and TIA-1 expression were compatible with the surface phenotype of CD8+low subpopulations because the cytotoxic granule constituents are effector cell properties.40 Perforin and TIA-1 were also produced in CD8 cells. It remains to be elucidated that CD8 cells did not express granzyme B. As for cytokine production, both CD8+low and CD8 cells produced IFN- but not IL-2. Naive cells solely produce IL-2, and effector cells generate IFN- but not IL-2. Memory cells, on the contrary, produce both of them.36,41 However, IL-2 production is prominent in central memory cells; that of effector memory cells is significantly reduced.37 Therefore, the results of the cytokine production also support that CD8+low and CD8 T cells are effector memory cells. Thirdly, analysis of CDR3 length diversity can be used to define the extent of clonal expansion within the TCR repertoire.42,43 The TCR V CDR3 complexity decreased in CD8+ T cells with diminished CD8 expression. The results suggest that CD8+low and, moreover, CD8 T cells have proliferated extensively probably by antigenic stimulations. Also, the history of cell proliferation can be assessed by Sj TREC concentrations. Sj TRECs are the episomal DNA circles generated during excisional rearrangement of TCR genes.44 Not replicating during mitosis, they are diluted during cell division.45,46 Sj TREC value was significantly higher in CD8+high T cells but reduced with the loss of CD8 chains, consistent with decrease in TCR V CDR3 complexity. These data collectively indicated that CD8+high T cells diminish the CD8-chain expression as they are activated, proliferate, and acquire memory phenotypes and functions in vivo. To prove directly that particular CD8+ T cells change the levels of -chain expression in vivo, we tried to clarify that the same clones exist among CD8+high, CD8+low, and CD8 T cells, and pursued TCR V CDR3 sequence analysis. The CDR3 forms the contact site for binding to MHC expressed by antigen-presenting cells. The region bears the fine specificity of antigen recognition.47-50 Therefore, the CDR3 sequence defines a distinctive TCR clonotype that acts as a fingerprint for the T-cell lineage bearing it.51 On the basis of TCR V CDR3 spectratyping and their sequences, recent studies proposed that identical T-cell clones are located within the mouse gut epithelium and lamina propria and circulate in the thoracic duct lymph,52 or that CD8+CD28 T cells descend directly from CD8+CD28+ T cells in humans.53,54 In the experiment presented here, the same clones were identified among CD8+high, CD8+low, and CD8 T cells in all of 3 BVs analyzed. Because the major clones sequenced within CD8 cells were not identified within the CD8+high subset in BV21, it is unlikely that clones sequenced within the CD8+high subpopulation are derived from missorted CD8 T cells. This result may rather be explained by the fact that all cells of the clone have already down-regulated CD8. Missorting can neither explain the result in BV14, which showed that the major clones sequenced among CD8+high, CD8+low, and CD8 T cells were identical. Therefore, the sequence result suggests CD8+high, CD8+low, and CD8 T cells can share the same clones. Considering the differentiation stage, spectratypes, Sj TREC concentration, and CDR3 sequences, CD8 and CD8+low T cells do not belong to different ontogenic lineages, but directly descend from CD8+high T cells. In contrast to our data, numerous studies have suggested that CD8 cells are extrathymically differentiated T cells.20-22,55 CD8 T cells reside in intestinal mucosa, and they are proved to be thymus independent.56-58 In bone marrow transplantation (BMT), about one half of the CD8+ T cells constituted from T cell-depleted marrow were CD8 cells in thymectomized recipient mice.20 As for human children, older patients