|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Prepublished online as a Blood First Edition Paper on June 28, 2002; DOI 10.1182/blood-2001-12-0374.
HEMATOPOIESIS
From the Human Biology Division, Fred Hutchinson Cancer
Research Center, Seattle, WA.
The regulation of hematopoiesis involves the interaction of
specific hematopoietic cytokines with lineage-specific transcription factors, but little is known about how these cytokines might regulate the expression/activity of these different transcription factors. Here
we identify the critical signal transduction pathways that mediate the
interleukin 3 (IL-3)-induced enhancement of retinoic acid receptor
(RAR) transcriptional activity that accompanies the IL-3-mediated
commitment of the multipotent, stem cell factor (SCF)-dependent EML
cell line to granulocyte/monocyte progenitors. We observe that the
addition of IL-3 to EML cells induces activation of the
phosphatidylinositol-3 kinase, mitogen-activated protein kinase, and
Jak/Stat pathways and that Jak2 activation is the critical
"proximal" mediator of the IL-3-induced enhancement of RAR
activity. Constitutively active Stat5 constructs enhance both the
transcriptional activity of RARs in EML cells and the commitment of
these cells to granulocyte/monocyte progenitors, whereas
dominant-negative Stat5 constructs inhibit this IL-3-induced
enhancement of RAR transcriptional activity. We observe that the
retinoic acid response element (RARE) used in our RA responsive
reporter harbors overlapping Stat/RAR-binding sites. Moreover,
coimmunoprecipitation studies indicate an interaction between Stat5 and
RARs that is IL-3 dependent. Thus, Stat5 is an important mediator of
the IL-3-induced enhancement of RAR transcriptional activity that
accompanies the commitment of immature EML cells to the
granulocyte/monocyte lineage. Cytokine-mediated physical and functional
interactions between Stat5 and RARs may play critical roles in
regulating different stages of hematopoiesis.
(Blood. 2002;100:4401-4409) Defining the molecular events that regulate the
development of a multipotent hematopoietic stem cell to a
lineage-committed, differentiated progenitor is one of the fundamental
goals of experimental hematology. Hematopoietic stem cell development
is regulated by specific cytokines acting on hematopoietic precursors
of different lineages.1 In addition, different
hematopoietic transcription factors also play a critical role in
directing the commitment and differentiation of hematopoietic stem
cells along a particular lineage.2 Indeed, hematopoiesis
involves an intricate functional interaction between these
lineage-specific growth factors and these lineage-specific
transcription factors, but the molecular basis for how hematopoietic
cytokines regulate the expression and activity of these
lineage-specific transcription factors remains uncertain.
One family of transcription factors that are important regulators of
myeloid differentiation is the retinoic acid receptors (RARs).
Retinoic acid (RA) regulates the growth and differentiation of
primitive normal myeloid precursors in vitro,3 and
knock-out mice deficient in RAR In the present studies, we defined the specific signal transduction
pathways that are involved in this IL-3-mediated up-regulation of RAR
transcriptional activity that is associated with the commitment of the
multipotent, SCF-dependent EML cells to granulocyte/monocyte progenitors. We compared the signal transduction pathways involved in
the SCF-mediated maintenance and proliferation of the multipotent EML
cells with those activated by these same cells exposed to IL-3.
Although we noted a number of different signal transduction pathways
activated by IL-3 in the SCF-dependent EML cells, we observed that
Jak2/Stat5 activation plays the critical role both in enhancing RAR
transcriptional activity and in stimulating the commitment of the
immature, multipotent EML cells to the granulocyte/monocyte lineage.
Unexpectedly, we noted overlapping Stat5/RAR-binding sites in the RA
responsive elements (RAREs) of a number of different genes. Moreover,
we observed an in vivo interaction between Stat5 and RARs that is IL-3
dependent, suggesting that functional cross-talk between Stats and RARs
occurs at different stages of hematopoiesis.
