|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Prepublished online as a Blood First Edition Paper on August 1, 2002; DOI 10.1182/blood-2001-12-0165.
GENE THERAPY
From the Laboratory of Host Defenses, National
Institute of Allergy and Infectious Diseases, National Institutes of
Health, Bethesda, MD; Cell Genesys, Foster City, CA; and the Sidney
Kimmel Comprehensive Cancer Center, Johns Hopkins University School of
Medicine, Baltimore, MD.
HIV-1-derived lentivectors are promising for gene transfer
into hematopoietic stem cells but require preclinical in vivo
evaluation relevant to specific human diseases. Nonobese
diabetic/severe combined immunodeficient (NOD/SCID) mice accept human
hematopoietic stem cell grafts, providing a unique opportunity for in
vivo evaluation of therapies targeting human hematopoietic diseases. We
demonstrate for the first time that hematopoietic stem cells from
patients with X-linked chronic granulomatous disease (X-CGD) give
rise to X-CGD-phenotype neutrophils in the NOD/SCID model that can be
corrected using VSV-G-pseudotyped, 3rd-generation, self-inactivating (SIN) lentivector encoding gp91phox. We transduced X-CGD
patient-mobilized CD34+ peripheral blood stem cells
(CD34+PBSCs) with lentivector-gp91phox or
amphotropic oncoretrovirus MFGS-gp91phox and
evaluated correction ex vivo and in vivo in NOD/SCID mice. Only
lentivector transduced CD34+PBSCs under ex vivo
conditions nonpermissive for cell division, but both vectors performed
best under conditions permissive for proliferation (multiple growth
factors). Under the latter conditions, lentivector and MFGS achieved
significant ex vivo correction of X-CGD CD34+PBSCs (18%
and 54% of cells expressing gp91phox, associated with 53%
and 163% of normal superoxide production, respectively). However,
lentivector, but not MFGS, achieved significant correction of human
X-CGD neutrophils arising in vivo in NOD/SCID mice that underwent
transplantation (20% and 2.4%, respectively). Thus, 3rd-generation
SIN lentivector-gp91phox performs well as assessed in
human X-CGD neutrophils differentiating in vivo, and our studies
suggest that the NOD/SCID model is generally applicable for in vivo
study of therapies evaluated in human blood cells expressing a specific
disease phenotype.
(Blood. 2002;100:4381-4390) X-linked chronic granulomatous disease (X-CGD) is
an inherited defect in phagocyte oxidase resulting from a deficiency of gp91phox.1-5 Female X-CGD carriers exhibit
mosaicism of oxidase activity in neutrophils. Carriers with more than
5% oxidase normal neutrophils generally have a normal phenotype,
indicating a gene therapy goal of more than 5% corrected
neutrophils.6 Even this modest goal for gene marking has
not been achieved in myeloid cells in human subjects in vivo after ex
vivo stem cell gene therapy.7 One obstacle is the
inability of oncoretrovirus vectors to transduce nondividing
G0 or G1 hematopoietic totipotent stem
cells.8-11 Although vectors derived from lentiviruses have
the potential to overcome this obstacle,12-17 lentivectors
considered for clinical application must be modified to eliminate
pathogenicity and potential to regain replication function yet retain
the desirable feature of transducing totipotent hematopoietic stem
cells. The replication-incompetent 3rd-generation lentivector used in
this study is self-inactivating, stripped of all HIV accessory
proteins, lacks regulatory Tat protein, and is strictly dependent on
complementation of Rev protein in trans; thus, it appears to
satisfy these requirements.18,19
Most work with lentivectors has been performed with nontherapeutic
marker genes such as eGFP.13,20-25 It is
important to demonstrate that 3rd-generation SIN lentivector
efficiently transduces primitive hematopoietic stem cells with each
therapeutic gene of interest, such as the gp91phox required
for correction of X-CGD. The gp91phox is a 570-amino acid,
highly glycosylated transmembrane protein that must form a heterodimer
with p22phox and interact with other oxidase subunits for
functional activity.4 In this study we demonstrate that
3rd-generation SIN lentivector encoding gp91phox achieves
ex vivo transduction of nondividing, mobilized CD34+PBSCs
from patients with X-CGD; corrects the functional oxidase defect in
myeloid cells derived in vitro from these transduced CD34+PBSCs; and efficiently transduces NOD/SCID
mouse-repopulating X-CGD CD34+PBSCs, in which it achieves
persistent expression of gp91phox in human granulocytes
differentiated in vivo in these chimeras.
Source of CD34+PBSCs or engineered K562-X-CGD
cell line
We also used a human K562 cell model of X-CGD (K562-X-CGD) that we
engineered to contain p47phox and p67phox (and
that naturally expresses p22phox mRNA).27 Only
when K562-X-CGD are transduced to also produce gp91phox do
these cells become capable of generating superoxide in response to
phorbol 12-myristate 13-acetate (PMA) stimulation. Procedures for
transduction and for analysis of gp91phox
expression and oxidase activity in K562-X-CGD were similar to those
outlined below for CD34+PBSCs.
Construction of vectors encoding gp91phox and
eGFP
Vector production Amphotropic MFGS-gp91phox or MFGS-eGFP vector was collected over 12 hours from confluent cultures of producer lines, at titers of 2 × 107 or 1 × 106 infectious particles/mL, respectively. Supernate was filtered, stored at 70°C,
and used at 90% of neat supernatant for transductions.