at BMT exhibited more CD8 T cells than younger ones, suggesting the influence of thymic function on the regenerative pathways.21 However, these findings do not indicate that all of the CD8 T cells are necessarily of extrathymic origin. At least peripheral CD8 T cells and CD8 T intraepithelial lymphocytes (IELs) should be considered distinctively. It is reported that TCR CD8 IELs have not previously expressed CD8 using DNA methylation pattern analysis.59 Indeed, the results of IEL TCR V CDR3 analysis turned out to be opposite to those presented in this study; TCR IELs bearing CD8 or CD8 coreceptors shared no TCR BV clone.52,60 However, most recent studies by Leishman et al23 and Devine et al24 concerning the fate and function of these unique CD8+ T-cell subpopulations strongly indicate that they derive from the thymus and are positively selected. Moreover, CD8 phenotype was shown to be acquired under the influence of the microenvironment of intraepithelial lymphoid tissue.25 Furthermore, they suggest that CD8+low and CD8 T cells exhibit unique functional roles in vivo distinct from CD8+high T cells. Our findings are consistent with these data and confirm the notion that all 3 CD8+ T cells belong to the same cellular lineage and the level of CD8 chain expression is secondarily regulated in vivo by antigenic stimulation and subsequent cell activation. In conclusion, the present study demonstrates that the CD8 and CD8+low T cells are effector memory or terminally differentiated CD45ROCCR7 memory cells. Moreover, these cells share the same clone with the usual CD8+high T cells. We propose that at least in healthy individuals, circulating CD8 and CD8+low T cells do emerge as a consequence of MHC-TCR interaction. Therefore, the persistence of these cells reflects the presence of continuous antigenic stimulations and subsequent accumulation of the antigen-specific clonally expanded T cells, which may be influenced by thymic output. Analysis of these cells may help us to understand the pathogenesis of autoimmunity and immunodeficiency, and it will provide a useful biomarker to evaluate the disease activities.     Acknowledgments We thank Ms Mika Kitakata, Ms Tamae Yonezawa, and Ms Harumi Matsukawa for excellent technical help.     Footnotes Submitted April 15, 2002; accepted July 8, 2002. Prepublished online as Blood First Edition Paper, July 25, 2002; DOI 10.1182/blood-2002-04-1136. Supported by a Grant-in-Aid for Scientific Research from the Ministry of Education, Science, and Culture of Japan; and a grant from the Ministry of Health, Labour, and Welfare of Japan, Tokyo. The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734. Reprints: Akihiro Yachie, 13-1 Takara-machi, Kanazawa, 920-8641 Japan; e-mail: yachie{at}med.kanazawa-u.ac.jp.     References Top Abstract Introduction Materials and methods Results Discussion References 1. Gao GF, Tormo J, Gerth UC, et al. Crystal structure of the complex between human CD8alpha(alpha) and HLA-A2. Nature. 1997;387:630-634[CrossRef][Medline] [Order article via Infotrieve]. 2. Zamoyska R. CD4 and CD8: modulators of T-cell receptor recognition of antigen and of immune responses? Curr Opin Immunol. 1998;10:82-87[CrossRef][Medline] [Order article via Infotrieve]. 3. Norment AM, Salter RD, Parham P, Engelhard VH, Littman DR. Cell-cell adhesion mediated by CD8 and MHC class I molecules. Nature. 1988;336:79-81[CrossRef][Medline] [Order article via Infotrieve]. 4. Salter RD, Benjamin RJ, Wesley PK, et al. A binding site for the T-cell co-receptor CD8 on the alpha 3 domain of HLA-A2. Nature. 1990;345:41-46[CrossRef][Medline] [Order article via Infotrieve]. 5. Veillette A, Bookman MA, Horak EM, Bolen JB. The CD4 and CD8 T cell surface antigens are associated with the internal membrane tyrosine-protein kinase p56lck. Cell. 1988;55:301-308[CrossRef][Medline] [Order article via Infotrieve]. 