Cell cultures and reagents
Transduction of FLAG-tagged RXR cDNA into BaF3 cells
Expression vector constructs Expression vectors containing a wild-type Stat5a harboring a COOH-terminus FLAG tag (pRKmStat5acFLAG or Stat5aWT) as well as a dominant-negative Stat5a truncated at amino acid 713 (pRKmStat5a713cFLAG or Stat5aDN) were obtained from Jim Ihle.15 A constitutively active Stat5a mutant (pRKmStat5aHScFLAG or Stat5aHS) was generated from pRKmStat5acFLAG using the site-directed mutagenesis kit (Stratagene, Cedar Creek, TX), by substituting His299 and Ser711 with arginine and phenylalanine, respectively.16 To construct the hybrid GAL-RAR expression vector the complete coding sequence of the human
RAR17 was amplified by PCR and cloned into the
EcoR1 site of the GALdbd 1-147 expression vector, pSG424.18 An N-terminal deleted
GALdbd-RAR fusion construct that includes codons 135 to
462 of RAR (designated GAL-RAR N) as well as an N- and
C-terminal-deleted GALdbd-RAR fusion construct
including RAR codons 135 to 403 (designated GAL-RARNC) were
similarly constructed as previously detailed.12 The
corresponding p(UAS)5-LUC reporter that is activated by
GAL4-RAR in a retinoid-responsive manner has been previously
described.12
Antibodies and chemical inhibitors Rabbit polyclonal antibodies recognizing the phosphorylated p44/42 (Erk1/2) (Thr202/Tyr204), the phosphorylation-independent p44/42, the phosphorylated JNK (Thr183/Tyr185), the phosphorylated p38 mitogen-activated protein (MAP) kinase (Thr180/Tyr182), the phosphorylated Akt (Ser473), the phosphorylation-independent Akt, the phospho-Stat1 (Tyr701), phospho-Stat3 (Tyr705), and phospho-Stat5 (Tyr694) were obtained from Cell Signaling Technology (Beverly, MA). Rabbit antibodies recognizing RAR, RXR, and the
phosphorylation-independent Stat5 were obtained from Santa Cruz
Biotechnology (Santa Cruz, CA). The various chemical inhibitors of the
signal transduction pathways including the MEK1/2 inhibitors (PD98059,
U0126), the phosphatidylinositol-3 (PI3) kinase inhibitors
(wortmannin, Ly294002), and the jak2 (AG490) and jak 3 inhibitors were
obtained from Calbiochem (La Jolla, CA). These inhibitors were used at
the following concentrations: PD98059, 20 µM; U0126, 10 µM);
wortmannin, 200 nM; Ly294002, 20 µM; jak2 inhibitor, 400 µM; and
jak 3 inhibitor, 200 µM.
Immunoprecipitation and Western blot analysis Whole-cell protein extracts for Western blots were obtained by briefly sonicating the cell pellets and then boiling the lysates for 5 minutes in sample lysis buffer containing 50 mM Tris (tris(hydroxymethyl)aminomethane; pH 6.8), 0.5% sodium dodecyl sulfate (SDS), 10% glycerol, and 1 mM dithiothreitol (DTT). For immunoprecipitation cells were lysed in lysis buffer containing 20 mM HEPES (N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid; pH 7.6), 100 mM KCl, 0.1 mM EDTA (ethylenediaminetetraacetic acid), 10% glycerol, 0.1% Nonidet P-40 (NP-40), 1 mM DTT, 2 µg/mL aprotinin, 1 µg/mL leupeptin, 1 µg/mL pepstatin A, 100 µM phenylmethylsulfonyl fluoride, 1.0 mM NaF, and 2 mM sodium vanadate. Lysates were precleared by incubation with normal serum IgG-bound protein A and G beads for 1 hour at 4°C, and then these precleared lysates were immunoprecipitated for 1 to 4 hours at 4°C using specific antibodies and protein A and G Sepharose beads (Sigma, St Louis, MO). Cell extracts (50 µg/lane) or immunocomplexes were separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE; 8%) and electroblotted using the Trans Blot Cell (Bio-Rad, Hercules, CA) onto Polyscreen polyvinylidene difluoride (PVDF) transfer membrane (NEN Life Sciences, Boston, MA). Immunoblotting was performed using the indicated primary antibodies (see above) with peroxidase-conjugated goat antirabbit or antimouse antibodies as secondary antibodies (Santa Cruz Biotechnology). Signals were detected with enhanced chemiluminescence using the Supersignal WestPico luminol/enhancer solution (Pierce, Rockford, IL).Transient transfections and reporter gene assays All cell lines were transiently transfected by electroporation as previously detailed.12 Electroporation conditions for the EML and the EML plus IL-3 cells were 270 V and 950 µF. The luciferase reporter is the RARE tk-LUC, which is based on the pBL2CAT2 vector19 with luciferase replacing CAT and which
harbors sequences corresponding to the RARE present in the  55 to 33 sequence of the RAR2 promoter (AGGGTTCACCGAAAGTTCACTCG;
the 5-base pair (bp) "spacer" of the DR5 is underlined) cloned
into the HindIII site of this vector. As an internal control
for transfection efficiency we used the PON838 plasmid, which is a
-galactosidase reporter driven by the -actin promoter.
Twenty-five micrograms of the RARE tk-LUC reporter and 20 µg of
the PON838 control plasmid were generally used for each transfection.
Luciferase activity was normalized to -galactosidase activity, and
relative luciferase activity was calculated as the ratio of this
normalized value divided by an average baseline value that was
arbitrarily set at 1.