VSV-G-pseudotyped lentivector-gp91phox, -eGFP, or -eCFP
particles were generated by transient cotransfection of the specific
transfer vector plasmid with the 3 packaging plasmids (pMDLg/pRRE, the gag-pol plasmid; pRSV-Rev, a Rev expressing plasmid; and pMD.G, a VSV-G
envelope expressing plasmid) into 293T cells as described previously.18 Lentivector supernatant was filtered,
concentrated by ultracentrifugation (43 000g for 3 hours),
and stored at CD34+PBSC culture and transduction procedures Cultures (37°C, 7% CO2) of CD34+PBSCs were initiated at 2 × 105 cells/mL (5 mL per well in 6-well plates) in complete growth medium (X-VIVO 10 [BioWhittaker, Walkersville, MD] containing 1% human serum albumin [HSA] plus stem cell factor [SCF] at 50 ng/mL [R&D Systems, Minneapolis, MN], FLT3-ligand at 100 ng/mL [FLT3-L, a gift from Immunex, Seattle, WA], thrombopoietin (TPO) at 20 ng/mL [R&D Systems], Pixykine [PIXY321; interleukin-3/granulocyte-macrophage-colony-stimulating factor fusion protein; a gift from Immunex] at 20 ng/mL, and G-CSF at 10 ng/mL). Optimum transduction conditions for MFGS or lentivirus vectors were achieved with 5 growth factors, protamine at 6 µg/mL, fibronectin fragment, CH-296 (RetroNectin TaKaRa Shuzo, Otsu, Japan) coating of plates, and spinoculation (centrifugation in plates at 1200g at 32°C) for 20 minutes at the start of each 7-hour transduction.31,32 Transductions were performed on culture days 1, 2, and 3, after which cells were either maintained in complete growth medium for further culture ex vivo or were washed and resuspended in phosphate-buffered saline (PBS) containing 0.1% HSA for intravenous injection into NOD/SCID mice. Cultures of nontransduced X-CGD or normal CD34+PBSCs served as negative and positive controls, respectively, for assays of oxidase activity and gp91phox expression. Some experiments were performed in which CD34+PBSCs were cultured initially for 3 days with FLT3-L at 50 ng/mL as the only growth factor to maintain cell viability while avoiding stimulation of cell division (proliferation-limiting conditions). In those experiments, with transductions performed under proliferation-limiting conditions, the CD34+PBSCs were maintained overnight with FLT3-L and then were subjected to a single 7-hour transduction with either lentivector-gp91phox or MFGS-gp91phox. Vector medium was replaced with fresh medium containing only FLT3-L. Twenty-four hours later, cells were switched to complete medium containing 5 growth factors. For other experiments, CD34+PBSCs remaining in the G0 phase of the cell cycle at 18 hours of culture in complete growth medium were sorted by labeling with Hoechst 33342 (DNA dye) and PyroninY (RNA dye).33Analysis of transduction and correction of oxidase activity CD34+ cells were maintained in liquid culture for up to 28 days and were analyzed for PMA-stimulated superoxide production (chemiluminescence light units [LU]). For analyses of human hematopoietic cells engrafted in the marrow of NOD/SCID mice, marrow cells were analyzed by flow cytometry to determine the expression of human CD45 (all leukocytes) and human CD13 (myeloid cells). Human gp91phox was detected using fluorescein isothiocyanate (FITC)-conjugated murine monoclonal antibody 7D5, which does not bind to mouse gp91phox.34Vector copy number in transduced human cells was determined by real-time quantitative TaqMan polymerase chain reaction (PCR) (PE Applied Biosystems, Foster City, CA). Endogenous oncoretroviruses exist in the genome of NOD/SCID mice. Therefore, we designed primer sets that amplified only vector inserts from respective MFGS vectors. This design used a common forward primer for all MFGS vectors located just upstream of the transgene, a labeled probe that overlapped the start of transgene sequence, and a reverse primer located within the 5' coding region of each transgene. MFGS-gp91phox: forward primer, GTGAAGGCTGCCGACCC; 6FAM-labeled probe, TGGACCATCCTCTAGACTGCCATG; reverse primer, CCAAACCAGAATGACAAAAATGG; MFGS-eGFP: same forward primer; 6FAM-labeled probe, TGGACCATCCTCTAGACTGCCATGGC; reverse primer, CTCGCCCTTGCTCACCAT. For the lentivectors we designed primers and probe completely within the extended LTR lentivector sequence that could be used regardless of the transgene (gp91phox or eGFP). Lentivector: forward primer, TGAAAGCGAAAGGGAAACCA; 6FAM-labeled probe, AGCTCTCTCGACGCAGGACTC; reverse primer, CCGTGCGCGCTTCAG. For studies comparing vector copy and mRNA transcript numbers in MFGS- versus lentivector-gp91phox-transduced K562-X-CGD, we designed primers and probe spanning cDNA exon 3 and exon 4 regions that amplified only the gp91phox transgene insert and not the native gp91phox genomic sequence, regardless of which type of vector was used. gp91phox cDNA: forward primer, GTCGAAATCTGCTGTCCTTCCT; 6FAM-labeled probe, TTCCAGTGCGTGCTGCTCAACAAGA; reverse primer, TTCGAAGACAACTGGACAGGAAT. Quantitative real-time TaqMan PCR analysis of percentage human cell engraftment in NOD/SCID mice was found to correlate closely with human CD45+ cells by flow cytometry. A primer set and fluorescent probe were devised to detect the human housekeeping gene, phenol sulfotransferase gene (STP), within chimeric bone marrow.35,36 Human STP: forward primer, GGTGCCCTTCCTTGAGTTCA; 6FAM-labeled probe, CCCCAGGGATTCCCTCAGGTGTGT; reverse primer, CCCCTTGCACCCAGGAC. Genomic DNA from mixtures of mouse and human blood cells were used as standards. For TaqMan PCR analysis, the following incubation periods were applied for all primer sets: 2 minutes at 50°C, 10 minutes at 95°C, 40 cycles of 15 seconds at 95°C, and 60 seconds at 60°C. Standard curves for the TaqMan PCR analyses were obtained by using vector single-copy clones of K562 cells transduced with the respective vectors. Transplantation of human CD34+PBSCs into NOD/SCID mice Cultured CD34+PBSCs (107/mouse) were transplanted by tail-vein injection into sublethally (325 cGy) irradiated 7- to 9-week-old NOD/SCID mice (Jackson Laboratory, Bar Harbor, ME). For all lentivector studies and most MFGS vector studies, mice were killed after 3.5 months, and bone marrow was harvested from femurs and tibias.20 For one set of experiments with MFGS-gp91phox transduced X-CGD CD34+PBSCs, the NOD/SCID/ 2m / mouse model was used and analyzed at 2 months after transplantation. Although total engraftment of human cells
was higher in the latter model, the percentage of transduced human
cells appeared to be the same with MFGS vectors in both mouse models
when analyzed after 2 months or longer.
