|
|
Prepublished online as a Blood First Edition Paper on August 1, 2002; DOI 10.1182/blood-2001-12-0365.
 Previous Article | Table of Contents | Next Article 
Blood, 1 December 2002, Vol. 100, No. 12, pp. 4209-4216
RED CELLS
Development of sensitive fluorescent assays for embryonic and
fetal hemoglobin inducers using the human  -globin locus in
erythropoietic cells
Jim Vadolas,
Hady Wardan,
Michael Orford,
Lucille Voullaire,
Faten Zaibak,
Robert Williamson, and
Panayiotis A. Ioannou
From the Cell and Gene Therapy Research Group, The
Murdoch Children's Research Institute, Royal Children's Hospital,
Melbourne, Australia; and the Cyprus Institute of
Neurology and Genetics, Nicosia, Cyprus.
 |
Abstract |
Reactivation of fetal hemoglobin genes has been proposed as a
potential therapeutic procedure in patients with  -thalassemia, sickle cell disease, or other -hemoglobinopathies. In vitro model systems based on small plasmid globin gene constructs have previously been used in human and mouse erythroleukemic cell lines to study the
molecular mechanisms regulating the expression of the fetal human
globin genes and their reactivation by a variety of pharmacologic agents. These studies have led to great insights in globin gene regulation and the identification of a number of potential inducers of
fetal hemoglobin. In this study we describe the development of enhanced
green fluorescence protein (EGFP) reporter systems based on bacterial
artificial chromosomes (EBACs) to monitor the activity of the
 -, G -, A-,  -, and -globin genes
in the -globin locus. Additionally, we demonstrate that transfection
of erythroleukemia cells with our EBACs is greatly enhanced by
expression of EBNA1, which also facilitates episomal maintenance of our
constructs in human cells. Our studies in human cells have shown
physiologically relevant differences in the expression of each of the
globin genes and also demonstrate that hemin is a potent inducer of
EGFP expression from EGFP-modified -, G-, and
A-globin constructs. In contrast, the EGFP-modified -
and -globin constructs consistently produced much lower levels of
EGFP expression on hemin induction, mirroring the in vivo ontogeny. The
EGFP-modified -globin eukaryotic BAC (EBAC) vector system can
thus be used in erythroleukemia cells to evaluate induction of the
- and -globin genes from the intact human -globin locus.
(Blood. 2002;100:4209-4216)
© 2002 by The American Society of Hematology.
| |
Introduction |
-Thalassemia and sickle cell disease are among
the most common inherited genetic disorders in the world. In
-thalassemia, unpaired  -globin chains accumulate and precipitate
within erythroid cells, resulting in red cell damage, hemolysis,
ineffective erythropoiesis, and anemia. In sickle cell disease,
intracellular accumulation of polymerized hemoglobin causes sickling of
red blood cells and vascular occlusion. Amelioration of clinical
symptoms associated with these hemoglobinopathies has been reported in
patients with elevated levels of -globin chain synthesis. In
-thalassemia, the presence of -globin inhibits the precipitation
of unpaired -globin through the formation of fetal hemoglobin (HbF,
22,), whereas in sickle cell disease the
presence of -globin inhibits the polymerization of sickle hemoglobin
(2 ) via the formation of mixed
hemoglobin tetramers (2s) and the
maintenance of a higher oxygen tension in the
capillaries.1
A diverse group of genetic mutations termed hereditary persistence of
fetal hemoglobin (HPFH) are associated with high levels of HbF in adult
life. Coexistence of HPFH with homozygous -thalassemia or sickle
cell disease often results in complete phenotypic complementation of
the disease.2 Many of the HPFH mutations are the result of
deletions or point mutations in the -globin locus.3
However, a small number of HPFH cases have been identified that are not linked to the -globin locus, implicating the presence of
trans-acting factor(s).4-6 Other genetic conditions that
contribute to elevated levels of HbF include metabolic disorders such
as propionic acidemia7 and -ketothiolase
deficiency,8 implicating short chain fatty acids in the
induction of HbF. In addition, many acquired conditions have also been
reported to reactivate HbF, including pregnancy and starvation
ketosis.9 Pharmacologic reactivation of HbF has therefore
been proposed as a potential therapeutic strategy for the treatment of
hemoglobinopathies (for review see Olivieri and
Weatherall10). Drugs such as 5-azacytidine
(5-AzaC),11 hydroxyurea (HU),12 and butyrate
analogues13,14 have been shown to increase HbF synthesis
in patients. However, many of these drugs have low efficacy and
specificity, while some are potentially carcinogenic. There is
therefore an urgent need to identify new types of pharmacologic agents
that can induce HbF with greater efficacy and less
toxicity.15-18
A number of published studies have focused on the development of
sensitive assays for HbF inducers using various reporters in small
plasmid constructs, in combination with some of the regulatory elements
from the -globin locus. While some of these assays have yielded
interesting results,19-21 it is questionable whether the use of globin regulatory elements out of their natural context can
recapitulate the requirements for therapeutic HbF reactivation in the
erythropoietic compartment.