6. Barber EK, Dasgupta JD, Schlossman SF, Trevillyan JM, Rudd CE. The CD4 and CD8 antigens are coupled to a protein-tyrosine kinase (p56lck) that phosphorylates the CD3 complex. Proc Natl Acad Sci U S A. 1989;86:3277-3281[Abstract/Free Full Text]. 7. Wange RL, Samelson LE. Complex complexes: signaling at the TCR. Immunity. 1996;5:197-205[CrossRef][Medline] [Order article via Infotrieve]. 8. Baume DM, Caligiuri MA, Manley TJ, Daley JF, Ritz J. Differential expression of CD8 alpha and CD8 beta associated with MHC-restricted and non-MHC-restricted cytolytic effector cells. Cell Immunol. 1990;131:352-365[CrossRef][Medline] [Order article via Infotrieve]. 9. Moebius U, Kober G, Griscelli AL, Hercend T, Meuer SC. Expression of different CD8 isoforms on distinct human lymphocyte subpopulations. Eur J Immunol. 1991;21:1793-1800[Medline] [Order article via Infotrieve]. 10. Norment AM, Littman DR. A second subunit of CD8 is expressed in human T cells. EMBO J. 1988;7:3433-3439[Medline] [Order article via Infotrieve]. 11. Terry LA, DiSanto JP, Small TN, Flomenberg N. Differential expression and regulation of the human CD8 alpha and CD8 beta chains. Tissue Antigens. 1990;35:82-91[Medline] [Order article via Infotrieve]. 12. Nakayama K, Shinkai YI, Okumura K, Nakauchi H. Isolation and characterization of the mouse CD8 beta-chain (Ly-3) genes: absence of an intervening sequence between V- and J-like gene segments. J Immunol. 1989;142:2540-2546[Abstract]. 13. Parnes JR. Molecular biology and function of CD4 and CD8. Adv Immunol. 1989;44:265-311[Medline] [Order article via Infotrieve]. 14. Bosselut R, Kubo S, Guinter T, et al. Role of CD8beta domains in CD8 coreceptor function: importance for MHC I binding, signaling, and positive selection of CD8+ T cells in the thymus. Immunity. 2000;12:409-418[CrossRef][Medline] [Order article via Infotrieve]. 15. Renard V, Romero P, Vivier E, Malissen B, Luescher IF. CD8 beta increases CD8 coreceptor function and participation in TCR-ligand binding. J Exp Med. 1996;184:2439-2444[Abstract/Free Full Text]. 16. Wheeler CJ, Chen JY, Potter TA, Parnes JR. Mechanisms of CD8beta-mediated T cell response enhancement: interaction with MHC class I/beta2-microglobulin and functional coupling to TCR/CD3. J Immunol. 1998;160:4199-4207[Abstract/Free Full Text]. 17. Irie HY, Mong MS, Itano A, et al. The cytoplasmic domain of CD8 beta regulates Lck kinase activation and CD8 T cell development. J Immunol. 1998;161:183-191[Abstract/Free Full Text]. 18. Irie HY, Ravichandran KS, Burakoff SJ. CD8 beta chain influences CD8 alpha chain-associated Lck kinase activity. J Exp Med. 1995;181:1267-1273[Abstract/Free Full Text]. 19. Kawabata K, Nagasawa M, Morio T, Okawa H, Yata J. Decreased alpha/beta heterodimer among CD8 molecules of peripheral blood T cells in Wiskott-Aldrich syndrome. Clin Immunol Immunopathol. 1996;81:129-135[CrossRef][Medline] [Order article via Infotrieve]. 20. Dulude G, Brochu S, Fontaine P, et al. Thymic and extrathymic differentiation and expansion of T lymphocytes following bone marrow transplantation in irradiated recipients. Exp Hematol. 1997;25:992-1004[Medline] [Order article via Infotrieve]. 21. Honda K, Takada H, Nagatoshi Y, et al. Thymus-independent expansion of T lymphocytes in children after allogeneic bone marrow transplantation. Bone Marrow Transplant. 2000;25:647-652[CrossRef][Medline] [Order article via Infotrieve]. 22. Schmitz JE, Forman MA, Lifton MA, et al. Expression of the CD8alpha beta-heterodimer on CD8(+) T lymphocytes in peripheral blood lymphocytes of human immunodeficiency virus and human immunodeficiency virus+ individuals. Blood. 1998;92:198-206[Abstract/Free Full Text]. 