Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
Prepublished online as a Blood First Edition Paper on July 25, 2002; DOI 10.1182/blood-2002-04-1136.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2002-04-1136v1
100/12/4090    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Konno, A.
Right arrow Articles by Koizumi, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Konno, A.
Right arrow Articles by Koizumi, S.
Related Collections
Right arrow Immunobiology
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, 1 December 2002, Vol. 100, No. 12, pp. 4090-4097

IMMUNOBIOLOGY

CD8alpha alpha memory effector T cells descend directly from clonally expanded CD8alpha +beta high TCRalpha beta T cells in vivo

Akihiro Konno, Kanae Okada, Kazunori Mizuno, Mika Nishida, Shuya Nagaoki, Tomoko Toma, Takahiro Uehara, Kazuhide Ohta, Yoshihito Kasahara, Hidetoshi Seki, Akihiro Yachie, and Shoichi Koizumi

From the Department of Pediatrics, Angiogenesis and Vascular Development, Graduate School of Medical Science and School of Medicine, Kanazawa University and School of Health Sciences, Faculty of Medicine, Kanazawa University, Kanazawa, Japan.


    Abstract
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Whereas most peripheral CD8+ alpha beta T cells highly express CD8alpha beta heterodimer in healthy individuals, there is an increase of CD8alpha +beta low or CD8alpha alpha alpha beta T cells in HIV infection or Wiskott-Aldrich syndrome and after bone marrow transplantation. The significance of these uncommon cell populations is not well understood. There has been some question as to whether these subsets and CD8alpha +beta high cells belong to different ontogenic lineages or whether a fraction of CD8alpha +beta high cells have down-regulated CD8beta chain. Here we assessed clonality of CD8alpha alpha and CD8alpha +beta low alpha beta T cells as well as their phenotypic and functional characteristics. Deduced from surface antigens, cytotoxic granule constituents, and cytokine production, CD8alpha +beta low cells are exclusively composed of effector memory cells. CD8alpha alpha cells comprise effector memory cells and terminally differentiated CD45RO-CCR7- memory cells. T-cell receptor (TCR) Vbeta complementarity-determining region 3 (CDR3) spectratyping analysis and subsequent sequencing of CDR3 cDNA clones revealed polyclonality of CD8alpha +beta high cells and oligoclonality of CD8alpha +beta low and CD8alpha alpha cells. Importantly, some expanded clones within CD8alpha alpha cells were also identified within CD8alpha +beta high and CD8alpha +beta low subpopulations. Furthermore, signal-joint TCR rearrangement excision circles concentration was reduced with the loss of CD8beta expression. These results indicated that some specific CD8alpha +beta high alpha beta T cells expand clonally, differentiate, and simultaneously down-regulate CD8beta chain possibly by an antigen-driven mechanism. Provided that antigenic stimulation directly influences the emergence of CD8alpha alpha alpha beta T cells, these cells, which have been previously regarded as of extrathymic origin, may present new insights into the mechanisms of autoimmune diseases and immunodeficiencies, and also serve as a useful biomarker to evaluate the disease activities. (Blood. 2002;100:4090-4097)

© 2002 by The American Society of Hematology.

    Introduction
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

CD8 is a coreceptor that recognizes the nonpolymorphic alpha 3 domain of the major histocompatibility complex (MHC) class I molecules and is necessary for T-cell activation.1,2 It increases the avidity of the interaction between the CD8-bearing T cell and the antigen-presenting cell.1,3,4 With the T-cell receptor (TCR)-peptide-MHC ligation, simultaneous coligation of the coreceptor juxtaposes MHC-engaged TCR complexes with intracellular signaling intermediates, leading to increased tyrosine phosphorylation and further recruitment and activation of downstream signaling effector molecules.2,5-7 CD8 antigen is composed of 2 kinds of molecules, alpha  and beta  chain, and is expressed either as an alpha alpha homodimer or an alpha beta heterodimer.8-11 These isoforms are the products of closely linked but distinct genes exhibiting only moderate sequence homology.12,13 Studies of CD8alpha and CD8beta have revealed the distinct contributions to the coreceptor function. CD8alpha can interact with all molecules presently known to be involved in CD8 function by itself. CD8beta , on the contrary, has roles to make the coreceptor function more efficiently as CD8alpha beta heterodimers. Extracellular domain of CD8beta increases the avidity of CD8 binding to MHC class I14 and influences specificity of the CD8/MHC/TCR interaction.15 CD8beta may also uniquely mediate efficient interaction with the TCR/CD3 complex.16 In addition, the intracellular domain of CD8beta enhances association of CD8alpha with Lck and linker for activation of T cells (LAT).14,17,18

In healthy individuals, most thymocytes and peripheral T cells highly express the heterodimeric form of CD8.17 These CD8alpha +beta high T cells express not only CD8alpha beta heterodimers but also CD8alpha alpha homodimers on the same cells.9,10 On the other hand, specific subpopulations of natural killer (NK) cells and intestinal gamma delta T cells exclusively express CD8alpha alpha .17 However, CD8alpha +beta low and CD8alpha alpha alpha beta T cells increase in the periphery in some conditions. Patients with Wiskott-Aldrich syndrome (WAS) are reported to have CD8+ T cells composed mostly of CD8alpha alpha homodimers.19 Also, a large proportion of CD8+ T cells reconstituted in bone marrow transplant recipients express CD8alpha alpha homodimers.20,21 In addition, HIV infection is characterized by the appearance of a major CD8 subpopulation with reduced CD8beta chains, which exhibits strong antiviral activity.22

Although there has been much controversy as to the origin and the functional roles of these cells, there is increasing evidence in recent literature to suggest that CD8alpha alpha alpha beta T cells derive from the thymus after positive selection and that they exhibit distinct functions from conventional CD8alpha beta alpha beta T cells.23,24 Furthermore, it seems that expression of CD8alpha chains is secondarily regulated by the intestinal microenvironments.25 However, despite the extensive studies of CD8alpha and beta  chains in vitro and the studies on a molecular basis, heterogeneity of CD8 isoform expression may not have been examined thoroughly in various human disorders and clinical conditions. Moreover, the in vivo function and clinical significance of CD8alpha alpha and CD8alpha +beta low alpha beta T cells are poorly understood. The purpose of this study is to reveal in vivo cell function and the origin of CD8alpha alpha and CD8alpha +beta low alpha beta T cells. More specifically, we analyzed cell surface antigen expression, cytotoxic granule constituents, and cytokine production of these subpopulations. Furthermore, this study also examined if CD8alpha alpha and CD8alpha +beta low alpha beta T cells comprise distinct clones, or if they descend directly from CD8alpha +beta high cells by down-regulating CD8beta chain after antigen stimulation in vivo.