The usefulness of an assay system for HbF reactivation is critically
dependent on the choice of cell line to be used. The human
erythroleukemia K562 cell line has been shown to undergo erythroid
differentiation and -globin gene expression after treatment with a
variety of chemical compounds.10-18 Importantly, many of these compounds have also been reported to stimulate HbF production in
human erythroid precursor cells from healthy subjects and in human
patients. Murine erythroleukemia cells (MEL) with an adult type of
hemoglobin expression have also been used extensively in globin gene
expression studies. Studies on mice transgenic for the human -globin
locus indicate that the pattern of developmental regulation is
generally well retained, although the - to -globin switch appears
to operate earlier in mice than in humans.22-26 Furthermore, the mouse transcriptional machinery does not appear to
transcribe the human -globin locus as efficiently as the mouse locus, presumably as a result of variations in the regulatory sequences
and the amino acid sequences of the various factors needed for
transcription. It has also been reported that the direct transfer of a
-globin yeast artificial chromosome (YAC) into MEL cells
resulted in loss of position-independent expression of the globin
genes,27 suggesting that the human locus control region
(LCR) may not function properly when the locus is directly transferred into a murine erythroid cell.
In this study, we have developed novel assay systems for the assessment
of globin gene expression using a bacterial artificial chromosome (BAC)
containing the intact human -globin locus. One of the main
advantages of BACs is that they carry genomic fragments in the 100 kb
to 300 kb range, which are large enough to contain most genes intact
together with their long-range regulatory elements that are essential
for regulated gene expression in a tissue-specific manner.28,29 The development of genetic modification
techniques for BACs, such as recE/recT-based homologous
recombination,30-32 and site-specific
mutagenesis,33 has also largely overcome the technical
limitations in manipulating large genomic BAC clones. Recently, the
development of eukaryotic-BAC vectors (EBACs) has further simplified
functional gene expression studies in eukaryotic cells.30,34 EBACs contain the bacterial elements of BACs
and a number of other eukaryotic elements to facilitate
extrachromosomal replication, episomal maintenance, and functional
studies in eukaryotic cells. Such elements include the Epstein-Barr
virus (EBV) nuclear antigen-1 (EBNA1),35 the latent origin
of EBV replication (oriP), and positive and negative selectable
markers.36 These vectors can readily be "shuttled"
between bacterial and human cells, thus allowing for the rapid
modification of genomic fragments in bacteria and their functional
analysis in eukaryotic cells.
We report here the development of enhanced green fluorescence protein
(EGFP) reporter systems to monitor the activity of the -,
G-, A-, -, and -globin genes in the
human erythroleukemic K562 cell line, in the context of the human
-globin locus, cloned in an EBAC vector. The EGFP insertions were
designed to replace each of the -, G-,
A-, -, and -globin coding regions with the EGFP
gene, such that EGFP expression is driven by the upstream regulatory
elements. In this context, expression of the EGFP reporter construct
should reflect globin chain synthesis, and may therefore be used to
evaluate globin gene expression in human erythroid cells. We
demonstrate physiologically relevant expression of EGFP from each
globin promoter in response to hemin-induced erythroid differentiation.
Our results show that the EGFP-modified -globin locus EBAC reporter
system represents a novel assay system, which may be used to detect and evaluate potentially therapeutic compounds that can alter globin chain
synthesis, thus enabling a rational approach to drug design and
evaluation of globin gene inducers.
| |
Materials and methods |
Construction of EBAC vectors
The P1-derived artificial chromosome (PAC) clone (148O22) was
identified from the RPCI I PAC library to contain the -globin locus
in a 185-kb genomic fragment
(http://www.chori.org/bacpac/).29 Further detailed mapping
revealed that the 73-kb sequence of the -globin locus (accession no.
U10317) is flanked by 92 kb of sequence at the 5' end and 20 kb of
sequence at the 3' end. The 185-kb genomic fragment was retrofitted
into the pEBAC140 cloning vector as a single NotI fragment
to generate pEBAC/148 (Figure 1, also
referred to as pBH14834). The pEBAC140 vector is a hybrid system based on the bacterial F1 origin of replication of BACs
and the EBNA1/oriP elements of EBV-based vectors. The pEBAC160G vector was generated from pEBAC140 by the insertion of a
modified pUC19 sequence into the multicloning site, and by the blunt
end cloning of an AflIII-AflII fragment from
pEGFP-N22 (see next paragraph) into the unique
Bst1107I site (Figure 1). Last, the 185-kb globin genomic
fragment was retrofitted into the pEBAC160G vector to produce
pEBAC/148G, a 205-kb clone in which EGFP expression from the
backbone of the vector may be used to monitor transfection efficiency
of large BACs.
View larger version (29K):
[in this window]
[in a new window]
| Figure 1.