Lentivector-gp91phox transduction of nondividing X-CGD CD34+PBSCs corrects oxidase function Initial studies focused on determining the potential of our lentivectors to transduce nondividing, human, mobilized CD34+PBSCs. In preliminary studies, we demonstrated that CD34+PBSCs cultured with 50 ng/mL FLT3-L alone were viable for 3 days but did not proliferate. This was confirmed by pulse labeling of CD34+PBSCs with PKH26 or CFSE (carboxyfluorescein diacetate succinimidyl ester).37-39 CFSE fluorescence of CD34+PBSCs remained constant until day 3 in medium containing FLT3-L only (Figure 1A), whereas 95% of CD34+PBSCs cultured in medium containing 5 growth factors had divided 1 to 4 times (Figure 1B).
As X-CGD CD34+PBSCs differentiated in culture, endogenous
oxidase subunits (excluding the deficient gp91phox) began
to appear by day 7. Thus, the appearance of oxidase activity is
correlated with gp91phox transgene expression. Figure
2 shows the appearance of oxidase activity (% of normal) in cultures of X-CGD CD34+PBSCs
that had been transduced once with 3rd-generation SIN
lentivector-gp91phox (left pair of bars) or
MFGS-gp91phox (right pair of bars) under
proliferation-limiting (open bars) or proliferation-permissive (hatched
bars) conditions (conditions corresponding to those shown in Figure
1A-B).
These studies confirm that 3rd-generation lentivector gp91phox retained the ability to transduce nonproliferating X-CGD CD34+PBSCs and that MFGS-gp91phox lacked any significant capacity to transduce nondividing CD34+PBSCs. However, the activation of CD34+PBSCs with multiple cytokines did significantly enhance the capacity of 3rd-generation SIN lentivector to transduce human CD34+PBSCs. Most published studies of lentivector transduction of unstimulated hematopoietic stem cells have been performed with either cord blood or bone marrow, each of which appears to transduce with lentivector efficiently, even without cytokine prestimulation. Mobilized CD34+PBSCs in the current study required stimulation for optimum transduction with 3rd-generation SIN lentivectors. Therefore, for our studies of transplantation of human CD34+PBSCs into NOD/SCID mice, all transductions were performed under conditions of optimum proliferation (multiple growth factors). Results of 3 daily 7-hour transductions of X-CGD CD34+PBSCs under optimum proliferation conditions X-CGD CD34+PBSCs were transduced ex vivo with lentivector gp91phox or MFGS-gp91phox on 3 consecutive days under optimum transduction conditions, as noted in "Materials and methods," and were analyzed for the expression of gp91phox transgene on culture day 17 (Figure 3). Similar cultures of nontransduced X-CGD CD34+PBSCs and normal CD34+PBSCs were used as negative and positive controls, respectively, for gp91phox expression. By day 17 of ex vivo culture, CD34+PBSCs had differentiated such that 24% of nontransduced normal CD34+PBSCs appeared to be granulocytes (neutrophils, band forms, eosinophils) that expressed high levels of native gp91phox (Figure 3, open bar). Similar analyses of differentiating cultures of naive, nontransduced X-CGD CD34+PBSCs indicated similar numbers of granulocytes by visual light microscopy inspection but demonstrated no detectable labeling with anti-gp91phox antibody (not shown). X-CGD CD34+PBSCs transduced with lentivector-gp91phox or MFGS-gp91phox under optimum conditions demonstrated gp91phox transgene expression in 18% and 54% of cells, respectively, at day 17 of culture (Figure 3, stippled and hatched bars).
Figure 4 shows reconstitution of oxidase
activity over 4 weeks of culture after transduction, with the results
expressed as percentage of oxidase activity appearing in
differentiating cultures of normal CD34+PBSCs. There was
little detectable oxidase activity in the cultures of naive,
nontransduced X-CGD CD34+PBSCs (Figure 4, open squares).
With both groups of transduced X-CGD CD34+PBSCs, the
apparent correction peaked at 3 weeks in culture, at which time X-CGD
cells transduced with the lentivector-gp91phox
demonstrated approximately 53% of normal activity, whereas
MFGS-gp91phox-transduced X-CGD cells generated 163% of
normal activity. The supranormal levels of oxidase activity in the
MFGS-gp91phox-transduced population likely resulted from
high expression of gp91phox transgene in differentiating
myeloid cells that had begun to express low levels of the complementary
oxidase subunits. We have previously shown that transduction-mediated
high expression of any one of the oxidase subunits, even in normal
early myeloid cells expressing low levels of oxidase factor subunits,
results in higher levels of oxidase activity.31 This is
probably a simple chemical mass-action effect. Early in
differentiation, when all the subunits are present in limiting amounts,
increasing the concentration of any one of the multiple subunits
enhances assembly to form the active oxidase.
A similar comparison of lentivector-eGFP and MFGS-eGFP transduction
of normal CD34+PBSCs on 3 successive days in the optimum
growth conditions is shown in Figure 5.
Again, the oncoretrovirus vector achieved higher rates of transduction
of the overall population of differentiating CD34+PBSCs, as
assessed over 28 days of ex vivo culture, than lentivector-eGFP.
It is not the transduction of CD34+PBSCs, as assessed ex vivo in long-term culture, but the transduction of the most primitive long-term marrow repopulating cells that determines the clinical efficacy of a vector system. Determination of transduction efficiency in those human CD34+PBSCs capable of engrafting the NOD/SCID mouse likely is more predictive of the clinical usefulness of a vector system, and this assessment was performed next. Persistent expression of gp91phox by gene-corrected human X-CGD neutrophils in NOD/SCID mouse chimeras Lentivector-gp91phox- or MFGS-gp91phox-transduced X-CGD CD34+PBSCs and lentivector-eGFP- or MFGS-eGFP-transduced normal CD34+PBSCs described in the previous section were injected intravenously into NOD/SCID mice (approximately 107 cultured CD34+PBSCs per mouse, representing approximately a 3.5-fold expansion during 4 days of ex vivo culture). Some control mice received nontransduced X-CGD or normal CD34+PBSCs cultured similarly to transduced cells. Mouse-human chimeric bone marrow was harvested at 3.5 months (2 months in one MFGS-gp91phox experiment).NOD/SCID chimeric bone marrow was analyzed by flow cytometry to assess
engraftment of human cells and expression of either gp91phox or eGFP in human cells. For the data derived by
flow cytometry and shown in Figure 6,
analysis was gated on the region with forward and side scatter
characteristic of human and murine neutrophils and on the human
CD45+ population. This region also contained all human
CD13+ (myeloid) cells. The range of human cell engraftment
was 15% to 60%, and there was close correlation between the
CD45+ flow cytometry analysis and the STP gene
PCR assessment used to verify the extent of human cell engraftment.