    Materials and methods
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Monoclonal antibodies

Fluorescein isothiocyanate (FITC)-conjugated monoclonal antibodies (mAbs) recognizing CD95, CD45RO, and R-phycoerythrin-Cyanine5 (RPE-Cy5)-conjugated anti-CD8alpha mAb were purchased from Dako (Glostrup, Denmark). FITC-conjugated mAbs against CD16, CD27, CD57, TCRalpha beta , interleukin 2 (IL-2), interferon gamma  (IFN-gamma ), and mouse IgG antibodies as well as nonconjugated anti-CCR7 mAbs were obtained from BD Pharmingen (San Diego, CA). FITC-conjugated anti-CD28, anti-TCRgamma delta , anti-CD62L, PE-conjugated anti-CD8beta , anti-2B4, anti-TIA-1 (a cytotoxic granule-associated protein), and nonconjugated anti-CD8beta mAbs were products of Beckman Coulter (Tokyo, Japan). PE-conjugated mAbs against perforin and granzyme B were purchased from Ancell (Bayport, MN) and Research Diagnostics (Flanders, NJ), respectively.

Cell preparation and flow cytometric analysis

Human peripheral blood mononuclear cells (PBMNCs) were isolated from heparinized peripheral blood by Ficoll-Hypaque density centrifugation. CD16+ and TCRgamma delta + cells were then depleted using MACS and anti-FITC magnetic beads (Miltenyi Biotec, Bergisch Gladbach, Germany) after staining with FITC-conjugated anti-TCRgamma delta and anti-CD16 mAbs. The negatively sorted cells (purity > 99%) were stained with PE-conjugated anti-CD8beta and RPE-Cy5-conjugated anti-CD8alpha mAb in combination with FITC-conjugated anti-TCRalpha beta , anti-CD62L, anti-CD57, anti-CD95, anti-HLA-DR, or anti-CD45RO mAbs. For the analysis of CCR7 expression, nonconjugated anti-CCR7 mAbs were used with FITC-conjugated goat antimouse antibodies. Similarly, 2B4 expression was analyzed using FITC-conjugated goat antimouse antibodies with the staining with nonconjugated anti-CD8beta mAbs and PE-conjugated anti-2B4 mAbs. These stained cells, after washing with phosphate-buffered saline (PBS), were analyzed on a FACSCalibur flow cytometer (BD Biosciences, Tokyo, Japan). In addition, for signal-joint TCR rearrangement excision circles (Sj TRECs) quantification and TCR complementarity-determining region 3 (CDR3) spectratyping and sequencing, CD8alpha + alpha beta T cells with different (high, low, or negative) CD8beta expression were separated using an Epics ELITE flow cytometer (Coulter Electronics, Hialeah, FL) after depletion of CD4+, CD14+, CD16+, CD20+, and TCRgamma delta + cells with MACS (purity > 98%). Patterns of flow cytometric analysis pursued for 3 to 6 independent donors were similarly otherwise noted, and the representative results were presented.

Flow cytometric detection of cytokine production and intracellular staining for cytotoxic granule constituents

TCRgamma delta -depleted and CD16-depleted PBMNCs (TCRgamma delta - CD16- PBMNCs) were stimulated for 6 hours with 10 ng/mL phorbol myristate acetate (PMA) and 500 ng/mL A23187 in the presence of 1 µg/mL monensin (Sigma, St Louis, MO). After cell surface staining with PE-conjugated CD8beta and RPE-Cy5-conjugated CD8alpha , cells were fixed and permeabilized with Cytofix/Cytoperm Plus Kit (BD Pharmingen) per the manufacturer's instruction. Staining of the cytoplasm with FITC-conjugated anti-IFN-gamma or anti-IL-2 mAb followed. Separately, freshly isolated TCRgamma delta -CD16- PBMNCs were treated with anti-CD8beta mAb followed by FITC-conjugated goat antimouse antibodies. They were further stained with RPE-Cy-5-conjugated anti-CD8alpha mAbs after blocking with normal mouse serum. After fixation and permeabilization, the cells were stained with PE-conjugated antiperforin, antigranzyme B, or anti-TIA-1 mAbs.

RNA extraction and cDNA preparation

Total RNA was extracted from separated CD8+ alpha beta T cells with TRIZOL reagent following the manufacturer's instructions (Gibco BRL, Bethesda, MD). The RNA was then reverse-transcribed into cDNA in a reaction primed with oligo(dt)12-18 using SuperScript II reverse transcriptase as recommended by the manufacturer (Gibco BRL).

Sj TREC quantification

Sj TRECs were quantified in sorted CD8+ alpha beta T-cell subsets by a real-time quantitative polymerase chain reaction (PCR) method as described previously.26,27 Sorted cells were lysed in 100 µg/mL proteinase K (Wako Pure Chemical Industries, Osaka, Japan) for 1 hour at 56°C and then 10 minutes at 95°C at 107 cells/mL. Then PCR was carried out on 5 µL cell lysate in a spectrofluorometric thermal cycler (ABI PRISM 7700, Applied Biosystems, Osaka, Japan) under the following conditions: 50°C for 2 minutes followed by 95°C for 10 minutes, after which 50 cycles of amplification were carried out (95°C for 15 seconds, 60°C for 1 minute). The sequences of the primers and probe used were the following: forward primer GGAAAACACAGTGTGACATGGA, reverse primer GTCAACAAAGGTGATGCCACAT, and the probe FAM-CCTGTCTGCTCTTCATTCACCGTTCTCA-TAMRA. A standard curve was plotted, and Sj TREC values for samples were calculated by ABI PRISM 7700 software.

CDR3 spectratyping

CDR3 spectratyping was pursued as previously described.28 Briefly, cDNA was amplified by PCR through 35 cycles (94°C for 1 minute, 55°C for 1 minute, and 72°C for 1 minute) with a primer specific to 24 different BV subfamilies (BVs 1-2029 and BVs21-2430) and a fluorescent BC primer.29 The fluorescent PCR products were mixed with formamide and the size standard (GeneScan-500 TAMRA, Applied Biosystems). After denaturation for 2 minutes at 90°C, the products were analyzed with an automated 310 DNA sequencer (Applied Biosystems), and the data were analyzed with GeneScan software (Applied Biosystems).

The overall complexity within a Vbeta subfamily was determined by counting the numbers of discrete peaks and determining their relative size on the spectratype histogram. We used a complexity scoring system31 with our interpretation, that is, complexity score = (sum of all the peak heights/sum of the major peak heights) × (number of the major peaks). Major peaks were defined as those peaks on the spectratype histogram whose amplitude was at least 10% of the sum of all the peak heights.

Cloning and sequencing of PCR-amplified cDNA

The PCR products of some BV cDNA were electrophoresed on an agarose gel and purified using QIAquick Gel Extraction Kit (Qiagen, Tokyo, Japan), and then cloned with TOPO TA Cloning (Invitrogen, Carlsbad, CA). Eleven to 19 colonies containing the insert fragment were randomly selected. Purified with QIAprep Spin Miniprep Kit (Qiagen), the recombinant plasmids were subjected to fluorescence dye terminator cycle sequencing, and the sequence reactions were analyzed on a 310 DNA sequencer (Applied Biosystems) after removal of the unincorporated fluorescence dye with Centri-Sep Spin Columns (Applied Biosystems).