Schematic representation of the EGFP-modified -globin
EBACs used in this study.
(A) An EGFP-Neo/Kan expression cassette starting with the first codon
of the EGFP gene and finishing with the last codon of the Neo/Kan gene
was inserted by GET Recombination between the start codon of
either the -, -, A-, G-, or
-globin genes and the termination codon of the -globin gene, in
the 185-kb genomic insert of pEBAC/148 which contains the intact
-globin locus. This created a series of deletions ranging in size
from 1.4 kb to 44 kb, while placing the EGFP gene under the regulatory
elements of the corresponding gene in the context of the -globin
locus. In the G-A-EGFP construct, the
EGFP-expression cassette was inserted between the start codon of the
G- and the stop codon of the A-globin
gene, with the deletion of all intervening genomic sequences. The
approximate size of the resulting genomic insert in each construct is
indicated. The genomic insert in each construct was maintained as a
single NotI fragment in the rare multicloning site of the
pEBAC vector. (B) The complete pEBAC160G cloning vector containing a
modified pUC19 in the multicloning site and the EGFP reporter gene
driven by the cytomegalovirus early promoter on the backbone of
the vector.
|
|
The construction of the EGFP-modified pEBAC/148 clones has
previously been described.37 In brief, pEGFP-N2 vector
(Clontech, Palo Alto, CA) was modified by removing the multicloning
site located at the 5' end of the EGFP gene using BglII and
BamHI double digest, and by blunting the NotI
site located downstream of the EGFP gene, resulting in the pEGFP-N22
vector. The pEGFP-N22 vector was then used as a template to amplify by
polymerase chain reaction (PCR) the 2.7-kb EGFP-Neo/Kan cassette. The
EGFP-Neo/Kan PCR product, designed to be flanked by 50 nucleotides of
pEBAC/148 homology, was introduced into the pEBAC/148 via
homologous recombination using the pGETrec plasmid. The plasmid pGETrec
is a 6.5-kb plasmid that contains the Escherichia coli recE
and recT genes and bacteriophage  gam gene in
a polycistronic operon.30 The 5' end of the EGFP-Neo/Kan expression cassette was placed in frame at the start codon of either
the -, G-, A-, -, or -globin
genes, while the 3' end of the EGFP-Neo/Kan expression cassette
was inserted at the 3' end of the -globin gene, resulting in a
series of deletions ranging from 1.4 kb to 44 kb (Figure 1).
The G-A-EGFP construct was similarly
created by targeting the EGFP-Neo/Kan cassette between the start codon
of the G gene and the termination codon of the
A gene. The EGFP-Neo/Kan cassette was amplified with
primers EGFP-F, 5'-CTCGCTTCTGGAACGTCTGAGATTATCAATAAGCTCCTAGTCCAGACGCCATGGTGAGCAAGGGCGAGGAGC-3' and NEO-R, 5'-CTTGCAGAATAA
AGCCTATCCTTGAAAGCTCTGAATCATGGGCAAGAGGCCCAGAGTCCCGCTCAGAAG-3'. Due to
the high homology between the 2 -globin genes, these primers can
target to the start and end of each -globin gene, thus yielding recombinants with replacement of either of the 2 -globin genes with
the EGFP-Neo/Kan cassette, or with the simultaneous replacement of both
-globin genes by the cassette. The
G-A-EGFP construct was distinguished
from the G-EGFP and A-EGFP constructs
using the screening primers F, 5'-CCTCACTGGAGCTACAG ACAAGA-3',
GR, 5'-GCACATGACACAAACACACATAG-3' and AR,
5'-ACTTGCAGAACTCCCGTGTA-3'.
Preparation of EBAC vectors
The EBAC vectors were propagated in the E coli strain
DH10B (Invitrogen, Carlsbad, CA). Bacterial cultures were routinely grown in Luria broth (LB) liquid culture, or on LB agar plates (15 g/L)
containing the following antibiotics 12.5 µg/mL chloramphenicol (Cm)
or 25 µg/mL kanamycin (Km). Large-scale preparation of EBAC constructs for transfection studies was performed using CsCl-ethidium bromide density gradient centrifugation.