EMSA Nuclear proteins were extracted as previously described.20 Oligonucleotide probes were synthesized and annealed to their complementary oligo by heating to 70°C. Probes were end labeled by T4 polynucleotide kinase using -32P-adenosine triphosphate (ATP) and purified on a 15%
nondenaturing polyacrylamide gel. The RARE probe corresponds to the
DR5 RARE in the RAR promoter21,22 and harbors two 6-bp
direct repeats separated by a 5-bp "spacer" 5'
AGGGTTCACCGAAAGTTCACTCG 3' (the direct repeats
are underlined). The corresponding mutated oligo, designated RARE
m4, harbors base pair changes in both direct repeats while maintaining
the consensus Stat-binding site: 5' AGatTTCACCGAAAtaagACTCG 3' (mutated
bases in lower case). The oligo harboring the consensus Stat5-binding
site (underlined) is 5' AGATTTCTAGGAATTCAATCC 3'. The chick
-actin promoter fragment is a 135-bp
EcoR1-HindIII restriction fragment that binds a
ubiquitously expressed nuclear protein.23 Nuclear extract
(15 µg) was incubated with radiolabeled probe (10 000 cpm), and
electrophoretic mobility shift assay (EMSA) performed as previously
detailed.12 In supershift assays nuclear extracts were
preincubated with 1 µg anti-Stat1, anti-Stat3, or anti-Stat5 antibody
for 10 minutes at 4°C before adding the labeled probe. In competition
assays nuclear extracts were preincubated with a 25- or 50-fold molar
excess of the designated unlabeled double-stranded oligo.
Assay of EML CFU-GM generation Following electroporation with the different expression vectors, EML cells were cultured for 6 to 8 hours in liquid suspension at 5 × 105/mL in media containing SCF alone, and the cells were then harvested and washed, and 5 × 104 viable cells were resuspended in 0.7 mL Iscove modified Dulbecco medium (IMDM) supplemented with 0.75 mL 2.2% methylcellulose (Methocult; Stem Cell Technologies, Vancouver, BC, Canada), 5% horse serum, and 10 ng/mL granulocyte-macrophage colony-stimulating factor (GM-CSF). Cultures were incubated in 12-well plates (0.7 mL/plate) and GM-CSF-dependent colonies (>20 cells) were counted following 5 to 7 days of incubation in a humidified incubator.
SCF activates the PI3 kinase and MAP kinase pathways in EML cells The in vitro proliferation of the multipotent EML cells is absolutely dependent on SCF (kit-ligand), and these cells undergo apoptosis beginning 8 to 12 hours after this cytokine is withdrawn.10 To determine which signal transduction pathways are involved in this SCF-mediated viability/proliferation of the EML cells, we suspended EML cells in SCF-free culture medium and then after 4 hours re-exposed these cells to SCF. Cell lysates obtained following this SCF stimulation were then subjected to Western blot analysis using antibodies detecting activated (phosphorylated) proteins involved in different signal transduction pathways. We observed enhanced phosphorylation of both Erk1/2 (Figure 1, rows 1 and 2) and Akt (Figure 1, rows 3 and 4) following SCF stimulation of the EML cells. We also detected phosphorylated Stat3 and p38 MAP kinase proteins in EML cells in both the presence and absence of SCF (Figure 1, rows 5 and 8). In contrast we observed little if any activation of JNK or of the Stat1 or Stat5 proteins in the EML cells in either the presence or absence of SCF (Figure 1, rows 6, 7, and 9). Thus, in EML cells SCF activates the PI3 kinase (Akt) and MAP kinase (Erk1/2) pathways, whereas Stat3 and p38 MAP kinase appear to be constitutively active in these cells. These observations suggest that SCF maintains EML cell survival/proliferation through activation of the PI3 kinase and MAP kinase pathways.
IL-3 activates the MAP kinase, PI3 kinase, and Jak/Stat pathways in EML cells We have previously observed that the addition of IL-3 to the SCF-dependent EML cells markedly stimulates CFU-GM production by these cells.10,12 To determine the specific signal transduction pathways involved in this IL-3-mediated granulocyte/monocyte commitment, we used phosphorylation-specific antibodies to probe Western blots of EML cell lysates obtained at periodic intervals following exposure of the cells to IL-3 (5 ng/mL). In these experiments the IL-3 was added to proliferating EML cells continuously exposed to SCF, and thus this experimental approach assessed the effect of an IL-3 signal superimposed on an SCF signal in the cultured EML cells. The addition of IL-3 enhanced the phosphorylation of both Erk1/2 and of Akt to a degree greater than that observed in the EML cells treated with SCF alone (Figure 2, rows 1-4). We also observed that IL-3 induced the rapid phosphorylation of multiple Stat proteins including Stat1, the higher molecular weight form of Stat3, as well as Stat5 with the phosphorylation of Stat5 appearing particularly prominent (Figure 2, rows 5-7). This phosphorylation occurred within 5 minutes following IL-3 stimulation, peaked before 30 minutes, and then decreased to basal levels after 4 hours (Figure 2). We observed no IL-3-induced activation of either the p38 MAP kinase or JNK pathways in the IL-3-treated cells (not shown). These observations indicate that the addition of IL-3 to the SCF-dependent EML cells activates multiple signal transduction pathways including the MAP kinase, PI3 kinase, and Jak/Stat pathways.