Statistical analysis

Association of the percentage of peripheral CD8alpha +beta low and CD8alpha alpha alpha beta T cells with age was analyzed using the Spearman rank correlation coefficient. The Wilcoxon signed rank test was applied to examine statistically significant differences of CDR3 complexity scores between subpopulations of different CD8beta expression.


    Results
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

CD8alpha +beta low and CD8alpha alpha alpha beta T cells expand with advancing age

To ensure that the number of peripheral CD8alpha +beta low and CD8alpha alpha alpha beta T cells are limited in healthy individuals, we first stained PBMNCs with anti-TCRalpha beta , anti-CD8beta , and anti-CD8alpha mAbs conjugated to different fluorochromes in several healthy individuals including cord blood. CD8alpha + TCRalpha beta + cells could be classified into 3 groups defined by the level of CD8beta expression: CD8alpha +beta high, CD8 alpha +beta low, and CD8 alpha +beta -, which is CD8alpha alpha . Although CD8alpha alpha alpha beta T cells were negligible and small numbers of CD8alpha +beta low alpha beta T cells existed in cord blood, these populations increased in a 5-year-old child and even more in an adult (Figure 1). To assess the developmental changes of CD8alpha +beta low and CD8alpha alpha alpha beta T cells, we evaluated the frequency of these subpopulations in various age groups using more blood samples. In cord blood, CD8alpha +beta low and CD8alpha alpha alpha beta T cells represented a minor population within CD8alpha + alpha beta T cells. These subpopulations increased with advancing age as expected (P < .01). However, it is notable that some adults showed levels of CD8alpha +beta low and CD8alpha alpha alpha beta T cells as low as neonates (Figure 2).


View larger version (18K):
[in this window]
[in a new window]
 
Figure 1. CD8beta expression on CD8alpha + alpha beta T cells in healthy individuals. PBMNCs from healthy individuals and cord blood were stained with FITC-conjugated anti-TCRalpha beta , PE-conjugated anti-CD8beta , and RPE-Cy5-conjugated anti-CD8alpha mAbs. TCRalpha beta and CD8alpha gated cells were analyzed for the expression of CD8alpha (y-axis) versus CD8beta (x-axis). Representative data are displayed.



View larger version (10K):
[in this window]
[in a new window]
 
Figure 2. Developmental change of CD8alpha +beta low and CD8alpha alpha fractions within CD8alpha + alpha beta T cells. CD8alpha + alpha beta T cells were analyzed for CD8beta expression, and the total frequencies of CD8alpha +beta low and CD8alpha alpha fractions were plotted along different age groups.

Correlation of CD8beta expression with other surface markers

We next compared the expression of the various surface antigen markers on CD8alpha + alpha beta T cells with different levels of CD8beta expression. Before pursuing 3-color flow cytometric analysis, we depleted CD16+ NK cells and TCRgamma delta + T cells from PBMNCs because these cells contain CD8alpha + cells. The depletion of CD16+ and TCRgamma delta + cells yielded TCRalpha beta + or CD3+ cells with more than 98% purity when gated on CD8alpha (Figure 3A). CD8alpha +beta high cells were heterogeneous for the expression of all the surface antigens analyzed. In the CD8alpha +beta low subpopulation, CD95+, CD45RO+, and 2B4+ cells became dominant, and the subset lost CD62L and CCR7 antigens. Most CD8alpha alpha T cells expressed CD95 and 2B4, but not CD57, CD62L, or CCR7. Although more than half of 7 adults analyzed had CD8alpha alpha cells, which exclusively expressed CD45RO, CD27, and CD28, the rest of the individuals possessed CD8alpha alpha cells that were as much as 30% negative for these surface antigens (Figure 3B and data not shown).


View larger version (63K):
[in this window]
[in a new window]
 
Figure 3. Analysis of surface antigen expression on CD8alpha + alpha beta T cells. TCRgamma delta - CD16- PBMNCs were stained with CD8beta , CD8alpha , and TCRalpha beta or CD3 (A), or other various surface antigens as indicated (B). CD8alpha gated cells are displayed.

Cytotoxic granule proteins and cytokine production

To further characterize the subpopulations of CD8+ alpha beta T cells with regard to CD8beta -chain expression, we analyzed CD8+ alpha beta T cells for the presence of perforin, granzyme B, and TIA-1. CD8alpha +beta high cells were heterogeneous for the expression of the cytotoxic granule constituents. CD8alpha +beta low cells were also heterogeneous for the expression of perforin and granzyme B, but the subset entirely expressed TIA-1. A large number of CD8alpha alpha T cells possessed perforin and nearly all the cells contained TIA-1, whereas CD8alpha alpha cells did not contain granzyme B (Figure 4A).


View larger version (43K):
[in this window]
[in a new window]
 
Figure 4. Cytotoxic granule constituents and cytokine production. (A) TCRgamma delta - CD16- PBMNCs were stained with anti-CD8beta mAbs recognized by FITC-conjugated goat-antimouse antibodies, RPE-Cy5-conjugated anti-CD8alpha , and PE-conjugated antiperforin, antigranzyme B, or anti-TIA-1 mAbs. (B) After the stimulation with PMA and A23187 in the presence of monensin, TCRgamma delta -CD16- PBMNCs were stained with PE-conjugated anti-CD8beta , RPE-Cy5-conjugated anti-CD8alpha , and FITC-conjugated anti-IL-2 or anti-IFN-gamma mAbs. CD8alpha gated cells are displayed.

Because cytokine production capacity is also a major factor determining cell functions, CD8+ alpha beta T cells were stimulated for 6 hours with PMA and calcium ionophore in the presence of monensin for analysis of IFN-gamma and IL-2 production. Heterogeneity for the cytokine production was observed in the CD8alpha +beta high subset. Entire CD8alpha +beta low cells produced IFN-gamma , and some proportion of the cells produced IL-2. CD8alpha alpha cells exclusively expressed IFN-gamma , but not IL-2 (Figure 4B).

CD8alpha +beta low and CD8alpha alpha alpha beta T cells exhibit less clonal diversity

Sequence analysis of CDR3 length diversity in CD8alpha +beta high, CD8alpha +beta low, and CD8alpha alpha alpha beta T cells was pursued to define the extent of clonal expansion. About 5 × 105 cells of each subpopulation were isolated, and their cDNA was subjected to PCR amplification with 24 Vbeta -specific primers. TCR spectratypes of CD8alpha +beta high cells exhibited, with a few exceptions, a gaussianlike distribution, indicating that the subset comprises cells with highly diverse and polyclonal TCR repertoires. The profile of CD8alpha +beta low cells revealed skewed CDR3 size distribution in some Vbeta subfamilies, but about one third of Vbeta subfamilies remained diverse. To a further extent, the majority of Vbeta subfamilies of CD8alpha alpha cells displayed apparently skewed patterns, many of them with an almost single peak pattern (Figure 5).