Construction of K562-EBNA1 cell lines
Stable K562 cell lines that constitutively express EBNA1 were
generated by transfection with the pEB vector (kindly provided by Dr
Burt, Division of Molecular Biology, Roslin Institute, Edinburgh, Scotland, United Kingdom).38 The pEB vector contains a
picornaviral internal ribosome entry site that allows the EBNA1 gene
and neomycin resistance gene to be transcribed as a dicistronic mRNA
under the control of the phosphoglucokinase (PGK) promoter. The pEB vector (10 µg) was linearized with MluI restriction
endonuclease and transfected into K562 cells (2 × 106)
by lipofection using DMRIE-C (Invitrogen), at a 4:1
lipid-to-DNA ratio, according to the manufacturer's recommended
protocol. Cells were seeded 2 days following transfection in 96-well
flat-bottom plates and selected in Dulbecco modified Eagle medium
(Sigma, Castle Hill, NSW, Australia) supplemented with G418 (400 µg/mL). G418-resistant colonies were isolated via limiting cell
dilution. The presence of the EBNA1 gene was confirmed by
EBNA1-specific PCR38 and the relative levels of EBNA1
protein expression were measured by flow cytometry using an
EBNA1-specific monoclonal antibody (Mab) 1H439 (kindly
provided by Dr Grasser, Institut fur Medizinische Mikrobiologie und
Hygiene, Abteilung Virologie, Universitatskliniken, Homburg/Saar,
Germany). Individual clones were evaluated for their transfectability
with the pEBAC160G vector and the pEBAC/148/EGFP construct. A single
clone (denoted clone 8.13) with moderate levels of EBNA1 expression and
high transfectability was selected for subsequent studies.
Cell cultures
The human erythroleukemia cell line K562 and the K562-EBNA1
derivatives were maintained in continuous culture in Dulbecco modified
Eagle medium (Sigma) supplemented with 10% fetal calf serum (FCS) for
K562 cells and K562-EBNA1 cells, 100 U/mL penicillin, and 100 µg/mL
streptomycin. K562-EBNA1 cells transfected with EBACs were grown in
media containing 20% FCS, 100 U/mL penicillin, 100 µg/mL
streptomycin, and 400 µg/mL hygromycin and supplemented with an
antioxidant mix (1 mM sodium pyruvate, 50 µM -thioglycerol, and 20 nm bathocuprionedisulfonate).40 The cell density was maintained between 1 × 105 cells/mL and
8 × 105 cells/mL and cultures were incubated at 37°C
in a humidified 5% CO2 incubator.
Transfection of EBAC vectors into K562 and K562-EBNA1
cells
Transient transfection of K562 and K562-EBNA1 cells with
pEBAC160G was carried out for 5 hours using DMRIE-C (Invitrogen) at a
4:1 lipid-to-DNA ratio, according to the manufacturer's recommended procedure optimized in the absence of phorbol myristate acetate (PMA),
since PMA is used to enhance the differentiation of K562 cells toward
the megakaryocytic lineage.41,42 Transfection of
pEBAC/148 EGFP-modified -globin constructs was similarly carried
out at a 2:1 lipid-to-DNA ratio. For the establishment of episomal
cultures, hygromycin was added after 48 hours (400 µg/mL) and
maintained throughout the growth of the cultures.
Green fluorescent protein expression analysis
The percentage of EGFP-positive cells and relative levels of
EGFP expression were measured by flow cytometry using a FACScan flow
cytometer (Becton Dickinson, Los Angeles, CA). K562 or K562-EBNA1 cells
(2 × 106) transfected with EGFP-modified EBAC constructs
were assayed 2 days following transfection and grown for 40 days in
media containing hygromycin (400 µg/mL) before further analysis. Data
acquisition and analysis were performed using WinMDI software
(http://pingu.salk.edu /software.html). Propidium iodide (0.25 µg/mL)
was added to transfected cells to exclude dead cells from analysis.
Hemin induction
Hemin (Sigma) (5 mM stock solution) was prepared as previously
described.43 K562-EBNA1 cells transfected with EBAC
vectors were cultured in media containing hygromycin (400 µg/mL) for
40 days prior to hemin induction. Transfected cells
(3 × 105) were induced with 0 µM to 100 µM of hemin
in the absence of hygromycin, and analyzed by flow cytometry on days 3 and 5. The effects of hemin on each globin promoter were examined by
measuring the percentage of EGFP-expressing cells and median peak
fluorescence (MPF).
Fluorescence in situ hybridization
Cell cultures grown under hygromycin selection for 40 days were
treated with colcemid for 4 to 12 hours before harvesting. Chromosome
preparations were obtained using standard techniques. Cells were spread
onto slides and subsequently denatured by immersion in 70% formamide
in 2x sodium chloride/sodium citrate (SSC) at 70°C for 3 minutes.
EBAC vector and genomic globin DNA were labeled with digoxigenin and
biotin, respectively, using nick translation according to the
manufacturer's recommended method (Roche, Indianapolis, IN). The
labeled DNA was alcohol precipitated together with COT-1 DNA (30 µg)
and resuspended in 50% formamide, 10% dextran sulfate, and 2x SSC to
give a concentration for each labeled DNA of 40 ng DNA/µL. The probe
was denatured by heating to 75°C for 8 minutes, followed by
preannealing at 37°C for 20 minutes. Hybridization was at 37°C for
16 hours followed by washing in 1x SSC at 70°C for 5 minutes. The
digoxigenin-labeled vector DNA was detected with antidigoxigenin
conjugated to rhodamine (Roche) and the biotin-labeled insert DNA was
detected with avidin conjugated to fluorescein (Vector Laboratories,
Burlingham, CA). The slides were mounted in Vectashield (Vector
Laboratories) containing 4',6-diamidino-2-phenylindole (DAPI)
counterstain. The cells were examined and analyzed using a Zeiss
(Göttingen, Germany) epifluorescence microscope with appropriate
filters, and images were captured using Cytovision imaging equipment
and software (Applied Imaging, Santa Clara, CA). We analyzed 10 metaphases and 20 interphases for individual and colocalized signals.