23. Leishman AJ, Gapin L, Capone M, et al. Precursors of functional MHC class I- or class II-restricted CD8aa T cells are positively selected in the thymus by agonist self-peptides. Immunity. 2002;16:355-364[CrossRef][Medline] [Order article via Infotrieve]. 24. Devine L, Rogozinski L, Naidenko OV, et al. The complementarity-determining region-like loops of CD8a interact differently with b2-microglobulin of the class I molecules H-2Kb and thymic leukemia antigen, while similarly with their a3 domains. J Immunol. 2002;168:3881-3886[Abstract/Free Full Text]. 25. Imhof BA, Dunon D, Courtois D, et al. Intestinal CD8aa and CD8ab intraepithelial lymphocytes are thymus derived and exhibit subtle differences in TCRb repertoires. J Immunol. 2000;165:6716-6722[Abstract/Free Full Text]. 26. Hazenberg MD, Otto SA, Cohen Stuart JW, et al. Increased cell division but not thymic dysfunction rapidly affects the T-cell receptor excision circle content of the naive T cell population in HIV-1 infection. Nat Med. 2000;6:1036-1042[CrossRef][Medline] [Order article via Infotrieve]. 27. McFarland RD, Douek DC, Koup RA, Picker LJ. Identification of a human recent thymic emigrant phenotype. Proc Natl Acad Sci U S A. 2000;97:4215-4220[Abstract/Free Full Text]. 28. Zeng W, Nakao S, Takamatsu H, et al. Characterization of T-cell repertoire of the bone marrow in immune-mediated aplastic anemia: evidence for the involvement of antigen-driven T-cell response in cyclosporine-dependent aplastic anemia. Blood. 1999;93:3008-3016[Abstract/Free Full Text]. 29. Choi YW, Kotzin B, Herron L, Callahan J, Marrack P, Kappler J. Interaction of Staphylococcus aureus toxin "superantigens" with human T cells. Proc Natl Acad Sci U S A. 1989;86:8941-8945[Abstract/Free Full Text]. 30. Labrecque N, McGrath H, Subramanyam M, Huber BT, Sekaly RP. Human T cells respond to mouse mammary tumor virus-encoded superantigen: V beta restriction and conserved evolutionary features. J Exp Med. 1993;177:1735-1743[Abstract/Free Full Text]. 31. Bomberger C, Singh-Jairam M, Rodey G, et al. Lymphoid reconstitution after autologous PBSC transplantation with FACS-sorted CD34+ hematopoietic progenitors. Blood. 1998;91:2588-2600[Abstract/Free Full Text]. 32. Clement LT. Isoforms of the CD45 common leukocyte antigen family: markers for human T-cell differentiation. J Clin Immunol. 1992;12:1-10[CrossRef][Medline] [Order article via Infotrieve]. 33. Young JL, Ramage JM, Gaston JS, Beverley PC. In vitro responses of human CD45RObrightRA- and CD45RO-RAbright T cell subsets and their relationship to memory and naive T cells. Eur J Immunol. 1997;27:2383-2390[Medline] [Order article via Infotrieve]. 34. Sempowski G, Thomasch J, Gooding M, et al. Effect of thymectomy on human peripheral blood T cell pools in myasthenia gravis. J Immunol. 2001;166:2808-2817[Abstract/Free Full Text]. 35. Fagnoni FF, Vescovini R, Passeri G, et al. Shortage of circulating naive CD8(+) T cells provides new insights on immunodeficiency in aging. Blood. 2000;95:2860-2868[Abstract/Free Full Text]. 36. Hamann D, Baars PA, Rep MH, et al. Phenotypic and functional separation of memory and effector human CD8+ T cells. J Exp Med. 1997;186:1407-1418[Abstract/Free Full Text]. 37. Sallusto F, Lenig D, Forster R, Lipp M, Lanzavecchia A. Two subsets of memory T lymphocytes with distinct homing potentials and effector functions. Nature. 1999;401:708-712[CrossRef][Medline] [Order article via Infotrieve]. 38. Richards SJ, Jones RA, Roberts BE, Patel D, Scott CS. Relationships between 2H4 (CD45RA) and UCHL1 (CD45RO) expression by normal blood CD4+CD8, CD4CD8+, CD4CD8dim+, CD3+CD4CD8 and CD3CD4CD8 lymphocytes. Clin Exp Immunol. 1990;81:149-155[Medline] [Order article via Infotrieve]. 39. Champagne P, Ogg GS, King AS, et al. Skewed maturation of memory HIV-specific CD8 T lymphocytes. Nature. 2001;410:106-111[CrossRef][Medline] [Order article via Infotrieve]. 