Figure 6 shows summary data for the in vivo experiments. It is
important to recall that for gp91phox and eGFP vector
comparisons, MFGS oncoretrovirus vectors achieved higher transduction
as measured ex vivo (Figures 4-5).
We used TaqMan PCR to determine the copy number calculated per transgene-expressing human cell of lentivector or MFGS vector transgene in genomic DNA from NOD/SCID chimeric bone marrow. Average lentivector insert copy numbers per transgene-expressing engrafted human cell in these experiments was 2.5 and 2.2 for the lentivector-gp91phox (8 mice analyzed) and lentivector-eGFP (6 mice analyzed), respectively. Average insert copy numbers per transgene-expressing cells in the same cells ex vivo before transplantation (2-3 preparations each) were 5.7 and 10, respectively. This is consistent with the notion that committed progenitors, which do not engraft, are more easily transduced to higher copy numbers. With MFGS-gp91phox and MFGS-eGFP, insert copy numbers ex vivo per transgene-expressing cells were 11.9 and 6.0, respectively. The very low percentage of human cells expressing transgene in vivo in the MFGS experiments (see next paragraph) made it difficult to reliably calculate the in vivo copy number per transgene-expressing cell (approximate range, 1-4 copies). Additional ex vivo transduction experiments were performed in which vector copy number was determined in CD34+PBSCs that were sorted by flow cytometry into populations that did or did not express transgene. Transgene expression-negative cells had a vector copy number of less than 0.01, whereas vector copy numbers in transgene-expressing cells were consistent with those indicated above for the experiments in which ex vivo-transduced cells were transplanted into NOD/SCID mice. It is important to note that in the lentivector and the MFGS vector studies in the NOD/SCID mice, silencing of transgene expression might have occurred and would have increased the calculated copy insert number per transgene-expressing cell. Particularly with MFGS, vector silencing might have contributed significantly to the low expression in vivo. Despite higher transduction measured ex vivo with MFGS-gp91phox or MFGS-eGFP, the percentages of human NOD/SCID repopulating cells that expressed transgene in vivo with these vectors averaged only 2.4% and 0.3%, respectively. This emphasizes the fact that the apparent transduction of the total CD34+PBSC culture population as measured ex vivo was not predictive of the targeting of the primitive stem cells capable of engrafting in NOD/SCID mice. Figures 7,
8, and 9
show examples of dot plots of flow cytometry analyses used to generate
the summary data shown in Figure 6. The 4 representative dot plots in
Figure 7 include cells with forward and side scatter parameters
characteristic of granulocytes, and they indicate how we gated on the
human CD45+ cells to assess the percentage of human cell
engraftment. Figure 8 shows examples of dot plot analyses of eGFP
transgene expression in the human CD45+ gated population
from NOD/SCID chimeric marrow, with or without transduction with
lentivector-eGFP. In the example from the lentivector-eGFP transduction experiment shown in Figure 8B, 42% of the
lentivector-eGFP-transduced human normal CD34+PBSCs
engrafted in this NOD/SCID mouse bone marrow expressed high levels of
eGFP. The control for this experiment (engraftment of nontransduced
normal human cells) is shown in Figure 8A, where no human cells express
eGFP. We do not show the analysis of an example from the MFGS-eGFP
transduction experiments because the percentages of human cells from
the NOD/SCID chimeras that appeared to express eGFP were lower than
0.4% in every case.
Figure 9 shows representative examples of dot plot analyses of gp91phox transgene expression in the CD45+ human X-CGD-cell-gated population from NOD/SCID chimeric marrow without (Figure 9A-C) or with transduction with lentivector-gp91phox (Figure 9B) or MFGS-gp91phox (Figure 9D). As a control, native expression of gp91phox in normal human cells in the NOD/SCID chimeric marrow is also shown (Figure 9E). It is important to note that the intensity of labeling with anti-gp91phox antibody in the gp91phox-expressing population (boxed areas), as determined by the mean fluorescence intensity per cell, was greater in the normal (Figure 9E) and the MFGS-gp91phox-transduced (Figure 9D) groups than in the lentivector-gp91phox group (Figure 9B). Although Figure 9 demonstrates this in vivo in the transduced cells from one mouse in each of the groups shown, this pattern of expression level has been seen in every experiment we conducted comparing the lentivector-CMV-gp91phox-transduced cells versus MFGS-gp91phox-transduced cells, whether ex vivo or in the NOD/SCID model in vivo. This indicates that the expression of gp91phox from the MFGS LTR promoter was significantly greater than the expression from the CMV internal promoter in the SIN lentivector. Of note is that this was not the case with eGFP, in which the cellular expression of eGFP was the same using SIN lentivector or MFGS vector. Effect of vector type and internal promoter on expression of gp91phox Because the level of transduction of NOD/SCID-repopulating human CD34+PBSCs with our lentivectors was encouraging but the expression of gp91phox per cell from the internal CMV promoter was low, it was important to determine the basis of this observation and to determine possible corrective measures. We recently constructed our SIN lentivector-gp91phox with alternative internal promoters (human PGK or human EF1 promoters) to improve
gp91phox expression. We used these vectors in a series of
experiments with our K562-X-CGD model, described in "Materials and
methods," to assess these issues. Of importance to the current
analysis, VSV-G-pseudotyped lentivector-CMV-gp91phox and
amphotropic MFGS-gp91phox transduced this K562-X-CGD
model efficiently, and relative amounts and differences in the
expression of gp91phox transgene in these X-CGD-type K562
cells measured by mean fluorescence intensity
(anti-gp91phox monoclonal antibody) by flow cytometry were
similar to the amounts and differences seen in the transduced X-CGD
CD34+ cells. As shown in Table
1, we compared genomic vector insert copy
number (TaqMan PCR of genomic DNA), mRNA transcript numbers (TaqMan PCR
on reverse-transcribed mRNA), mean fluorescence intensity (by flow
cytometry) of gp91phox transgene expression in the
transgene-positive population, and PMA-stimulated oxidase activity
(chemiluminescence light units).