| |
Results |
Construction and characterization of K562 cells stably
expressing EBNA1
Transient transfection studies in K562 cells showed that
approximately 4% of the K562 cells expressed EGFP with the 21-kb pEBAC160G vector, while transfection studies with pEBAC/148G yielded
much lower levels of EGFP-positive cells ( 0.1%). In contrast,
transfection studies of K562 cells with fluorescently labeled DNA
showed cytoplasmic uptake in most of the cells (data not shown). Thus,
while DNA appeared to enter the cells readily under our transfection
conditions, only a very small percentage of cells appeared able to take
the DNA into the nucleus and show detectable levels of EGFP expression
by flow cytometry.
Several studies have previously reported that human cells either
transformed with human EBV or stably expressing EBNA1 support extrachromosomal replication and episomal maintenance of
oriP-containing plasmids.35,36 To assist in our study,
K562 cell lines stably expressing EBNA1 were therefore generated by
transfecting an EBNA1/Neo expression cassette.38 A
quantity of 30 G418 resistant clones were isolated via limiting cell
dilution. All clones tested positive for the presence of the EBNA1 gene
and showed EBNA1 protein expression by flow cytometry (data not shown).
Although our studies showed an absolute dependence on EBNA1 expression
for an increase in transfection efficiency with pEBAC160G, there was no
clear correlation between the efficiency of transfection and the level
of EBNA1 expression among different K562-EBNA1 clones (data not shown). A sharp reduction in transfection efficiency with clone size was also
observed in K562 cells, which was significantly relieved by expression
of EBNA1 in K562-EBNA1 cells. A single K562-EBNA1 clone (clone 8.13)
with moderate levels of EBNA1 expression and high transfectability
(Figure 2) was selected for subsequent
studies.
View larger version (44K):
[in this window]
[in a new window]
| Figure 2.
Analysis of EGFP expression by transiently transfected
K562-EBNA1 cells.
(A) Dot plot analysis of K562-EBNA1 cells transiently transfected with
EGFP-modified globin EBACs and the pEBAC160G vector, as indicated. Flow
cytometric analysis was carried out 2 days following transfection. The
total number of EGFP-positive cells was expressed as a percentage of
the total number of viable cells. (B) Comparison of K562 and K562-EBNA1
cells after transient transfection with EGFP-modified -globin EBACs
and the pEBAC160G vector as in panel A. The data represent the
means ± SD of 3 independent experiments.
|
|
Transient transfection studies with EGFP-modified globin EBACs in
erythroid cells
The percentage of EGFP-positive cells was determined 48 hours
following transfection (Figure 2A). We found the transfection efficiency of clone 8.13 cells with the pEBAC160G vector to be significantly higher (35% ± 4%) when compared with normal K562 cells (4% ± 2%, P < .05). The transfection
efficiency of all EGFP-modified -globin EBACs was also significantly
higher in K562-EBNA1 cells when compared with the transfection
efficiency of K562 cells (Figure 2B). It was noted that the expression
levels of EGFP differed according to the specific globin promoter
driving EGFP expression, with the intensity of EGFP expression varying
over 2 orders of magnitude between the different constructs (Figure
2A). The - and --EGFP EBAC constructs produced not only the
lowest levels of transfection but also the lowest level of EGFP
expression, whereas the G-, A-, and
-EGFP -globin EBACs resulted in the highest levels of transfection and EGFP expression, which is in line with the embryonic phenotype of globin gene expression of K562
cells.44,45
We have previously demonstrated that transient transfection of MEL
cells with pEBAC/148-EGFP enabled the identification of clones
expressing EGFP under the regulatory elements of the -globin gene.44 However, the efficiency of transfection was very
low, making it difficult to perform functional studies. In this study, we have generated stable clones of MEL cells expressing EBNA-1 (MEL-EBNA1) and demonstrated a similar increase in transfection efficiency with our EBAC constructs, as with K562-EBNA1 cells (data not
shown). Stable expression of EBNA1 protein in K562 and MEL cells
therefore facilitates increased transfection efficiency with EBAC DNA,
enabling for the first time functional studies with globin BACs in both
cell types. We also found that EBACs could be maintained episomally for
at least 3 months in the K562-EBNA1 cell lines under hygromycin
selection, while the episomes were lost quickly in MEL-EBNA1 cell lines
(data not shown), presumably due to less specific interaction between
mouse chromatin and the EBNA1 protein.