Jak2 activation is a critical mediator of Stat, MAP kinase, and PI3 kinase activation in the IL-3-treated EML cells Potentially there may be considerable "cross-talk" between different signal transduction pathways following growth factor/cytokine stimulation. For example, activation of the ras pathway can trigger PI3 kinase activation,24 and the activation of certain receptor-associated Jaks can activate the MAP kinase pathway.25 To determine whether any cross-talk occurs in the Jak/Stat, Erk1/2, and PI3 kinase pathways in the IL-3-induced EML cells, we assessed the effect of specific chemical inhibitors of these different signal transduction pathways. EML cells maintained in SCF were preincubated for 60 minutes with either MEK1/2 inhibitors (PD98059 and U0126), PI3 kinase inhibitors (wortmannin and LY294002), and Jak2 (AG490) or Jak3 inhibitors. Following IL-3 addition (15 minutes), cell lysates were obtained and subjected to Western blot analysis using phosphorylation-specific antibodies. As expected, the IL-3-mediated phosphorylation of the Erk1/2 proteins was blocked by the MEK1/2 inhibitors, and these compounds did not block the IL-3-induced phosphorylation of Akt or of Stat1, Stat3, and Stat5 (Figure 3A, lanes 3-6). Similarly the IL-3-mediated Akt phosphorylation was inhibited by the PI3 kinase inhibitors, but these same compounds exhibited no effect on inhibiting either Stat or Erk1/2 phosphorylation (Figure 3A, lanes 7-10). Thus, in the IL-3-treated EML cells there was little evidence that inhibiting the IL-3 induced activation of either the MAP kinase or PI3 kinase pathways influenced the activity of other signal transduction pathways.
In contrast, exposing the EML cells to the Jak chemical inhibitors clearly influenced multiple signal transduction pathways in the IL-3-treated EML cells. The Jak3 inhibitor inhibits the IL-3-induced Stat1 phosphorylation and partially inhibits the IL-3-induced Stat3 phosphorylation but does not inhibit the induction of Stat5 phosphorylation (Figure 3B, lanes 5 and 6). Curiously, this compound also inhibits Akt phosphorylation but enhances the IL-3-induced Erk1,2 phosphorylation (Figure 3B, columns 5 and 6). In contrast, the Jak2 inhibitor (AG490) exhibited the most "global" inhibitory effects, inhibiting not only Stat1, Stat3, and Stat5 activation in the IL-3-treated cells but also inhibiting the IL-3-induced Erk1,2 and PI3 kinase activation (Figure 3B, columns 3 and 4). This widespread effect of the Jak2 inhibitor in simultaneously inhibiting PI3 kinase, Erk1,2, and Jak/Stat activation strongly suggests that the critical "proximal" event in the IL-3-mediated induction of these multiple signal transduction pathways in EML cells is the activation of Jak2. The IL-3-induced enhancement of RAR reporter activity is mediated through Jak2 The IL-3-mediated commitment of the SCF-dependent EML cells to the granulocyte/monocyte lineage is associated with the enhanced activity of endogenous RARs in these cells.11 We used the above chemical inhibitors to determine which of the signal transduction pathways activated by IL-3 (Jak/Stat versus Erk1/2 versus PI3 kinase) mediates this enhanced RAR functional activity. IL-3 treatment of the SCF-dependent EML cells enhances the activity of a luciferase reporter construct driven by an RARE11 (Figure 4, column 1). We observed that the MEK1/2 inhibitors (PD98059 and U0126; Figure 4, columns 2 and 3) as well as the PI3 kinase inhibitors (wortmannin and LY294002; Figure 4, columns 4 and 5) did not exhibit any significant effect on this IL-3-mediated enhancement of the RARE luciferase reporter activity. In contrast the Jak2 inhibitor (AG490) markedly inhibited both the IL-3 and the IL-3 plus all-trans-retinoic acid (ATRA)-mediated enhancement of the RARE reporter activity (Figure 4, column 6), whereas the Jak3 inhibitor did not exhibit any inhibition and may actually enhance the RAR activity (Figure 4, column 7). Taken together these observations indicate that Jak2 activation is a critical mediator of the IL-3 enhancement of RAR activity, whereas the PI3 kinase and Erk1/2 pathways exhibit little involvement in this enhanced RAR activity.
Activated Stat5 is a critical mediator of the IL-3 induction of enhanced RAR reporter activity in EML cells The above observations indicate that the Jak2/Stat pathway is involved in enhancing the transcriptional activity of the RAR in the IL-3-treated EML cells, but which specific Stat might be the critical mediator of this enhanced activity? We observe that in the IL-3-treated EML cells, the Jak3 inhibitor inhibits Stat1 activation and partially inhibits Stat3 activation but does not inhibit Stat5 activation (Figure 3B, columns 5 and 6), and this compound also does not inhibit the IL-3-induced enhancement of RAR transcriptional activity (Figure 4, column 7). This suggests that Stat5 might be a critical mediator of the IL-3-induced enhancement of RAR activity. To directly test this hypothesis, we determined the effect of both a constitutively active as well as a dominant-negative Stat5 on RAR transcriptional activity in the cultured EML cells. We constructed an expression vector harboring a FLAG-tagged, constitutively active Stat5a mutant (Stat5aHS) in which histamine residue 299 and serine residue 711 were substituted with arginine and phenylalanine, respectively.16 EML cells were cotransfected with the RARE-luciferase reporter together with these different Stat5 expression vectors. Compared with the control (empty) vector as well as the vector harboring the wild-type Stat5a, we observed that transduction of the constitutively active Stat5a into EML cells significantly enhanced RAR transcriptional activity (Figure 5A, column 3).