View larger version (51K):
[in this window]
[in a new window]
 
Figure 5. Spectratypes of the T-cell repertoire within CD8alpha +beta high, CD8alpha +beta low, and CD8alpha alpha alpha beta T cells. Histograms of the relative sizes of the PCR-amplified CDR3 region within CD8alpha +beta high, CD8alpha +beta low, and CD8alpha alpha alpha beta T cells in one donor are shown. The y-axis is relative quantity of RNA bearing the specific TCR Vbeta . The x-axis represents the nucleotide length of the PCR-amplified TCR gene products.

To quantify differences in the TCR Vbeta gene repertoire among the T-cell subsets, we assigned complexity scores to each sample analyzed. Samples from 2 donors were presented; one of them (donor 1) did not possess CD8alpha alpha alpha beta T cells enough to be isolated. In donor 1, complexity scores of CD8alpha +beta low cells were significantly lower than CD8alpha +beta high cells (P < .01). Likewise, complexity scores of CD8alpha + alpha beta T cells in donor 2 decreased as they lost CD8beta expression (CD8alpha +beta high versus CD8alpha +beta low cells, P < .05; CD8alpha +beta low versus CD8alpha alpha cells, P < .001; Figure 6). These results suggest that CD8alpha +beta low and, to a larger extent, CD8alpha alpha alpha beta T cells comprise oligoclonally proliferated cells.


View larger version (25K):
[in this window]
[in a new window]
 
Figure 6. Comparison of TCR Vbeta CDR3 complexity scores among CD8alpha + alpha beta T cells with different CD8beta expression. Complexity scores were generated for each TCR BV from the CDR3 spectratype analysis. The individual complexity scores were plotted along CD8beta expression, and the dots for the same BVs were connected with lines. Representative data of 2 donors are shown.

Identical clones exist among CD8alpha +beta high, CD8alpha +beta low, and CD8alpha alpha cells

It needs to be confirmed directly that CD8alpha +beta low and CD8alpha alpha alpha beta T cells are oligoclonally proliferated cells. Therefore, the PCR products were then cloned and the nucleotide sequence of CDR3 was determined (Table 1). This analysis also provides the information if identical clones exist among the subpopulations of different CD8beta expression. In this experiment, we used the cDNA samples from one donor so that the pruity of each sorted cell fraction was more than 98% and the number was identical for all BVs within a given cell fraction. In addition, we selected BV21, BV20, and BV14 because these BVs exhibited distinct patterns of spectratypes within CD8alpha +beta high, CD8alpha +beta low, and CD8alpha alpha alpha beta T cells (BV21: polyclonal, polyclonal, and oligoclonal; BV20: polyclonal, oligoclonal, and oligoclonal; and BV14: oligoclonal, oligoclonal, and oligoclonal; Figure 7).

                              
View this table:
[in this window]
[in a new window]
 
Table 1. The amino acid composition of the CDR3 region within CD8alpha +beta high, CD8alpha +beta low, and CD8alpha alpha alpha beta T cells



View larger version (23K):
[in this window]
[in a new window]
 
Figure 7. Spectratypes of TCR BV21, BV20, and BV14. Spectratyping analysis of alpha beta T cells within CD8alpha +beta high, CD8alpha +beta low, and CD8alpha alpha subpopulations was pursued in another healthy donor. Histograms of BV21, BV20, and BV14 are displayed as Figure 5.

As for BV21, 19 CDR3 cDNA clones of CD8alpha +beta high cells were randomly selected and sequenced. Consistent with spectratyping, heterogeneous CDR3 clones were sequenced, which indicated that CD8alpha +beta high cells possessing TCR Vbeta 21 were polyclonal. Conversely, a large number of cDNA clones were determined to be identical in CD8alpha alpha cells; in 9 of 16 clones the amino acid sequence of the N-D-N region was PVSGRL (designated as clone PVSGRL; single-letter amino acid codes). This clone was also identified in CD8alpha +beta low cells (3 of 16 clones). However, this clone PVSGRL was not found in the CD8alpha +beta high subpopulation. Although an additional 46 cDNA clones within CD8alpha +beta high cells were analyzed, this clone was not detected (data not shown). In contrast, another clone, LDPSQGH, was detected within CD8alpha +beta high cells and CD8alpha +beta low cells in the frequency of 2 of 19 and 3 of 16, respectively, but not within CD8alpha alpha cells. Notably, the third clone, FVSGS, was found within CD8alpha +beta high, CD8alpha +beta low, and CD8alpha alpha cells, although the clone was not dominant within these subpopulations (1 of 19, 3 of 16, and 2 of 16, respectively).

In BV20, a major clone, SPVSWA, within CD8alpha alpha cells (10 of 14 clones) dominated within CD8alpha +beta low cells (9 of 11 clones). This clone was also detected within CD8alpha +beta high cells (2 of 15 clones). In BV14, where spectratypes of CD8alpha +beta high, CD8alpha +beta low, and CD8alpha alpha subpopulations were all oligoclonal, clone GQSR was identified predominantly within the cells of all the subpopulations. To ensure that sharing of the identical clones among CD8alpha +beta high, CD8alpha +beta low, and CD8alpha alpha subpopulations holds true for other individuals, we determined CDR3 sequences of BV17 from a different healthy donor; a dominant clone, SATVSYEQY, (7 of 10 clones) and a clone KPAGTFVLF (2 of 10 clones) within CD8alpha alpha cells were also detected within CD8alpha +beta high cells at a frequency of 3 of 18 and 1 of 18, respectively (data not shown). Taken together, it is proved that the cells with skewed BV spectratypes, frequently observed in CD8alpha +beta low and CD8alpha alpha subpopulations, comprise oligoclonally proliferated cells. More importantly, CD8alpha +beta high, CD8alpha +beta low, and CD8alpha alpha alpha beta T cells can possess the same cell clones. Some of these clones also become dominant with the loss of CD8beta chains. These results suggest that some cell clones proliferate while down-regulating CD8beta chains.

Sj TREC concentrations decreased with the down-regulation of CD8beta

If CD8alpha alpha alpha beta T cells descend from CD8alpha +beta high alpha beta T cells, CD8alpha alpha cells have undergone cell division more than CD8alpha +beta low, and still more than CD8alpha +beta high alpha beta T cells. To assess the relative proliferative history of CD8+ alpha beta T-cell populations defined by the intensity of CD8beta expression, we measured Sj TREC concentrations in CD8alpha +beta high, CD8alpha +beta low, and CD8alpha alpha alpha beta T-cell subsets. In all 3 donors examined, Sj TREC levels were higher in CD8alpha +beta high alpha beta T cells, and the number of Sj TREC copies declined with the loss of CD8beta expression (Table 2). These results, supporting the findings of spectratyping analysis, indicate that CD8alpha +beta high alpha beta T cells, at least at the population level, can differentiate to CD8alpha alpha alpha beta T cells but not the opposite way.

                              
View this table:
[in this window]
[in a new window]
 
Table 2. Quantification of Sj TREC within CD8alpha +beta high, CD8alpha +beta low, and CD8alpha alpha alpha beta T cells


    Discussion
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

In the present paper, we tried to show that peripheral blood CD8alpha alpha or CD8alpha +beta low alpha beta T cells derive directly from CD8alpha +beta high alpha beta T cells, presumably by an antigen-driven mechanism. Three different approaches were undertaken. At first, age-dependent changes in the proportions of CD8alpha alpha and CD8alpha +beta low alpha beta T cells were examined.