We conclude that the primary source of the differences in
gp91phox expression per cell that we saw between
lentivector-CMV-gp91phox and MFGS-gp91phox
was related to lower production of mRNA per integrated vector copy
insert. Furthermore, replacement of the CMV promoter with EF1 Results of lentivector-eCFP and MFGS-eGFP cotransduction of G0 sorted CD34+PBSCs Based on the work of others, the basis for low correction or marking of human cells with amphotropic MFGS vector in vivo in NOD/SCID mice despite high ex vivo transduction is likely attributed to the failure of this vector relative to lentivector to transduce the most primitive cells. It would be helpful to verify this hypothesis in ex vivo culture. Human hematopoietic stem cells that contribute to long-term human cell engraftment are predominantly in G0, and in ex vivo culture do not cycle until after the 3rd day.33,40-42 We compared VSV-G pseudotyped lentivector and amphotropic MFGS transduction of those normal CD34+PBSCs remaining in G0 at 18 hours of culture in proliferation-permissive growth medium. G0 cells sorted to high purity, as described in "Materials and methods" (Figure 10A-B), were transduced at 24 hours and 48 hours after sorting. MFGS vector achieved higher ex vivo transduction rates in the bulk unsorted CD34+PBSCs in this experiment than lentivector (Figure 10E-F), as expected based on our other experiments described above. However, lentivector greatly outperformed MFGS vector in the transduction of sorted G0 CD34+PBSCs ex vivo (Figure 10D), a result that correlates more closely with our NOD/SCID data than the ex vivo transduction of the bulk unsorted CD34+PBSCs and that provides a biologic basis for our results.
This study demonstrates for the first time efficient transduction of NOD/SCID-repopulating human X-CGD CD34+PBSCs by a VSV-G-pseudotyped 3rd-generation SIN lentivector-gp91phox associated with significant correction of the X-CGD defect in human neutrophils. Another important unique feature of our studies is the demonstration that the NOD/SCID model can be used to study mature human neutrophils differentiating in vivo and expressing the X-CGD phenotype derived from human X-CGD patient stem cells. This validates the more general principle of using the NOD/SCID model to study other human hematopoietic cell diseases, particularly those in which there is no large-animal model. Our study provides important new information for considering the transition of lentivector from the laboratory to the clinic. First, we used lentivector that incorporates 3rd-generation safety features.18,19 Second, our studies were performed using G-CSF-mobilized CD34+PBSCs, which are the target of choice for most hematopoietic clinical applications of gene therapy but have rarely been the reported target of lentivector in NOD/SCID model studies. Third, we look at outcomes in which the vector transgene is a therapeutic protein, gp91phox, which corrects the genetic defect of X-linked CGD. The same 3rd-generation SIN lentivector-eGFP used in our study also
was used by Guenechea et al22 in their studies to
demonstrate efficient transduction of NOD/SCID-repopulating
CD34+Lin As shown in Figures 4 and 5, after 3 days of transduction under proliferation-permissive conditions, the high-titer, amphotropic oncoretrovirus vector MFGS transduced more CD34+ cells than the VSV-G-pseudotyped 3rd-generation SIN lentivector, as assessed during prolonged culture ex vivo, regardless of the transgene in the construct (eGFP or gp91phox). When these same cells were injected into irradiated NOD/SCID mice, the percentage of human cells containing vector insert by real-time PCR and expressing the transgene 2 to 3.5 months after engraftment was from almost 10- to 100-fold greater with the lentivector than with the oncoretrovirus vector (20% vs 2.4% for expression of the gp91phox therapeutic transgene; 29% vs 0.3% for the eGFP marker gene). This is in accordance with study results indicating that amphotropic oncoretrovirus vectors are less efficient at transduction of the primitive stem cells that encompass the NOD/SCID-engrafting group, even under proliferation-permissive conditions.49,50 One factor in the poor performance of the MFGS oncoretrovirus vector in the transduction of NOD/SCID-repopulating cells in the current study might have been amphotropic vector pseudotyping. Of note is that 2 published studies have reported significant transduction of NOD/SCID-repopulating human CD34+PBSCs with GALV-pseudotyped oncoretrovirus vector.51,52 Other investigators have explored the potential of VSV-G pseudotyping of a variety of oncoretrovirus vectors and have not found this maneuver to greatly enhance transduction of the most primitive hematopoietic stem cells.53 Important information can be derived from our observation that amphotropic MFGS vector achieved some long-term transgene expression in the human CD34+PBSCs engrafted in the NOD/SCID mouse-human chimera model. The absolute requirement of cell division for integration of oncoretrovirus cDNA preintegration complex allows us to conclude that a small number of NOD/SCID-repopulating CD34+PBSCs were stimulated to go through at least one cell division before engraftment during transduction under proliferation-permissive conditions. Furthermore, the high level of overall engraftment of human cells in the NOD/SCID mice in our studies demonstrated that proliferation-permissive conditions of ex vivo culture for 4 days can preserve NOD/SCID-repopulating potential. Our studies of the transduction of CD34+PBSCs remaining in G0 at 18 hours of culture in proliferation-permissive conditions suggest a close numerical correlation between the MFGS or lentivector transduction rates of this subpopulation ex vivo and the results we saw in vivo in the NOD/SCID mice. The 3rd-generation SIN lentivector that we used in this study was reliant on the activity of an internal promoter (CMV) to achieve transgene expression in the target cell population. By contrast, the MFGS oncoretrovirus vector relied on the activity of the virus LTR to achieve transgene expression. Expression of the gp91phox therapeutic gene product was significantly higher per MFGS-gp91phox gene-corrected cell (approaching that of native gp91phox expression in normal neutrophils) than the 3rd-generation SIN lentivector-CMV-gp91phox gene-corrected cell, as indicated by the mean fluorescence intensity by flow cytometry (Figure 9). This is true ex vivo and in vivo in the NOD/SCID chimeras. Similarly low expression per cell of gp91phox transgene mediated by a SIN lentivector with the CMV internal promoter was reported to occur after transduction of the X-CGD PLB985 cell line,54 and we found the same result in our K562-X-CGD model. By contrast, we have found the expression of eGFP to be uniformly high per cell with both types of vectors. This emphasizes that it may be necessary to individually assess the expression of each therapeutic transgene in a particular vector system. Studies from Dr Dinauer's laboratory have demonstrated that the
expression of only 15% to 20% of normal amounts of
gp91phox per cell in gp91phox-deficient myeloid
cells is associated with higher relative levels of restoration of
oxidant production per cell.55 Thus, it may not
be necessary to achieve full restoration of gp91phox
protein to levels seen in normal neutrophils to obtain a clinically beneficial level of correction of oxidase function. Nonetheless, it
would be desirable to be able to achieve the highest level of
gp91phox transgene expression possible from the
3rd-generation SIN lentivector system. In the current study we found
that the expression of gp91phox protein per cell from our
lentivector CMV promoter construct is probably inadequate for clinical
application. Our studies with the K562-X-CGD cell line suggest that
the basis for this observation is low mRNA production mediated by the
CMV promoter. EF1 In summary, we show for the first time that 3rd-generation SIN lentivector-gp91phox provides significant correction of the X-CGD functional defect in oxidase activity and efficiently transduces NOD/SCID-repopulating X-CGD CD34+PBSCs, resulting in long-term persistence of gp91phox expression in human X-CGD neutrophils in vivo.