Episomal maintenance and expression of EGFP-modified
-globin EBACs
The K562-EBNA1 cell line (clone no. 8.13) was transfected with the
-, G-, A-,
G-A-, -, or -EGFP globin EBACs
(Figure 1) and grown for 40 days in continuous culture under hygromycin
(400 µg/mL) selection. A gradual increase in the percentage of EGFP
expressing cells was observed under antibiotic selection in all
cultures, reaching 40% to 60% of the cells transfected with the
--, G--, and A--EGFP globin
EBACs (Figure 3A). In contrast, the -
and --EGFP globin EBACs showed only a small rise in the
proportion of EGFP-expressing cells during hygromycin selection. On the
other hand, removal of antibiotic selection from the growth media
resulted in a gradual reduction in the proportion of EGFP-expressing
cells (data not shown), indicating an episomal pattern of maintenance
of the -globin locus EGFP constructs. This was further demonstrated
by fluorescence in situ hybridization (FISH) analysis of interphase
(Figure 3B) and metaphase spreads (Figure 3C) of K562-EBNA1 cells
episomally transfected with the G--EGFP construct,
and simultaneously probing for the vector (red) and globin locus
sequences (green). Most cells contained 3 green signals, corresponding
to the 3 copies of chromosome 11 that are known to exist in K562
cells.46 Additionally, both interphase and metaphase cells
were found to contain 5 ± 3 colocalized signals for red and green.
The signals in metaphase cells appeared tethered to single chromatids,
as has been previously observed for the unmodified pEBAC/148
clone.34 EBNA1 has been shown to tether oriP-containing
vectors to condensed chromosomes during mitosis, thereby facilitating
segregation of EBV-based vectors.47
View larger version (64K):
[in this window]
[in a new window]
| Figure 3.
Fluorescent microscopy of K562-EBNA1 cells episomally
transfected with the EGFP-modified globin EBACs.
Pools of transfected K562-ENBA-1 cells were cultured for 40 days in the
presence of hygromycin before examination. (A) Direct examination of
EGFP expression after transfection with 4 different EGFP constructs, as
indicated. Original magnification × 200. (B-C) Fluorescent in
situ hybridization analysis of K562-EBNA1 cells episomally transfected
with the G--EGFP globin EBAC. Cell spreads were
probed with the -globin EBAC (green) and pEBAC160 vector (red). DNA
was counterstained with DAPI. Most cells contained 3 single green
signals (white arrows), which correspond to the 3 copies of chromosome
11. Typical interphases (B) and metaphases (C) were found to contain
5 ± 3 colocalized signals for red and green (yellow arrows), that
were intimately associated with single chromatids in metaphases.
Original magnification B-C, × 400.
|
|
The activity of each globin promoter in episomal format was assessed by
measuring the level of EGFP expression by flow cytometry (Figure
4A, no hemin induction). As with
transient transfection (Figure 2A), the - and --EGFP EBACs
showed the lowest percentage of EGFP-expressing cells and the lowest
MPF values. In contrast, the --, G--,
A--, and G-A-EGFP
globin EBACs all showed a much higher proportion of EGFP-expressing cells, as well as 5- to 10-fold higher MPF values.
View larger version (49K):
[in this window]
[in a new window]
| Figure 4.
Hemin induction of K562-EBNA1 cells episomally
transfected with EBACs carrying EGFP modifications in the -globin
locus.
Pools of transfected cells were grown continuously in the presence of
hygromycin for 40 days before flow cytometry (shaded, no hemin
induction). Transfected cells were induced for 5 days with hemin. (A)
Comparison of EGFP expression without (shaded) and with hemin (100µM)
induction (unshaded) in the various EGFP constructs, as indicated. The
percent of cells expressing EGFP and the median peak fluorescence (MPF)
without and with hemin is shown for each construct. (B) The effect of
hemin induction on EGFP gene expression was determined by measuring MPF
on day 3 (filled symbols) and day 5 (empty symbols) at different hemin
doses, for the same constructs as in panel A. The data represent the
means ± SD of 3 independent experiments.
|
|
Hemin induction of K562-EBNA1 cells carrying episomally maintained
EGFP-modified -globin EBACs
Under normal growth conditions K562 cells appear to express mainly
the -globin gene, small amounts of the -globin gene, and very
little if any of the -globin gene. Hemin can induce K562 cells to
undergo erythroid differentiation, which is associated with a sharp
increase in embryonic and fetal globin gene
expression.44,45,48 We therefore investigated whether
hemin could enhance EGFP expression from the EGFP-modified -globin
EBAC constructs. K562-EBNA1 cells transfected with the EGFP-modified
globin EBACs and cultured for 40 days were treated with various doses
of hemin (0-100 µM) for up to 5 days. To minimize the effect of
clonal differences in the measurement of gene expression, pools of
hygromycin-resistant cells were used throughout this study.