In cord blood, CD8alpha alpha alpha beta T cells were negligible and relatively small numbers of CD8alpha +beta low alpha beta T cells were detected. These populations increased with advancing age. They made up even about a half of the CD8alpha + alpha beta T cells in some healthy adults. Neonatal T cells are exclusively composed of naive cells, and in repeated antigenic stimulations with age, infection and autoreactivity convert the naive cells to effector and memory cells.32 Therefore, CD8alpha alpha and CD8alpha +beta low alpha beta T cells may represent antigen-experienced cells. A wide range of the variation in the frequencies of these cells among adult individuals supports this notion.

Secondly, surface antigen expression, cytotoxic granule constituents, and cytokine production of CD8+ alpha beta T cells were assessed to characterize phenotype and functional features. The results of surface marker analysis were consistent with previous data that assessed surface expression of CD8alpha beta heterodimer on the positive and negative fractions of various antigens within CD8+ T cells.22 Several surface markers have been proposed for identification of naive, effector, and memory T cells. Although the CD45RA isoform can revert from CD45RO,33 double labeling with CD45RA and CD62L is frequently used for the identification of the cell phenotype.34,35 Alternatively, it is reported that simultaneous staining with CD45RA and CD27 mAbs can separate the majority of human CD8+ T cells into 3 functionally distinct subpopulations: CD45RA+ CD27+ cells, CD45RA+ CD27- cells, and CD45RA- CD27+ cells, which are naive, effector, and memory phenotype, respectively.36 Recently, naive T cells were identified as CD95- T lymphocytes.35 In addition, CCR7+ memory T cells were designated as central memory cells with the counterpart as effector memory cells.37 Considering data from these reports and that T cells reciprocally express CD45RA or CD45RO,38 the CD8alpha +beta low subpopulation contains effector memory cells. Although the CD8alpha alpha subpopulation exclusively comprised cells of the same surface phenotype as CD8alpha +beta low cells in more than half of the individuals analyzed, there were appreciable CD45RO-CCR7- cells within the CD8alpha alpha subpopulation in others. Because of the skewed spectratypes and low Sj TREC concentration, these CD45RO-CCR7- cells may represent terminally differentiated memory cells.39

Perforin, granzyme B, and TIA-1 expression were compatible with the surface phenotype of CD8alpha +beta low subpopulations because the cytotoxic granule constituents are effector cell properties.40 Perforin and TIA-1 were also produced in CD8alpha alpha cells. It remains to be elucidated that CD8alpha alpha cells did not express granzyme B. As for cytokine production, both CD8alpha +beta low and CD8alpha alpha cells produced IFN-gamma but not IL-2. Naive cells solely produce IL-2, and effector cells generate IFN-gamma but not IL-2. Memory cells, on the contrary, produce both of them.36,41 However, IL-2 production is prominent in central memory cells; that of effector memory cells is significantly reduced.37 Therefore, the results of the cytokine production also support that CD8alpha +beta low and CD8alpha alpha alpha beta T cells are effector memory cells.

Thirdly, analysis of CDR3 length diversity can be used to define the extent of clonal expansion within the TCR repertoire.42,43 The TCR Vbeta CDR3 complexity decreased in CD8+ T cells with diminished CD8beta expression. The results suggest that CD8alpha +beta low and, moreover, CD8alpha alpha alpha beta T cells have proliferated extensively probably by antigenic stimulations. Also, the history of cell proliferation can be assessed by Sj TREC concentrations. Sj TRECs are the episomal DNA circles generated during excisional rearrangement of TCR genes.44 Not replicating during mitosis, they are diluted during cell division.45,46 Sj TREC value was significantly higher in CD8alpha +beta high alpha beta T cells but reduced with the loss of CD8beta chains, consistent with decrease in TCR Vbeta CDR3 complexity. These data collectively indicated that CD8alpha +beta high alpha beta T cells diminish the CD8beta -chain expression as they are activated, proliferate, and acquire memory phenotypes and functions in vivo.

To prove directly that particular CD8+ T cells change the levels of beta -chain expression in vivo, we tried to clarify that the same clones exist among CD8alpha +beta high, CD8alpha +beta low, and CD8alpha alpha alpha beta T cells, and pursued TCR Vbeta CDR3 sequence analysis. The CDR3 forms the contact site for binding to MHC expressed by antigen-presenting cells. The region bears the fine specificity of antigen recognition.47-50 Therefore, the CDR3 sequence defines a distinctive TCR clonotype that acts as a fingerprint for the T-cell lineage bearing it.51 On the basis of TCR Vbeta CDR3 spectratyping and their sequences, recent studies proposed that identical T-cell clones are located within the mouse gut epithelium and lamina propria and circulate in the thoracic duct lymph,52 or that CD8+CD28- T cells descend directly from CD8+CD28+ T cells in humans.53,54 In the experiment presented here, the same clones were identified among CD8alpha +beta high, CD8alpha +beta low, and CD8alpha alpha alpha beta T cells in all of 3 BVs analyzed. Because the major clones sequenced within CD8alpha alpha cells were not identified within the CD8alpha +beta high subset in BV21, it is unlikely that clones sequenced within the CD8alpha +beta high subpopulation are derived from missorted CD8alpha alpha alpha beta T cells. This result may rather be explained by the fact that all cells of the clone have already down-regulated CD8beta . Missorting can neither explain the result in BV14, which showed that the major clones sequenced among CD8alpha +beta high, CD8alpha +beta low, and CD8alpha alpha alpha beta T cells were identical. Therefore, the sequence result suggests CD8alpha +beta high, CD8alpha +beta low, and CD8alpha alpha alpha beta T cells can share the same clones. Considering the differentiation stage, spectratypes, Sj TREC concentration, and CDR3 sequences, CD8alpha alpha and CD8alpha +beta low alpha beta T cells do not belong to different ontogenic lineages, but directly descend from CD8alpha +beta high alpha beta T cells.

In contrast to our data, numerous studies have suggested that CD8alpha alpha cells are extrathymically differentiated T cells.20-22,55 CD8alpha alpha T cells reside in intestinal mucosa, and they are proved to be thymus independent.56-58 In bone marrow transplantation (BMT), about one half of the CD8+ T cells constituted from T cell-depleted marrow were CD8alpha alpha cells in thymectomized recipient mice.20 As for human children, older patients at BMT exhibited more CD8alpha alpha T cells than younger ones, suggesting the influence of thymic function on the regenerative pathways.21 However, these findings do not indicate that all of the CD8alpha alpha alpha beta T cells are necessarily of extrathymic origin. At least peripheral CD8alpha alpha alpha beta T cells and CD8alpha alpha alpha beta T intraepithelial lymphocytes (IELs) should be considered distinctively. It is reported that TCRalpha beta CD8alpha alpha IELs have not previously expressed CD8beta using DNA methylation pattern analysis.59 Indeed, the results of IEL TCR Vbeta CDR3 analysis turned out to be opposite to those presented in this study; TCRalpha beta IELs bearing CD8alpha beta or CD8alpha alpha coreceptors shared no TCR BV clone.52,60

However, most recent studies by Leishman et al23 and Devine et al24 concerning the fate and function of these unique CD8+ T-cell subpopulations strongly indicate that they derive from the thymus and are positively selected. Moreover, CD8alpha alpha phenotype was shown to be acquired under the influence of the microenvironment of intraepithelial lymphoid tissue.25 Furthermore, they suggest that CD8alpha +beta low and CD8alpha alpha alpha beta T cells exhibit unique functional roles in vivo distinct from CD8alpha +beta high alpha beta T cells. Our findings are consistent with these data and confirm the notion that all 3 CD8+alpha beta T cells belong to the same cellular lineage and the level of CD8beta chain expression is secondarily regulated in vivo by antigenic stimulation and subsequent cell activation.