Submitted December 6, 2001; accepted July 23, 2002.
Prepublished online as Blood First Edition Paper, August 1, 2002; DOI 10.1182/blood-2001-12-0165.
Supported by Deutsche Forschungsgemeinschaft grant BR 2057/1 (S.B.) and National Institutes of Health grant PO1 CA70970 (C.I.C.).
J.R. and S.B. contributed equally to this manuscript.
A.A.B., T.D., and M.K. are or have been employees of Cell Genesys, Inc, which has a commercial interest in the lentivector system described in these studies. Johns Hopkins University holds patents on CD34 monoclonal antibodies and related inventions. C.I.C. is entitled to a share of the sales royalty received by the University under licensing agreements between the University, Becton Dickinson Corp, and Baxter HealthCare Corp. The terms of these arrangements have been reviewed and approved by the University in accordance with its conflict-of-interest policies.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Harry L. Malech, Laboratory of Host Defenses, National Institute of Allergy and Infectious Diseases, Bldg 10, Rm 11N113, 10 Center Dr, MSC 1886, Bethesda, MD 20892-1886; e-mail: hmalech{at}nih.gov.
1. Rae J, Newburger PE, Dinauer MC, et al. X-linked chronic granulomatous disease: mutations in the CYBB gene encoding the gp91-phox component of respiratory-burst oxidase. Am J Hum Genet. 1998;62:1320-1331[CrossRef][Medline] [Order article via Infotrieve]. 2. Roesler J, Heyden S, Burdelski M, et al. Uncommon missense and splice mutations and resulting biochemical phenotypes in German patients with X-linked chronic granulomatous disease. Exp Hematol. 1999;27:505-511[CrossRef][Medline] [Order article via Infotrieve]. 3. Roos D. X-CGDbase: a database of X-CGD-causing mutations. Immunol Today. 1996;17:517-521[Medline] [Order article via Infotrieve]. 4. Roos D, Curnutte JT. Chronic granulomatous disease. In: Ochs OD,Smith CIE,Puck FM, eds. Primary Immunodeficiency Diseases. New York, NY: Oxford University Press; 1999. 5. Tauber AI, Borregaard N, Simons E, Wright J. Chronic granulomatous disease: a syndrome of phagocyte oxidase deficiencies. Medicine (Baltimore). 1983;62:286-309[Medline] [Order article via Infotrieve]. 6. Malech HL. Progress in gene therapy for chronic granulomatous disease. J Infect Dis. 1999;179(suppl 2):S318-S325[Medline] [Order article via Infotrieve].
7.
Malech HL, Maples PB, Whiting-Theobald N, et al.
Prolonged production of NADPH oxidase-corrected granulocytes after gene therapy of chronic granulomatous disease.
Proc Natl Acad Sci U S A.
1997;94:12133-12138
8.
Case SS, Price MA, Jordan CT, et al.
Stable transduction of quiescent CD34(+)CD38(
9.
Lewis PF, Emerman M.
Passage through mitosis is required for oncoretroviruses but not for the human immunodeficiency virus.
J Virol.
1994;68:510-516 10. Roe T, Reynolds TC, Yu G, Brown PO. Integration of murine leukemia virus DNA depends on mitosis. EMBO J. 1993;12:2099-2108[Medline] [Order article via Infotrieve].
11.
Uchida N, Sutton RE, Friera AM, et al.
HIV, but not murine leukemia virus, vectors mediate high efficiency gene transfer into freshly isolated G0/G1 human hematopoietic stem cells.
Proc Natl Acad Sci U S A.
1998;95:11939-11944 12. Kafri T, Blomer U, Peterson DA, Gage FH, Verma IM. Sustained expression of genes delivered directly into liver and muscle by lentiviral vectors. Nat Genet. 1997;17:314-317[Medline] [Order article via Infotrieve].
13.
Miyoshi H, Smith KA, Mosier DE, Verma IM, Torbett BE.
Transduction of human CD34+ cells that mediate long-term engraftment of NOD/SCID mice by HIV vectors.
Science.
1999;283:682-686
14.
Mochizuki H, Schwartz JP, Tanaka K, Brady RO, Reiser J.
High-titer human immunodeficiency virus type 1-based vector systems for gene delivery into nondividing cells.
J Virol.
1998;72:8873-8883
15.
Naldini L, Blomer U, Gage FH, Trono D, Verma IM.
Efficient transfer, integration, and sustained long-term expression of the transgene in adult rat brains injected with a lentiviral vector.
Proc Natl Acad Sci U S A.
1996;93:11382-11388
16.
Poeschla E, Corbeau P, Wong-Staal F.
Development of HIV vectors for anti-HIV gene therapy.
Proc Natl Acad Sci U S A.