We also determined the effect of a dominant-negative Stat5 construct on the IL-3-mediated enhancement of RAR activity in EML cells. In these studies we used a Stat5 expression vector harboring a COOH-terminus truncated Stat5a (Stat5aDN).15 Compared with the wild-type Stat5 vector, this dominant-negative Stat5a (Stat5aDN) significantly inhibits the IL-3-mediated enhancement of RAR activity (Figure 5B). This reduced reporter activity likely is secondary to inhibition of endogenous Stat5 because cotransfection of the wild-type Stat5 construct restores the reporter activity in a dose-dependent manner (Figure 5C). Together these observations using both constitutively active and dominant-negative Stat5 constructs indicate that the activated Stat5 is a critical mediator of the IL-3-induced enhancement of RAR activity in cultured EML cells. Activated Stat5 enhances CFU-GM generation in the SCF-dependent EML cells To determine whether Stat5 activation can directly enhance the commitment of the SCF-dependent EML cells to granulocyte/monocyte progenitors, we determined the effect of transducing the constitutively active Stat5 on CFU-GM generation in the cultured EML cells. We observed a significant increase in CFU-GMs in the EML cultures transduced with the activated Stat5 construct (Stat5aHS) compared with the same cells transduced with the control (empty) vector or with the vector harboring the wild-type Stat5a (Figure 6). Thus, in the multipotent SCF-dependent EML cells the activation of Stat5 directly enhances the production of granulocyte/macrophage progenitors (CFU-GMs).
A Stat5-binding site overlaps the RAR-binding site in the RARE
within the RAR RARE) is derived from the
RAR promoter (55 to 33) and is of particular interest because it
is likely involved in the autoregulation of RAR expression in
certain cells.21,22 This RARE is a prototype DR5 with a
6-bp repeat separated by a 5-bp "spacer" sequence. Initially we
observed that either an oligo harboring a consensus Stat5-binding site
or an anti-Stat5 antibody significantly reduced the DNA-binding
activity of RAR/RXR to this RARE (data not shown). Close inspection of
this sequence reveals a consensus "TTC(N)2-4GAA" Stat-binding site, "TTCACCGAA" that directly overlaps with this DR5
(Figure 7A). To determine whether this
consensus Stat-binding sequence observed within the RARE is indeed a
Stat-binding site, we performed an EMSA using nuclear extracts from
Stat5-transfected cells incubated with the radiolabeled RARE
oligonucleotide. We observed multiple retarded bands using this oligo
likely reflecting the multiple nuclear proteins capable of binding to
this sequence (Figure 7B, lane 1). Importantly, the slowest migrating
band using the RARE oligonucleotide migrates at a similar mobility
with a single band observed using an oligo harboring a consensus
Stat5-binding site alone (Figure 7B, lane 3), and supershift assays
with these different oligos using Stat5 antibodies also generate bands
of similar mobility (Figure 7B, compare lanes 2 and 4). These EMSAs suggest that the RARE, in addition to harboring RAR-binding sites, might also harbor sites capable of binding Stat5.
To confirm a Stat5 interaction with the consensus Stat sequences within
the An in vivo interaction between Stat5 and RARs is IL-3 dependent Our observation that theRARE oligo harbors overlapping Stat5-
and RAR-binding sites (Figure 7) prompted us to perform a coimmunoprecipitation analysis to determine whether Stat5 might interact with the RAR-RXR heterodimer. We have previously encountered difficulty with coimmunoprecipitation studies in EML cells likely secondary to relatively high levels of endogenous protease activity in
these particular cells. Therefore, we used the pre-B-cell BaF3 cell
line, which proliferates in the presence of exogenous
IL-3,13 harbors an activated Stat5,28 and
also exhibits Stat5-mediated enhancement of RAR activity (data not
shown). We observe that an anti-Stat5 antibody coimmunoprecipitates
both RAR and RXR, whereas control IgG does not (Figure
8A). Importantly this
coimmunoprecipitation of Stat5 and RAR/RXR occurs only after the cells
are exposed to IL-3 (Figure 8B). Similarly, whereas an anti-RXR
antibody coimmunoprecipitates both itself and its RAR partner in
IL-3-deprived cells, coimmunoprecipitation of Stat5 with this antibody
occurs only in cells treated with IL-3 (Figure 8C). These observations
suggest that in at least some cell types there is an in vivo
association of Stat5 with components of the RAR-RXR heterodimer but
that this association requires the IL-3-mediated activation of
Stat5.