While there was little if any increase in the fraction of cells
expressing EGFP for each of the constructs during the period of hemin
induction, a significant dose-dependent shift in MPF was observed for
all constructs (Figure 4). Moreover, a continuing increase in EGFP
expression between day 3 and day 5 of induction was obvious for the
--, G--, and
G-A-EGFP constructs (Figure 4B).
Interestingly, although the A- construct also showed
a dose-dependent response to hemin, it seemed to reach a maximal
response within 3 days. This may relate to the fact that the
A- construct showed a high level of EGFP expression
prior to induction (Figure 4A). The largest increase in the level of
EGFP expression was seen with the --EGFP globin EBAC, resulting
in a 14.1-fold increase in MPF when induced with hemin at 100 µM for
5 days (day 0 MPF = 115, and day 5 MPF = 1620) (Figure 4A-B). Somewhat lower MPF values were obtained for the G--,
A--, and G-A-EGFP
globin EBACs (MPF = 1260, 980, and 741, respectively, following hemin
induction), while the - and --EGFP globin EBACs showed much
lower MPF values (MPF = 50 and 42, respectively), with only a
marginal increase after hemin induction. Thus, our findings are
quantitatively and qualitatively in general accordance with the sharp
increase in the expression of the - and -globin genes that occurs
in K562 cells after induction with hemin.44,45,48 However,
the expression of EGFP under each globin promoter in the different
constructs may be influenced by the deletion of downstream regulatory
elements during the creation of these constructs. This was directly
examined by comparing the expression from the G-- and
G-A-EGFP EBAC constructs (Figure 1). In
both of these constructs EGFP expression is driven by the
G promoter, but the G--EGFP construct
has a larger downstream deletion than the
G-A- EGFP construct. Thus, it is
interesting to note a 2-fold higher EGFP expression following hemin
induction in the G--EGFP construct when compared with
the G-A-EGFP construct, (MPF 1260 vs
741), a situation analogous to the increase in G levels
in some human -thalassemia deletions.22
| |
Discussion |
The sequence of the -globin locus has been known for almost 15 years, but progress in understanding the factors that underlie the
developmental and tissue-specific regulation of globin gene expression
has been very slow. The identification and analysis of the role of
various cis-acting elements and trans-acting factors has traditionally
depended on the use of small plasmid constructs in human and mouse
erythroleukemic cells. However, it is difficult from such studies to
extrapolate to the coordinated control of the different regulatory
elements in the context of the whole -globin locus in erythropoietic
cells, under various physiologically relevant conditions. This
limitation has been partly overcome by the use of transgenic mice
carrying the intact human -globin locus in
YACs22-24 or BACs.25,26 The
transgenic model approach is indeed yielding many insights but it is
very cumbersome, while the regulation of the human -globin locus in
transgenic mice may differ in many subtle ways from the regulation in
human erythropoietic cells. Thus, there is still the need for
convenient cellular model systems that recapitulate as precisely as
possible the regulation of the human -globin locus in human
erythropoietic cells and are readily amenable to experimental
manipulation. The development of techniques for the cloning, targeted
modification, and functional analysis of large genomic fragments in
BACs30-32 provides an opportunity to create cellular
assays that overcome most, if not all, of these limitations.
In this study, we report the delivery and functional analysis of EBACs
containing EGFP-modified -globin locus in human and mouse
erythroleukemic cells. The EBAC system incorporates the EBNA1 gene and
oriP elements of EBV and thus facilitates the maintenance of large
genomic fragments as episomes in human cells under hygromycin selection. However, we have found that expression of EBNA1 is not only
essential for the episomal maintenance of EBACs, but it also
significantly enhances transfection efficiency (Figure 2). This effect
is particularly marked for larger molecules and is manifested only when
EBNA1 is present in the recipient cells prior to transfection. The
exact mechanism by which EBNA1 facilitates preferential transfection of
large EBACs is not entirely clear, but it may be related to its known
binding to karyopherins.49-51 Based on the known role of
karyopherins in nuclear import, it is proposed that the nuclear import
of EBNA1 protein also facilitates the uptake of large EBACs by their
attachment to the nuclear import machinery through the oriP
sequence. Interestingly, although MEL cells stably expressing EBNA1
showed an enhancement of transient transfection efficiency similar to
K562-EBNA1 cells, episomes could not be maintained in long-term
cultures in these cells. The stable expression of EBNA1 in MEL cells
therefore facilitates their use with our globin EBACs in transient
transfection studies and in the generation of stable clones through
hygromycin selection, but not for episomal studies.
In order to monitor expression of each of the globin genes in the
context of the -globin locus, we have used the GET Recombination system30,37 to create a series of EGFP-modified
-globin EBACs (Figure 1). Transient transfection studies in
K562-EBNA1 cells (Figure 2) have shown significant differences in the
fraction of EGFP-expressing cells between the different constructs.