1996;93:11395-11399 17. Zhang H, Dornadula G, Pomerantz RJ. Endogenous reverse transcription of human immunodeficiency virus type 1 in physiological microenviroments: an important stage for viral infection of nondividing cells. J Virol. 1996;70:2809-2824[Abstract].
18.
Dull T, Zufferey R, Kelly M, et al.
A third-generation lentivirus vector with a conditional packaging system.
J Virol.
1998;72:8463-8471
19.
Zufferey R, Dull T, Mandel RJ, et al.
Self-inactivating lentivirus vector for safe and efficient in vivo gene delivery.
J Virol.
1998;72:9873-9880 20. Gao Z, Golob J, Tanavde VM, et al. High levels of transgene expression following transduction of long-term NOD/SCID-repopulating human cells with a modified lentiviral vector. Stem Cells. 2001;19:247-259[CrossRef][Medline] [Order article via Infotrieve]. 21. Gatlin J, Padgett A, Melkus MW, Kelly PF, Garcia JV. Long-term engraftment of nonobese diabetic/severe combined immunodeficient mice with human CD34+ cells transduced by a self-inactivating human immunodeficiency virus type 1 vector. Hum Gene Ther. 2001;12:1079-1089[CrossRef][Medline] [Order article via Infotrieve].
22.
Guenechea G, Gan OI, Inamitsu T, et al.
Transduction of human CD34+ CD38 23. Sirven A, Ravet E, Charneau P, et al. Enhanced transgene expression in cord blood CD34(+)-derived hematopoietic cells, including developing T cells and NOD/SCID mouse repopulating cells, following transduction with modified trip lentiviral vectors. Mol Ther. 2001;3:438-448[CrossRef][Medline] [Order article via Infotrieve].
24.
Woods NB, Fahlman C, Mikkola H, et al.
Lentiviral gene transfer into primary and secondary NOD/SCID repopulating cells.
Blood.
2000;96:3725-3733 25. Woods NB, Mikkola H, Nilsson E, et al. Lentiviral-mediated gene transfer into haematopoietic stem cells. J Intern Med. 2001;249:339-343[CrossRef][Medline] [Order article via Infotrieve].
26.
Sekhsaria S, Fleisher TA, Vowells S, et al.
Granulocyte colony-stimulating factor recruitment of CD34+ progenitors to peripheral blood: impaired mobilization in chronic granulomatous disease and adenosine deaminase-deficient severe combined immunodeficiency disease patients.
Blood.
1996;88:1104-1112 27. de Mendez I, Adams AG, Sokolic RA, Malech HL, Leto TL. Multiple SH3 domain interactions regulate NADPH oxidase assembly in whole cells. EMBO J. 1996;15:1211-1220[Medline] [Order article via Infotrieve].
28.
Li F, Linton GF, Sekhsaria S, et al.
CD34+ peripheral blood progenitors as a target for genetic correction of the two flavocytochrome b558 defective forms of chronic granulomatous disease.
Blood.
1994;84:53-58
29.
Ory DS, Neugeboren BA, Mulligan RC.
A stable human-derived packaging cell line for production of high titer retrovirus/vesicular stomatitis virus G pseudotypes.
Proc Natl Acad Sci U S A.
1996;93:11400-11406
30.
Sekhsaria S, Gallin JI, Linton GF, et al.
Peripheral blood progenitors as a target for genetic correction of p47phox-deficient chronic granulomatous disease.
Proc Natl Acad Sci U S A.
1993;90:7446-7450
31.
Weil WM, Linton GF, Whiting-Theobald N, et al.
Genetic correction of p67phox deficient chronic granulomatous disease using peripheral blood progenitor cells as a target for retrovirus mediated gene transfer.
Blood.
1997;89:1754-1761 32. Hanenberg H, Hashino K, Konishi H, et al. Optimization of fibronectin-assisted retroviral gene transfer into human CD34+ hematopoietic cells. Hum Gene Ther. 1997;8:2193-2206[Medline] [Order article via Infotrieve].
33.
Gothot A, van der Loo JC, Clapp DW, Srour EF.
Cell cycle-related changes in repopulating capacity of human mobilized peripheral blood CD34(+) cells in non-obese diabetic/severe combined immune-deficient mice.
Blood.
1998;92:2641-2649 34. Yamauchi A, Yu L, Potgens AJ, et al. Location of the epitope for 7D5, a monoclonal antibody raised against human flavocytochrome b558, to the extracellular peptide portion of primate gp91phox. Microbiol Immunol. 2001;45:249-257[Medline] [Order article via Infotrieve]. 35. Dooley TP, Obermoeller RD, Leiter EH, et al. Mapping of the phenol sulfotransferase gene (STP) to human chromosome 16p12.1-p11.2 and to mouse chromosome 7. Genomics. 1993;18:440-443[CrossRef][Medline] [Order article via Infotrieve].
36.
Gao Z, Fackler MJ, Leung W, et al.
Human CD34+ cell preparations contain over 100-fold greater NOD/SCID mouse engrafting capacity than do CD34
37.
Ladd AC, Pyatt R, Gothot A, et al.
Orderly process of sequential cytokine stimulation is required for activation and maximal proliferation of primitive human bone marrow CD34+ hematopoietic progenitor cells residing in G0.
Blood.
1997;90:658-668
38.
Luens KM, Travis MA, Chen BP, et al.
Thrombopoietin, kit ligand, and flk2/flt3 ligand together induce increased numbers of primitive hematopoietic progenitors from human CD34+Thy-1+Lin
39.
Oostendorp RA, Audet J, Eaves CJ.
High-resolution tracking of cell division suggests similar cell cycle kinetics of hematopoietic stem cells stimulated in vitro and in vivo.
Blood.
2000;95:855-862 40. Horwitz ME, Malech HL, Anderson SM, et al. Granulocyte colony-stimulating factor mobilized peripheral blood stem cells enter into G1 of the cell cycle and express higher levels of amphotropic retrovirus receptor mRNA. Exp Hematol. 1999;27:1160-1167[CrossRef][Medline] [Order article via Infotrieve]. 41. Jordan CT, Yamasaki G, Minamoto D. High-resolution cell cycle analysis of defined phenotypic subsets within primitive human hematopoietic cell populations. Exp Hematol. 1996;24:1347-1355[Medline] [Order article via Infotrieve].