The IL-3-mediated enhancement of promoter harbors a
Stat5-binding site that overlaps with the DR5 (Figure 7A) suggests that
the cytokine-activated Stat5 might act in an "immediate early" fashion to directly bind to and activate this promoter element and
perhaps displace RAR/RXR binding to the DR5. However, a number of our
observations suggest that this is not the case. First, although Stat5
activation occurs very quickly following IL-3 treatment of EML cells
(Figure 2, row 7), we observe that the IL-3-induced enhancement of RAR
activity requires relatively prolonged exposure to IL-3 (12-24 hours;
Figure 9A). Moreover, we note that IL-3 activates an RA-responsive GAL-RAR hybrid on a reporter harboring GAL binding sites (p(UAS)5-LUC; Figure 9B), an experimental
model that does not involve any Stat5-binding sites. In addition, we observe in gel shift assays using BaF3 nuclear extracts that IL-3 treatment appears to enhance binding of RAR/RXR to the RARE (Figure 9C). Finally, we note that the RARE reporter activity is markedly enhanced by ATRA in the IL-3-stimulated EML cells (Figure 4)
indicating that the RARs are playing an active role in the
IL-3-induced enhancement of this promoter (Figure 4). Taken together
these observations suggest that the activation of the RARE reporter
that we have observed in the IL-3-treated cells likely does not result
from direct Stat5 activation of this promoter element but rather is somehow mediated through enhanced activity of the RARs.
Little is known about how specific cytokines might regulate the activity of hematopoietic transcription factors because few experimental models are available to directly approach this question. EML cells, which were derived from normal mouse bone marrow,10 provide a unique in vitro model to address this question because under the influence of SCF these cells retain an immature, multipotent phenotype but can commit to different hematopoietic lineages with the addition of particular cytokines including IL-3, GM-CSF, erythropoietin, and IL-7.10 RARs are important regulators of myeloid differentiation, and we have recently observed that IL-3 enhances the transcriptional activity of RARs in a number of different in vitro models of myeloid differentiation including EML.11 Thus, we were interested in defining the particular signal transduction pathways that mediate this enhanced RAR transcriptional activity in the IL-3-treated EML cells. We observe that EML exposure to SCF alone is associated with activation
of the PI3 kinase and MAP kinase pathways (Figure 1). Similarly, the
addition of IL-3 to the SCF-dependent EML cells also activates the PI3
kinase and MAP kinase pathways, but, in addition, the Jak/Stat pathway
is activated by IL-3 (Figure 2). Using a battery of specific chemical
inhibitors of these different pathways together with constitutively
active and dominant-negative constructs, we have identified Stat5 as
the critical regulator of the enhanced RAR transcriptional activity
that we observe in the IL-3-treated EML cells. This Stat5-mediated
enhanced RAR What is the molecular basis for the Stat5-mediated enhancement of RAR
transcriptional activity in the IL-3-treated EML cells? The EML cells
express a truncated dominant-negative RAR In addition to such overlapping binding sites, our observation that Stat5 and RARs display an in vivo association that is IL-3 dependent (Figure 8) provides further evidence of a close physical and functional interaction between Stat and RAR family members. Current models of RAR activation suggest that the addition of ligand (ATRA) results in a distinct conformational change in RXR/RAR leading to the release of corepressors and the recruitment of transcriptional coactivators.31 It is possible that activated Stat5 might directly bind to RAR/RXR and trigger a conformational change in the heterodimer that mimics this action of the normal ligand. Alternatively, it has been noted that Stat family members themselves can recruit transcriptional coactivators such as CBP,32 and Stat5 might enhance RAR/RXR activity by recruiting additional coactivators to the RARE. Such models are currently quite speculative, and indeed the molecular components making up the Stat5/RAR complex in the IL-3-treated cells are presently unknown. Nevertheless, given the widespread expression and activity of the Stat and RAR families of transcription factors, the precise nature of this Stat5/RAR interaction and its functional consequences are questions worthy of further study. In summary, we observe that the IL-3-mediated enhancement of RAR activity that is associated with the commitment of the multipotent, SCF-dependent EML cells to granulocyte/monocyte progenitors is associated with the activation of multiple different signal transduction pathways. However, the Jak2/Stat pathway and in particular the activation of Stat5 appears to play the critical role in enhancing both RAR transcriptional activity and CFU-GM production in the SCF-dependent EML cells. Stat5 and RARs associate in vivo in an IL-3-dependent manner suggesting specific physical and functional interactions that likely occur between these transcription factors in certain cytokine-treated cells.
We thank Jim Ihle for the Stat5 constructs, LeMoyne Mueller and Jutta Fero for excellent technical assistance, Ted Gooley for calculating the P values, and Tony Blau for the BaF3 cells.
Submitted January 2, 2002; accepted June 4, 2002.
Prepublished online as Blood First Edition Paper, June 28, 2002; DOI 10.1182/blood-2001-12-0374.