40. Speiser DE, Colonna M, Ayyoub M, et al. The activatory receptor 2B4 is expressed in vivo by human CD8(+) effector alphabeta T cells. J Immunol. 2001;167:6165-6170[Abstract/Free Full Text]. 41. de Jong R, Brouwer M, Miedema F, van Lier RA. Human CD8+ T lymphocytes can be divided into CD45RA+ and CD45RO+ cells with different requirements for activation and differentiation. J Immunol. 1991;146:2088-2094[Abstract]. 42. Pannetier C, Cochet M, Darche S, Casrouge A, Zoller M, Kourilsky P. The sizes of the CDR3 hypervariable regions of the murine T-cell receptor beta chains vary as a function of the recombined germ-line segments. Proc Natl Acad Sci U S A. 1993;90:4319-4323[Abstract/Free Full Text]. 43. Kou ZC, Puhr JS, Rojas M, McCormack WT, Goodenow MM, Sleasman JW. T-Cell receptor Vbeta repertoire CDR3 length diversity differs within CD45RA and CD45RO T-cell subsets in healthy and human immunodeficiency virus-infected children. Clin Diagn Lab Immunol. 2000;7:953-959[Medline] [Order article via Infotrieve]. 44. Kong F, Chen CH, Cooper MD. Thymic function can be accurately monitored by the level of recent T cell emigrants in the circulation. Immunity. 1998;8:97-104[CrossRef][Medline] [Order article via Infotrieve]. 45. Livak F, Schatz DG. T-cell receptor alpha locus V(D)J recombination by-products are abundant in thymocytes and mature T cells. Mol Cell Biol. 1996;16:609-618[Abstract]. 46. Breit TM, Verschuren MC, Wolvers-Tettero IL, Van Gastel-Mol EJ, Hahlen K, van Dongen JJ. Human T cell leukemias with continuous V(D)J recombinase activity for TCR-delta gene deletion. J Immunol. 1997;159:4341-4349[Abstract]. 47. Wu CJ, Chillemi A, Alyea EP, et al. Reconstitution of T-cell receptor repertoire diversity following T-cell depleted allogeneic bone marrow transplantation is related to hematopoietic chimerism. Blood. 2000;95:352-359[Abstract/Free Full Text]. 48. Degano M, Garcia KC, Apostolopoulos V, Rudolph MG, Teyton L, Wilson IA. A functional hot spot for antigen recognition in a superagonist TCR/MHC complex. Immunity. 2000;12:251-261[CrossRef][Medline] [Order article via Infotrieve]. 49. Jorgensen JL, Esser U, Fazekas de St Groth B, Reay PA, Davis MM. Mapping T-cell receptor-peptide contacts by variant peptide immunization of single-chain transgenics. Nature. 1992;355:224-230[CrossRef][Medline] [Order article via Infotrieve]. 50. Pannetier C, Even J, Kourilsky P. T-cell repertoire diversity and clonal expansions in normal and clinical samples. Immunol Today. 1995;16:176-181[CrossRef][Medline] [Order article via Infotrieve]. 51. Gorski J, Yassai M, Zhu X, et al. Circulating T cell repertoire complexity in normal individuals and bone marrow recipients analyzed by CDR3 size spectratyping: correlation with immune status. J Immunol. 1994;152:5109-5119[Abstract]. 52. Arstila T, Arstila TP, Calbo S, et al. Identical T cell clones are located within the mouse gut epithelium and lamina propria and circulate in the thoracic duct lymph. J Exp Med. 2000;191:823-834[Abstract/Free Full Text]. 53. Mugnaini EN, Egeland T, Spurkland A, Brinchmann JE. The T cell receptor repertoire of CD8+CD28 T lymphocytes is dominated by expanded clones that persist over time. Clin Exp Immunol. 1999;117:298-303[CrossRef][Medline] [Order article via Infotrieve]. 54. Horiuchi T, Hirokawa M, Kawabata Y, et al. Identification of the T cell clones expanding within both CD8(+)CD28(+) and CD8(+)CD28() T cell subsets in recipients of allogeneic hematopoietic cell grafts and its implication in post-transplant skewing of T cell receptor repertoire. Bone Marrow Transplant. 2001;27:731-739[CrossRef][Medline] [Order article via Infotrieve]. 55. Leclercq G, Plum J. Thymic and extrathymic T cell development. Leukemia. 1996;10:1853-1859[Medline] [Order article via Infotrieve]. 