In conclusion, the present study demonstrates that the CD8alpha alpha and CD8alpha +beta low alpha beta T cells are effector memory or terminally differentiated CD45RO-CCR7- memory cells. Moreover, these cells share the same clone with the usual CD8alpha +beta high alpha beta T cells. We propose that at least in healthy individuals, circulating CD8alpha alpha and CD8alpha +beta low alpha beta T cells do emerge as a consequence of MHC-TCR interaction. Therefore, the persistence of these cells reflects the presence of continuous antigenic stimulations and subsequent accumulation of the antigen-specific clonally expanded T cells, which may be influenced by thymic output. Analysis of these cells may help us to understand the pathogenesis of autoimmunity and immunodeficiency, and it will provide a useful biomarker to evaluate the disease activities.


    Acknowledgments

We thank Ms Mika Kitakata, Ms Tamae Yonezawa, and Ms Harumi Matsukawa for excellent technical help.


    Footnotes

Submitted April 15, 2002; accepted July 8, 2002.

Prepublished online as Blood First Edition Paper, July 25, 2002; DOI 10.1182/blood-2002-04-1136.

Supported by a Grant-in-Aid for Scientific Research from the Ministry of Education, Science, and Culture of Japan; and a grant from the Ministry of Health, Labour, and Welfare of Japan, Tokyo.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: Akihiro Yachie, 13-1 Takara-machi, Kanazawa, 920-8641 Japan; e-mail: yachie{at}med.kanazawa-u.ac.jp.


    References
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

1. Gao GF, Tormo J, Gerth UC, et al. Crystal structure of the complex between human CD8alpha(alpha) and HLA-A2. Nature. 1997;387:630-634[CrossRef][Medline] [Order article via Infotrieve].

2. Zamoyska R. CD4 and CD8: modulators of T-cell receptor recognition of antigen and of immune responses? Curr Opin Immunol. 1998;10:82-87[CrossRef][Medline] [Order article via Infotrieve].

3. Norment AM, Salter RD, Parham P, Engelhard VH, Littman DR. Cell-cell adhesion mediated by CD8 and MHC class I molecules. Nature. 1988;336:79-81[CrossRef][Medline] [Order article via Infotrieve].

4. Salter RD, Benjamin RJ, Wesley PK, et al. A binding site for the T-cell co-receptor CD8 on the alpha 3 domain of HLA-A2. Nature. 1990;345:41-46[CrossRef][Medline] [Order article via Infotrieve].

5. Veillette A, Bookman MA, Horak EM, Bolen JB. The CD4 and CD8 T cell surface antigens are associated with the internal membrane tyrosine-protein kinase p56lck. Cell. 1988;55:301-308[CrossRef][Medline] [Order article via Infotrieve].

6. Barber EK, Dasgupta JD, Schlossman SF, Trevillyan JM, Rudd CE. The CD4 and CD8 antigens are coupled to a protein-tyrosine kinase (p56lck) that phosphorylates the CD3 complex. Proc Natl Acad Sci U S A. 1989;86:3277-3281[Abstract/Free Full Text].

7. Wange RL, Samelson LE. Complex complexes: signaling at the TCR. Immunity. 1996;5:197-205[CrossRef][Medline] [Order article via Infotrieve].

8. Baume DM, Caligiuri MA, Manley TJ, Daley JF, Ritz J. Differential expression of CD8 alpha and CD8 beta associated with MHC-restricted and non-MHC-restricted cytolytic effector cells. Cell Immunol. 1990;131:352-365[CrossRef][Medline] [Order article via Infotrieve].

9. Moebius U, Kober G, Griscelli AL, Hercend T, Meuer SC. Expression of different CD8 isoforms on distinct human lymphocyte subpopulations. Eur J Immunol. 1991;21:1793-1800[Medline] [Order article via Infotrieve].

10. Norment AM, Littman DR. A second subunit of CD8 is expressed in human T cells. EMBO J. 1988;7:3433-3439[Medline] [Order article via Infotrieve].

11. Terry LA, DiSanto JP, Small TN, Flomenberg N. Differential expression and regulation of the human CD8 alpha and CD8 beta chains. Tissue Antigens. 1990;35:82-91[Medline] [Order article via Infotrieve].

12. Nakayama K, Shinkai YI, Okumura K, Nakauchi H. Isolation and characterization of the mouse CD8 beta-chain (Ly-3) genes: absence of an intervening sequence between V- and J-like gene segments. J Immunol. 1989;142:2540-2546[Abstract].

13. Parnes JR. Molecular biology and function of CD4 and CD8. Adv Immunol. 1989;44:265-311[Medline] [Order article via Infotrieve].

14. Bosselut R, Kubo S, Guinter T, et al. Role of CD8beta domains in CD8 coreceptor function: importance for MHC I binding, signaling, and positive selection of CD8+ T cells in the thymus. Immunity. 2000;12:409-418[CrossRef][Medline] [Order article via Infotrieve].

15. Renard V, Romero P, Vivier E, Malissen B, Luescher IF. CD8 beta increases CD8 coreceptor function and participation in TCR-ligand binding. J Exp Med. 1996;184:2439-2444[Abstract/Free Full Text].

16. Wheeler CJ, Chen JY, Potter TA, Parnes JR. Mechanisms of CD8beta-mediated T cell response enhancement: interaction with MHC class I/beta2-microglobulin and functional coupling to TCR/CD3. J Immunol. 1998;160:4199-4207[Abstract/Free Full Text].

17. Irie HY, Mong MS, Itano A, et al. The cytoplasmic domain of CD8 beta regulates Lck kinase activation and CD8 T cell development. J Immunol. 1998;161:183-191[Abstract/Free Full Text].

18. Irie HY, Ravichandran KS, Burakoff SJ. CD8 beta chain influences CD8 alpha chain-associated Lck kinase activity. J Exp Med. 1995;181:1267-1273[Abstract/Free Full Text].

19. Kawabata K, Nagasawa M, Morio T, Okawa H, Yata J. Decreased alpha/beta heterodimer among CD8 molecules of peripheral blood T cells in Wiskott-Aldrich syndrome. Clin Immunol Immunopathol. 1996;81:129-135[CrossRef][Medline] [Order article via Infotrieve].