Supported by National Institutes of Health grants CA58292 (S.J.C.) and HL54881.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Steven J. Collins, Human Biology Division, Fred Hutchinson Cancer Research Center, 1100 Fairview Ave N, Seattle, WA 98109; e-mail: scollins{at}fhcrc.org.
1. Metcalf D. Cellular hematopoiesis in the twentieth century. Semin Hematol. 1999;36:5-12[Medline] [Order article via Infotrieve]. 2. Orkin SH. Diversification of haematopoietic stem cells to specific lineages. Nat Rev Genet. 2000;1:57-64[CrossRef][Medline] [Order article via Infotrieve]. 3. Douer D, Ramezani L, Parker J, Levine AM. All-trans-retinoic acid effects the growth, differentiation and apoptosis of normal human myeloid progenitors derived from purified CD34+ bone marrow cells. Leukemia. 2000;14:874-881[CrossRef][Medline] [Order article via Infotrieve].
4.
Labrecque J, Allan D, Chambon P, Iscove NN, Lohnes D, Hoang T.
Impaired granulocytic differentiation in vitro in hematopoietic cells lacking retinoic acid receptors alpha1 and gamma.
Blood.
1998;92:607-615 5. He L-Z, Guidez F, Tribioli C, et al. Distinct interactions of PML-RARa and PLZF-RARa with co-repressors determine differential responses to RA in APL. Nat Genet. 1998;18:126-135[CrossRef][Medline] [Order article via Infotrieve]. 6. Lin R, Nagy L, Inoue S, Shao W, Miller W, Evans R. Role of the histone deacetylase complex in acute promyelocytic leukemia. Nature. 1998;391:811-814[CrossRef][Medline] [Order article via Infotrieve]. 7. Guidez F, Ivins S, Zhu J, Soderstrom M, Waxman S, Zelent A. Reduced retinoic acid-sensitivities of nuclear receptor corepressor binding to PML- and PLZF-RARalpha underlie molecular pathogenesis and treatment of acute promyelocytic leukemia. Blood. 1998;91:2634-2642[Medline] [Order article via Infotrieve]. 8. Grignani F, De Matteis S, Nervi C, et al. Fusion proteins of the retinoic acid receptor-a recruit histone deacetylase in promyelocytic leukemia. Nature. 1998;319:815-818.
9.
Tsai S, Collins S.
A dominant negative retinoic acid receptor blocks neutrophil differentiation at the promyelocyte stage.
Proc Natl Acad Sci U S A.
1993;90:7153-7157
10.
Tsai S, Bartelmez S, Sitnicka E, Collins S.
Lymphohematopoietic progenitors immortalized by a retroviral vector harboring a dominant negative retinoic acid receptor can recapitulate lymphoid, myeloid and erythroid development.
Genes Dev.
1994;8:2831-2842
11.
Johnson BS, Mueller L, Si J, Collins SJ.
The cytokines IL-3 and GM-CSF regulate the transcriptional activity of retinoic acid receptors in different in vitro models of myeloid differentiation.
Blood.
2002;99:746-753
12.
Johnson B, Chandraratna R, Heyman R, Allegretto E, Mueller L, Collins S.
RXR agonist-induced activation of dominant negative RXR-RAR*403 heterodimers is developmentally regulated during myeloid differentiation.
Mol Cell Biol.
1999;19:3372-3382 13. Palacios R, Steinmetz M. Il-3-dependent mouse clones that express B-220 surface antigen, contain Ig genes in germ-line configuration, and generate B lymphocytes in vivo. Cell. 1985;41:727-734[CrossRef][Medline] [Order article via Infotrieve].
14.
Robertson KA, Emami B, Mueller L, Collins SJ.
Multiple members of the retinoic acid receptor family are capable of mediating the granulocytic differentiation of HL-60 cells.
Mol Cell Biol.
1992;12:3743-3749 15. Wang D, Stravopodis D, Teglund S, Kitazawa J, Ihle JN. Naturally occurring dominant negative variants of Stat5. Mol Cell Biol. 1996;16:6141-6148[Abstract].
16.
Onishi M, Nosaka T, Misawa K, et al.
Identification and characterization of a constitutively active STAT5 mutant that promotes cell proliferation.
Mol Cell Biol.
1998;18:3871-3879 17. Giguere V, Ong ES, Segui P, Evans RM. Identification of a receptor for the morphogen retinoic acid. Nature. 1987;330:624-629[CrossRef][Medline] [Order article via Infotrieve]. 18. Sadowski I, Ptashne M. A vector for expressing GAL4 (1-147) fusions in mammalian cells. Nucleic Acids Res. 1989;17:753-754.
19.
Luckow B, Schutz G.
CAT constructions with multiple unique restriction sites for the functional analysis of eukaryotic promoters and regulatory elements.
Nucleic Acids Res.
1987;15:5490
20.
Dignam JD, Lebovitz RM, Roeder RG.
Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei.
Nucleic Acids Res.