56. Fung-Leung WP, Kundig TM, Ngo K, et al. Reduced thymic maturation but normal effector function of CD8+ T cells in CD8 beta gene-targeted mice. J Exp Med. 1994;180:959-967[Abstract/Free Full Text]. 57. Nakayama K, Negishi I, Kuida K, et al. Requirement for CD8 beta chain in positive selection of CD8-lineage T cells. Science. 1994;263:1131-1133[Abstract/Free Full Text]. 58. Rocha B, Vassalli P, Guy-Grand D. Thymic and extrathymic origins of gut intraepithelial lymphocyte populations in mice. J Exp Med. 1994;180:681-686[Abstract/Free Full Text]. 59. Hamerman JA, Page ST, Pullen AM. Distinct methylation states of the CD8 beta gene in peripheral T cells and intraepithelial lymphocytes. J Immunol. 1997;159:1240-1246[Abstract]. 60. Regnault A, Cumano A, Vassalli P, Guy-Grand D, Kourilsky P. Oligoclonal repertoire of the CD8 alpha alpha and the CD8 alpha beta TCR-alpha/beta murine intestinal intraepithelial T lymphocytes: evidence for the random emergence of T cells. J Exp Med. 1994;180:1345-1358[Abstract/Free Full Text]. © 2002 by The American Society of Hematology.   CiteULike    Connotea    Del.icio.us    Digg    Reddit    Technorati    What's this? This article has been cited by other articles: A. Berndt, J. Pieper, and U. Methner Circulating {gamma}{delta} T Cells in Response to Salmonella enterica Serovar Enteritidis Exposure in Chickens Infect. Immun., July 1, 2006; 74(7): 3967 - 3978. [Abstract] [Full Text] [PDF] H.-R. Kim, M. S. Hong, J. M. Dan, and I. Kang Altered IL-7R{alpha} expression with aging and the potential implications of IL-7 therapy on CD8+ T-cell immune responses Blood, April 1, 2006; 107(7): 2855 - 2862. [Abstract] [Full Text] [PDF] T. Takahashi, S. Dejbakhsh-Jones, and S. Strober Expression of CD161 (NKR-P1A) Defines Subsets of Human CD4 and CD8 T Cells with Different Functional Activities J. Immunol., January 1, 2006; 176(1): 211 - 216. [Abstract] [Full Text] [PDF] T. Wada, S. H. Schurman, E. K. Garabedian, A. Yachie, and F. Candotti Analysis of T-cell repertoire diversity in Wiskott-Aldrich syndrome Blood, December 1, 2005; 106(12): 3895 - 3897. [Abstract] [Full Text] [PDF] T. Wada, T. Toma, H. Okamoto, Y. Kasahara, S. Koizumi, K. Agematsu, H. Kimura, A. Shimada, Y. Hayashi, M. Kato, et al. Oligoclonal expansion of T lymphocytes with multiple second-site mutations leads to Omenn syndrome in a patient with RAG1-deficient severe combined immunodeficiency Blood, September 15, 2005; 106(6): 2099 - 2101. [Abstract] [Full Text] [PDF] A. Attinger, L. Devine, Y. Wang-Zhu, D. Martin, J.-h. Wang, E. L. Reinherz, M. Kronenberg, H. Cheroutre, and P. Kavathas Molecular Basis for the High Affinity Interaction between the Thymic Leukemia Antigen and the CD8{alpha}{alpha} Molecule J. Immunol., March 15, 2005; 174(6): 3501 - 3507. [Abstract] [Full Text] [PDF] Y. Nishimura, M. Shimojima, E. Sato, Y. Izumiya, Y. Tohya, T. Mikami, and T. Miyazawa Downmodulation of CD3{varepsilon} expression in CD8{alpha}+{beta}- T cells of feline immunodeficiency virus-infected cats J. Gen. Virol., September 1, 2004; 85(9): 2585 - 2589. [Abstract] [Full Text] [PDF] L. T. Madakamutil, U. Christen, C. J. Lena, Y. Wang-Zhu, A. Attinger, M. Sundarrajan, W. Ellmeier, M. G. von Herrath, P. Jensen, D. R. Littman, et al. CD8{alpha}{alpha}-Mediated Survival and Differentiation of CD8 Memory T Cell Precursors Science, April 23, 2004; 304(5670): 590 - 593. [Abstract] [Full Text] [PDF] This Article Abstract Full Text (PDF) All Versions of this Article: 2002-04-1136v1 100/12/4090    most recent Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Konno, A. Articles by Koizumi, S. Search for Related Content PubMed PubMed Citation Articles by Konno, A. Articles by Koizumi, S. Related Collections Immunobiology Social Bookmarking                   What's this?

	Copyright © 2002 by American Society of Hematology         Online ISSN: 1528-0020