20. Dulude G, Brochu S, Fontaine P, et al. Thymic and extrathymic differentiation and expansion of T lymphocytes following bone marrow transplantation in irradiated recipients. Exp Hematol. 1997;25:992-1004[Medline] [Order article via Infotrieve].

21. Honda K, Takada H, Nagatoshi Y, et al. Thymus-independent expansion of T lymphocytes in children after allogeneic bone marrow transplantation. Bone Marrow Transplant. 2000;25:647-652[CrossRef][Medline] [Order article via Infotrieve].

22. Schmitz JE, Forman MA, Lifton MA, et al. Expression of the CD8alpha beta-heterodimer on CD8(+) T lymphocytes in peripheral blood lymphocytes of human immunodeficiency virus- and human immunodeficiency virus+ individuals. Blood. 1998;92:198-206[Abstract/Free Full Text].

23. Leishman AJ, Gapin L, Capone M, et al. Precursors of functional MHC class I- or class II-restricted CD8aa T cells are positively selected in the thymus by agonist self-peptides. Immunity. 2002;16:355-364[CrossRef][Medline] [Order article via Infotrieve].

24. Devine L, Rogozinski L, Naidenko OV, et al. The complementarity-determining region-like loops of CD8a interact differently with b2-microglobulin of the class I molecules H-2Kb and thymic leukemia antigen, while similarly with their a3 domains. J Immunol. 2002;168:3881-3886[Abstract/Free Full Text].

25. Imhof BA, Dunon D, Courtois D, et al. Intestinal CD8aa and CD8ab intraepithelial lymphocytes are thymus derived and exhibit subtle differences in TCRb repertoires. J Immunol. 2000;165:6716-6722[Abstract/Free Full Text].

26. Hazenberg MD, Otto SA, Cohen Stuart JW, et al. Increased cell division but not thymic dysfunction rapidly affects the T-cell receptor excision circle content of the naive T cell population in HIV-1 infection. Nat Med. 2000;6:1036-1042[CrossRef][Medline] [Order article via Infotrieve].

27. McFarland RD, Douek DC, Koup RA, Picker LJ. Identification of a human recent thymic emigrant phenotype. Proc Natl Acad Sci U S A. 2000;97:4215-4220[Abstract/Free Full Text].

28. Zeng W, Nakao S, Takamatsu H, et al. Characterization of T-cell repertoire of the bone marrow in immune-mediated aplastic anemia: evidence for the involvement of antigen-driven T-cell response in cyclosporine-dependent aplastic anemia. Blood. 1999;93:3008-3016[Abstract/Free Full Text].

29. Choi YW, Kotzin B, Herron L, Callahan J, Marrack P, Kappler J. Interaction of Staphylococcus aureus toxin "superantigens" with human T cells. Proc Natl Acad Sci U S A. 1989;86:8941-8945[Abstract/Free Full Text].

30. Labrecque N, McGrath H, Subramanyam M, Huber BT, Sekaly RP. Human T cells respond to mouse mammary tumor virus-encoded superantigen: V beta restriction and conserved evolutionary features. J Exp Med. 1993;177:1735-1743[Abstract/Free Full Text].

31. Bomberger C, Singh-Jairam M, Rodey G, et al. Lymphoid reconstitution after autologous PBSC transplantation with FACS-sorted CD34+ hematopoietic progenitors. Blood. 1998;91:2588-2600[Abstract/Free Full Text].

32. Clement LT. Isoforms of the CD45 common leukocyte antigen family: markers for human T-cell differentiation. J Clin Immunol. 1992;12:1-10[CrossRef][Medline] [Order article via Infotrieve].

33. Young JL, Ramage JM, Gaston JS, Beverley PC. In vitro responses of human CD45RObrightRA- and CD45RO-RAbright T cell subsets and their relationship to memory and naive T cells. Eur J Immunol. 1997;27:2383-2390[Medline] [Order article via Infotrieve].

34. Sempowski G, Thomasch J, Gooding M, et al. Effect of thymectomy on human peripheral blood T cell pools in myasthenia gravis. J Immunol. 2001;166:2808-2817[Abstract/Free Full Text].

35. Fagnoni FF, Vescovini R, Passeri G, et al. Shortage of circulating naive CD8(+) T cells provides new insights on immunodeficiency in aging. Blood. 2000;95:2860-2868[Abstract/Free Full Text].

36. Hamann D, Baars PA, Rep MH, et al. Phenotypic and functional separation of memory and effector human CD8+ T cells. J Exp Med. 1997;186:1407-1418[Abstract/Free Full Text].

37. Sallusto F, Lenig D, Forster R, Lipp M, Lanzavecchia A. Two subsets of memory T lymphocytes with distinct homing potentials and effector functions. Nature. 1999;401:708-712[CrossRef][Medline] [Order article via Infotrieve].

38. Richards SJ, Jones RA, Roberts BE, Patel D, Scott CS. Relationships between 2H4 (CD45RA) and UCHL1 (CD45RO) expression by normal blood CD4+CD8-, CD4-CD8+, CD4-CD8dim+, CD3+CD4-CD8- and CD3-CD4-CD8- lymphocytes. Clin Exp Immunol. 1990;81:149-155[Medline] [Order article via Infotrieve].

39. Champagne P, Ogg GS, King AS, et al. Skewed maturation of memory HIV-specific CD8 T lymphocytes. Nature. 2001;410:106-111[CrossRef][Medline] [Order article via Infotrieve].

40. Speiser DE, Colonna M, Ayyoub M, et al. The activatory receptor 2B4 is expressed in vivo by human CD8(+) effector alphabeta T cells. J Immunol. 2001;167:6165-6170[Abstract/Free Full Text].

41. de Jong R, Brouwer M, Miedema F, van Lier RA. Human CD8+ T lymphocytes can be divided into CD45RA+ and CD45RO+ cells with different requirements for activation and differentiation. J Immunol. 1991;146:2088-2094[Abstract].

42. Pannetier C, Cochet M, Darche S, Casrouge A, Zoller M, Kourilsky P. The sizes of the CDR3 hypervariable regions of the murine T-cell receptor beta chains vary as a function of the recombined germ-line segments. Proc Natl Acad Sci U S A. 1993;90:4319-4323[Abstract/Free Full Text].

43. Kou ZC, Puhr JS, Rojas M, McCormack WT, Goodenow MM, Sleasman JW. T-Cell receptor Vbeta repertoire CDR3 length diversity differs within CD45RA and CD45RO T-cell subsets in healthy and human immunodeficiency virus-infected children. Clin Diagn Lab Immunol. 2000;7:953-959[CrossRef][Medline] [Order article via Infotrieve].

44. Kong F, Chen CH, Cooper MD. Thymic function can be accurately monitored by the level of recent T cell emigrants in the circulation. Immunity. 1998;8:97-104[CrossRef][Medline] [Order article via Infotrieve].