1983;11:1475-1489 21. de The H, Vivanco-Ruiz MM, Tiollais P, Stunnenberg H, Dejean A. Identification of a retinoic acid responsive element in the retinoic acid receptor beta gene. Nature. 1990;343:177-180[CrossRef][Medline] [Order article via Infotrieve].
22.
Sucov HM, Murakami KK, Evans RM.
Characterization of an autoregulated response element in the mouse retinoic acid receptor type beta gene.
Proc Natl Acad Sci U S A.
1990;87:5392-5396
23.
Walsh K, Schimmel P.
Two nuclear factors compete for the skeletal muscle actin promoter.
J Biol Chem.
1987;262:9429-9432 24. Rodriguez-Viciana P, Warne PH, Khwaja A, et al. Role of phosphoinositide 3-OH kinase in cell transformation and control of the actin cytoskeleton by Ras. Cell. 1997;89:457-467[CrossRef][Medline] [Order article via Infotrieve]. 25. Stancato LF, Sakatsume M, David M, et al. Beta interferon and oncostatin M activate Raf-1 and mitogen-activated protein kinase through a JAK1-dependent pathway. Mol Cell Biol. 1997;17:3833-3840[Abstract].
26.
Darnell JE Jr.
STATs and gene regulation.
Science.
1997;277:1630-1635
27.
Ehret GB, Reichenbach P, Schindler U, et al.
DNA binding specificity of different STAT proteins. Comparison of in vitro specificity with natural target sites.
J Biol Chem.
2001;276:6675-6688 28. Mui AL, Wakao H, Kinoshita T, Kitamura T, Miyajima A. Suppression of interleukin-3-induced gene expression by a C-terminal truncated Stat5: role of Stat5 in proliferation. EMBO J. 1996;15:2425-2433[Medline] [Order article via Infotrieve].
29.
Leroy P, Nakshatri H, Chambon P.
Mouse retinoic acid receptor alpha 2 isoform is transcribed from a promoter that contains a retinoic acid response element.
Proc Natl Acad Sci U S A.
1991;88:10138-10142
30.
Langston A, Thompson J, Gudas L.
Retinoic acid-responsive enhancers located 3' of the Hox A and Hox B homeobox gene clusters.
J Biol Chem.
1997;272:2167-2175
31.
Glass CK, Rosenfeld MG.
The coregulator exchange in transcriptional functions of nuclear receptors.
Genes Dev.
2000;14:121-141
32.
Paulson M, Pisharody S, Pan L, Guadagno S, Mui AL, Levy DE.
Stat protein transactivation domains recruit p300/CBP through widely divergent sequences.
J Biol Chem.
1999;274:25343-25349
© 2002 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  K. M. Makkonen, S. Pasonen-Seppanen, K. Torronen, M. I. Tammi, and C. Carlberg Regulation of the Hyaluronan Synthase 2 Gene by Convergence in Cyclic AMP Response Element-binding Protein and Retinoid Acid Receptor Signaling J. Biol. Chem., July 3, 2009; 284(27): 18270 - 18281. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Yang, D. Qiao, K. Meyer, and A. Friedl Signal Transducers and Activators of Transcription Mediate Fibroblast Growth Factor-Induced Vascular Endothelial Morphogenesis Cancer Res., February 15, 2009; 69(4): 1668 - 1677. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Spiegl, S. Didichenko, P. McCaffery, H. Langen, and C. A. Dahinden Human basophils activated by mast cell-derived IL-3 express retinaldehyde dehydrogenase-II and produce the immunoregulatory mediator retinoic acid Blood, November 1, 2008; 112(9): 3762 - 3771. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Si and S. J. Collins Activated Ca2+/Calmodulin-Dependent Protein Kinase II{gamma} Is a Critical Regulator of Myeloid Leukemia Cell Proliferation Cancer Res., May 15, 2008; 68(10): 3733 - 3742. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. P. Chute, G. G. Muramoto, J. Whitesides, M. Colvin, R. Safi, N. J. Chao, and D. P. McDonnell Inhibition of aldehyde dehydrogenase and retinoid signaling induces the expansion of human hematopoietic stem cells PNAS, August 1, 2006; 103(31): 11707 - 11712. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Wang, P. Paradis, A. Aries, H. Komati, C. Lefebvre, H. Wang, and M. Nemer Convergence of Protein Kinase C and JAK-STAT Signaling on Transcription Factor GATA-4 Mol. Cell. Biol., November 15, 2005; 25(22): 9829 - 9844. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. D. Licht and A. Zelent Retinoid and growth factor receptor signaling in APL Blood, February 15, 2005; 105(4): 1381 - 1382. [Full Text] [PDF]
|
|
|
|
|
|
A. Glasow, N. Prodromou, K. Xu, M. von Lindern, and A. Zelent Retinoids and myelomonocytic growth factors cooperatively activate RARA and induce human myeloid leukemia cell differentiation via MAP kinase pathways Blood, January 1, 2005; 105(1): 341 - 349. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2002 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