42.
Glimm H, Oh IH, Eaves CJ.
Human hematopoietic stem cells stimulated to proliferate in vitro lose engraftment potential during their S/G(2)/M transit and do not reenter G(0).
Blood.
2000;96:4185-4193 43. Holyoake TL, Nicolini FE, Eaves CJ. Functional differences between transplantable human hematopoietic stem cells from fetal liver, cord blood, and adult marrow. Exp Hematol. 1999;27:1418-1427[CrossRef][Medline] [Order article via Infotrieve]. 44. Ueda T, Yoshida M, Yoshino H, et al. Hematopoietic capability of CD34+ cord blood cells: a comparison with CD34+ adult bone marrow cells. Int J Hematol. 2001;73:457-462[Medline] [Order article via Infotrieve].
45.
Wang JC, Doedens M, Dick JE.
Primitive human hematopoietic cells are enriched in cord blood compared with adult bone marrow or mobilized peripheral blood as measured by the quantitative in vivo SCID-repopulating cell assay.
Blood.
1997;89:3919-3924 46. Leung W, Ramirez M, Novelli EM, Civin CI. In vivo engraftment potential of clinical hematopoietic grafts. J Investig Med. 1998;46:303-311[Medline] [Order article via Infotrieve]. 47. Naldini L, Blomer U, Gallay P, et al. In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science. 1996;272:263-267[Abstract].
48.
Pryciak PM, Muller HP, Varmus HE.
Simian virus 40 minichromosomes as targets for retroviral integration in vivo.
Proc Natl Acad Sci U S A.
1992;89:9237-9241 49. Hennemann B, Chuo JY, Schley PD, et al. High-efficiency retroviral transduction of mammalian cells on positively charged surfaces. Hum Gene Ther. 2000;11:43-51[CrossRef][Medline] [Order article via Infotrieve].
50.
van Hennik PB, Verstegen MM, Bierhuizen MF, et al.
Highly efficient transduction of the green fluorescent protein gene in human umbilical cord blood stem cells capable of cobblestone formation in long-term cultures and multilineage engraftment of immunodeficient mice.
Blood.
1998;92:4013-4022
51.
Schiedlmeier B, Kuhlcke K, Eckert HG, et al.
Quantitative assessment of retroviral transfer of the human multidrug resistance 1 gene to human mobilized peripheral blood progenitor cells engrafted in nonobese diabetic/severe combined immunodeficient mice.
Blood.
2000;95:1237-1248 52. Schilz AJ, Schiedlmeier B, Kuhlcke K, et al. MDR1 gene expression in NOD/SCID repopulating cells after retroviral gene transfer under clinically relevant conditions. Mol Ther. 2000;2:609-618[CrossRef][Medline] [Order article via Infotrieve]. 53. von Laer D, Corovic A, Vogt B, et al. Amphotropic and VSV-G-pseudotyped retroviral vectors transduce human hematopoietic progenitor cells with similar efficiency. Bone Marrow Transplant. 2000;25(suppl 2):S75-S79[Medline] [Order article via Infotrieve]. 54. Saulnier SO, Steinhoff D, Dinauer MC, et al. Lentivirus-mediated gene transfer of gp91phox corrects chronic granulomatous disease (CGD) phenotype in human X-CGD cells. J Gene Med. 2000;2:317-325[CrossRef][Medline] [Order article via Infotrieve].
55.
Bjorgvinsdottir H, Ding C, Pech N, et al.
Retroviral-mediated gene transfer of gp91phox into bone marrow cells rescues defect in host defense against Aspergillus fumigatus in murine X-linked chronic granulomatous disease.
Blood.
1997;89:41-48
56.
Salmon P, Kindler V, Ducrey O, et al.
High-level transgene expression in human hematopoietic progenitors and differentiated blood lineages after transduction with improved lentiviral vectors.
Blood.
2000;96:3392-3398
© 2002 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  J. Chinen, J. Davis, S. S. De Ravin, B. N. Hay, A. P. Hsu, G. F. Linton, N. Naumann, E. Y. H. Nomicos, C. Silvin, J. Ulrick, et al. Gene therapy improves immune function in preadolescents with X-linked severe combined immunodeficiency Blood, July 1, 2007; 110(1): 67 - 73. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Roesler, J.-M. Izquierdo, M. Ryser, A. Rosen-Wolff, M. Gahr, J. Valcarcel, M. J. Lenardo, and L. Zheng Haploinsufficiency, rather than the effect of an excessive production of soluble CD95 (CD95{Delta}TM), is the basis for ALPS Ia in a family with duplicated 3' splice site AG in CD95 intron 5 on one allele Blood, September 1, 2005; 106(5): 1652 - 1659. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Brenner, N. L. Whiting-Theobald, G. F. Linton, K. L. Holmes, M. Anderson-Cohen, P. F. Kelly, E. F. Vanin, A. M. Pilon, D. M. Bodine, M. E. Horwitz, et al. Concentrated RD114-pseudotyped MFGS-gp91phox vector achieves high levels of functional correction of the chronic granulomatous disease oxidase defect in NOD/SCID/{beta}2-microglobulin-/- repopulating mobilized human peripheral blood CD34+ cells Blood, October 15, 2003; 102(8): 2789 - 2797. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2002 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
) or in the 5-cytokine combination (proliferation-permissive
conditions, 
). Twenty-four hours after transduction, all
cells were switched to fresh medium containing the 5-cytokine
combination. PMA-stimulated superoxide generation (chemiluminescence
assay) is expressed as percentage of the stimulated oxidase activity of
a similar 17-day culture of normal CD34+PBSCs. Negative
control: nontransduced X-CGD CD34+PBSCs at 17 days of
culture demonstrated PMA-stimulated superoxide generation that was
0.3% of the normal control (not shown).
) or
MFGS-gp91phox (
). PMA-stimulated
superoxide generation, as measured in a chemiluminescence assay, is
expressed as the percentage of the stimulated superoxide generation by
a similar culture of normal CD34+PBSCs. Results are
representative of 2 experiments.
. NOD/SCID mice also underwent
transplantation with similarly cultured, but nontransduced X-CGD
CD34+PBSCs or normal CD34+PBSCs (not shown
here, but see Figures 