These differences do not appear to arise from the relatively small
differences in the size of the various globin constructs, but are
generally in line with the known pattern of expression of the
endogenous globin genes in K562 cells.44,45 Furthermore,
initiation of selection with hygromycin 48 hours after transfection
leads to cultures in which the EGFP-modified -globin EBACs are
episomally maintained (Figure 3). The in-frame use of EGFP as a
reporter allows the study of the expression of each globin gene of
interest in the context of the whole locus. We show that globin gene
expression in K562-EBNA1 cells containing EGFP-modified
-globin EBACs can be quantitatively assayed in single cells by flow cytometry.
Although the globin-EGFP gene fusion constructs reported in this paper
retain all upstream regulatory elements intact, each has a deletion of
the genomic sequences extending from the start codon of the
corresponding globin gene to the stop codon of the -globin gene (or
from the start codon of the G- to the stop codon of the
A-globin gene in the case of the
G-A-EGFP construct), thus disrupting the
role of intragenic and 3' end regulatory sequences. The absence of any
competition from downstream promoter sequences may account for the very
high level of EGFP expression observed with the --EGFP construct,
and the higher level of expression from the G--EGFP
construct than from the G-A-EGFP
construct. Since other key regulatory elements may be located in the
deleted regions, work is in progress to develop additional EGFP
constructs, which will faithfully retain not only the upstream elements, but also the intragenic and downstream elements as well.
The human erythroleukemic cell line K562 has been used extensively to
study the molecular mechanisms involved in regulating - and
-globin gene expression, although it is not certain that it can
accurately recapitulate the conditions necessary for the reactivation
of fetal globin genes in adult patients. Hemin-induced erythroid
differentiation of K562 cells has previously been reported to result in
a sharp increase in -globin and -globin gene expression that is
associated with cytoplasmic accumulation of embryonic Gower
( 22) and fetal Portland
(22) hemoglobin
molecules.44,45,48 In this study, we show that
hemin-induced erythroid differentiation of episomally transfected
K562-EBNA1 cells resulted in a significant increase in EGFP expression
driven by the -, G- and A-globin
promoters, while EGFP expression from the - and -globin promoters
consistently produced low levels of EGFP. Importantly, we were able to
demonstrate quantitatively the dependence of EGFP expression in
K562-EBNA1 cells on hemin concentration. Given that the half-life of
EGFP in mammalian cells is about 26 hours,52 the increase
in EGFP expression with increasing hemin concentration over 5 days must
primarily reflect increased differentiation of K562-EBNA1 cells down
the erythropoietic pathway. Thus, K562-EBNA1 cells episomally
transfected with the EGFP-modified globin EBACs mirrored the expected
developmental, stage-specific, globin gene expression profile of normal
K562 cells.44,45,48
In conclusion, this study describes the use of the well-characterized
EBNA1/oriP elements of human EBV to facilitate for the first time
transient transfection studies with the EGFP-modified globin BACs in
human and murine erythroleukemia cells. The same approach can be used
to generate stable clones with such constructs in both cell types,
while the human K562 cells can additionally maintain the constructs in
episomal format, thus avoiding variations in expression that might
arise from positional integration effects. We propose that this novel
system provides a convenient approach to study the molecular mechanisms
regulating globin gene expression and - and -globin gene
induction. The further development of a dual fluorescent reporter
system in an adult erythropoietic environment should allow the
simultaneous monitoring of expression from embryonic/fetal and adult
globin genes, thus enabling the rapid screening and identification of
pharmacologic agents with the highest activity to reactivate the
embryonic or fetal genes. Similar approaches may also be applied to the
study of other genes that are cloned intact in PAC/BAC clones, thereby
facilitating the identification of distal regulatory elements and the
development of targeted approaches for the modification of gene
expression as a potential approach to the therapy of various diseases.
| |
Acknowledgments |
We would like to thank Dr D. Burt for providing the pEB plasmid and
Dr F. Grasser for providing the EBNA1-specific MAb 1H4. We would also
like to acknowledge the support of Dr Simon Bol for the use of the
FACScan flow cytometer.
| |
Footnotes |
Submitted January 3, 2002; accepted July 6, 2002.
Prepublished online
as Blood First Edition Paper, August 1, 2002; DOI
10.1182/blood-2001-12-0365.
Supported by grants from the National Health and Medical
Research Council (NHMRC) of Australia, the Brockhoff Foundation, the
Ronald Geoffrey Arnott Foundation, and the Thalassaemia Society of New
South Wales.
The publication costs of this
article were defrayed in part by
page charge payment. Therefore,
and solely to indicate this fact,
this article is hereby marked
"advertisement"
in accordance with 18 U.S.C.
section 1734.
Reprints: Panos Ioannou, CAGT Research Group, The
Murdoch Children's Research Institute, Royal Children's Hospital,
Flemington Rd, Parkville 3052, Melbourne, Australia; e-mail:
ioannoup{at}cryptic.rch.unimelb.edu.au.
| |
References |
|
Top
Abstract
Introduction