45. Livak F, Schatz DG. T-cell receptor alpha locus V(D)J recombination by-products are abundant in thymocytes and mature T cells. Mol Cell Biol. 1996;16:609-618[Abstract/Free Full Text].

46. Breit TM, Verschuren MC, Wolvers-Tettero IL, Van Gastel-Mol EJ, Hahlen K, van Dongen JJ. Human T cell leukemias with continuous V(D)J recombinase activity for TCR-delta gene deletion. J Immunol. 1997;159:4341-4349[Abstract].

47. Wu CJ, Chillemi A, Alyea EP, et al. Reconstitution of T-cell receptor repertoire diversity following T-cell depleted allogeneic bone marrow transplantation is related to hematopoietic chimerism. Blood. 2000;95:352-359[Abstract/Free Full Text].

48. Degano M, Garcia KC, Apostolopoulos V, Rudolph MG, Teyton L, Wilson IA. A functional hot spot for antigen recognition in a superagonist TCR/MHC complex. Immunity. 2000;12:251-261[CrossRef][Medline] [Order article via Infotrieve].

49. Jorgensen JL, Esser U, Fazekas de St Groth B, Reay PA, Davis MM. Mapping T-cell receptor-peptide contacts by variant peptide immunization of single-chain transgenics. Nature. 1992;355:224-230[CrossRef][Medline] [Order article via Infotrieve].

50. Pannetier C, Even J, Kourilsky P. T-cell repertoire diversity and clonal expansions in normal and clinical samples. Immunol Today. 1995;16:176-181[CrossRef][Medline] [Order article via Infotrieve].

51. Gorski J, Yassai M, Zhu X, et al. Circulating T cell repertoire complexity in normal individuals and bone marrow recipients analyzed by CDR3 size spectratyping: correlation with immune status. J Immunol. 1994;152:5109-5119[Abstract].

52. Arstila T, Arstila TP, Calbo S, et al. Identical T cell clones are located within the mouse gut epithelium and lamina propria and circulate in the thoracic duct lymph. J Exp Med. 2000;191:823-834[Abstract/Free Full Text].

53. Mugnaini EN, Egeland T, Spurkland A, Brinchmann JE. The T cell receptor repertoire of CD8+CD28- T lymphocytes is dominated by expanded clones that persist over time. Clin Exp Immunol. 1999;117:298-303[CrossRef][Medline] [Order article via Infotrieve].

54. Horiuchi T, Hirokawa M, Kawabata Y, et al. Identification of the T cell clones expanding within both CD8(+)CD28(+) and CD8(+)CD28(-) T cell subsets in recipients of allogeneic hematopoietic cell grafts and its implication in post-transplant skewing of T cell receptor repertoire. Bone Marrow Transplant. 2001;27:731-739[CrossRef][Medline] [Order article via Infotrieve].

55. Leclercq G, Plum J. Thymic and extrathymic T cell development. Leukemia. 1996;10:1853-1859[Medline] [Order article via Infotrieve].

56. Fung-Leung WP, Kundig TM, Ngo K, et al. Reduced thymic maturation but normal effector function of CD8+ T cells in CD8 beta gene-targeted mice. J Exp Med. 1994;180:959-967[Abstract/Free Full Text].

57. Nakayama K, Negishi I, Kuida K, et al. Requirement for CD8 beta chain in positive selection of CD8-lineage T cells. Science. 1994;263:1131-1133[Abstract/Free Full Text].

58. Rocha B, Vassalli P, Guy-Grand D. Thymic and extrathymic origins of gut intraepithelial lymphocyte populations in mice. J Exp Med. 1994;180:681-686[Abstract/Free Full Text].

59. Hamerman JA, Page ST, Pullen AM. Distinct methylation states of the CD8 beta gene in peripheral T cells and intraepithelial lymphocytes. J Immunol. 1997;159:1240-1246[Abstract].

60. Regnault A, Cumano A, Vassalli P, Guy-Grand D, Kourilsky P. Oligoclonal repertoire of the CD8 alpha alpha and the CD8 alpha beta TCR-alpha/beta murine intestinal intraepithelial T lymphocytes: evidence for the random emergence of T cells. J Exp Med. 1994;180:1345-1358[Abstract/Free Full Text].

© 2002 by The American Society of Hematology.
 

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Infect. Immun.Home page
A. Berndt, J. Pieper, and U. Methner
Circulating {gamma}{delta} T Cells in Response to Salmonella enterica Serovar Enteritidis Exposure in Chickens
Infect. Immun., July 1, 2006; 74(7): 3967 - 3978.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H.-R. Kim, M. S. Hong, J. M. Dan, and I. Kang
Altered IL-7R{alpha} expression with aging and the potential implications of IL-7 therapy on CD8+ T-cell immune responses
Blood, April 1, 2006; 107(7): 2855 - 2862.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Takahashi, S. Dejbakhsh-Jones, and S. Strober
Expression of CD161 (NKR-P1A) Defines Subsets of Human CD4 and CD8 T Cells with Different Functional Activities
J. Immunol., January 1, 2006; 176(1): 211 - 216.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. Wada, S. H. Schurman, E. K. Garabedian, A. Yachie, and F. Candotti
Analysis of T-cell repertoire diversity in Wiskott-Aldrich syndrome
Blood, December 1, 2005; 106(12): 3895 - 3897.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. Wada, T. Toma, H. Okamoto, Y. Kasahara, S. Koizumi, K. Agematsu, H. Kimura, A. Shimada, Y. Hayashi, M. Kato, et al.
Oligoclonal expansion of T lymphocytes with multiple second-site mutations leads to Omenn syndrome in a patient with RAG1-deficient severe combined immunodeficiency
Blood, September 15, 2005; 106(6): 2099 - 2101.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Attinger, L. Devine, Y. Wang-Zhu, D. Martin, J.-h. Wang, E. L. Reinherz, M. Kronenberg, H. Cheroutre, and P. Kavathas
Molecular Basis for the High Affinity Interaction between the Thymic Leukemia Antigen and the CD8{alpha}{alpha} Molecule
J. Immunol., March 15, 2005; 174(6): 3501 - 3507.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
Y. Nishimura, M. Shimojima, E. Sato, Y. Izumiya, Y. Tohya, T. Mikami, and T. Miyazawa
Downmodulation of CD3{varepsilon} expression in CD8{alpha}+{beta}- T cells of feline immunodeficiency virus-infected cats
J. Gen. Virol., September 1, 2004; 85(9): 2585 - 2589.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
L. T. Madakamutil, U. Christen, C. J. Lena, Y. Wang-Zhu, A. Attinger, M. Sundarrajan, W. Ellmeier, M. G. von Herrath, P. Jensen, D. R. Littman, et al.
CD8{alpha}{alpha}-Mediated Survival and Differentiation of CD8 Memory T Cell Precursors
Science, April 23, 2004; 304(5670): 590 - 593.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2002-04-1136v1
100/12/4090    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Konno, A.
Right arrow Articles by Koizumi, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Konno, A.
Right arrow Articles by Koizumi, S.
Related Collections
Right arrow Immunobiology
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2002 by American Society of Hematology         Online ISSN: 1528-0020