Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schuch, G.
Right arrow Articles by Soker, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schuch, G.
Right arrow Articles by Soker, S.
Related Collections
Right arrow Hemostasis, Thrombosis, and Vascular Biology
Right arrow Neoplasia
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, 15 December 2002, Vol. 100, No. 13, pp. 4622-4628

NEOPLASIA

In vivo administration of vascular endothelial growth factor (VEGF) and its antagonist, soluble neuropilin-1, predicts a role of VEGF in the progression of acute myeloid leukemia in vivo

Gunter Schuch, Marcelle Machluf, Georg Bartsch Jr, Masashi Nomi, Henri Richard, Anthony Atala, and Shay Soker

From the Department of Urology, Laboratory for Cellular Therapeutics, Children's Hospital, Boston, MA.


    Abstract
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Recent findings implied that the progression of hematologic malignancies, like that of solid tumors, is dependent on neovascularization. Recent studies on patients with acute myeloid leukemia (AML) showed increased levels of leukocyte-associated vascular endothelial growth factor (VEGF) and neovascularization of the bone marrow. Murine (32D, M1) and human (HEL, U937, and UKE-1) leukemic cell lines and freshly isolated leukemic cells were analyzed for the expression of VEGF and VEGF receptor mRNA. The expression of VEGF and VEGF receptors KDR and neuropilin-1 (NRP-1) was detected in these cells. In a murine chloroma model, delivery of VEGF165 using microencapsulation technology resulted in enhanced tumor growth and vascularization, whereas treatment with a VEGF antagonist soluble NRP-1 (sNRP-1) inhibited tumor angiogenesis and growth. In a systemic leukemia model, survival of mice injected with adenovirus (Ad) encoding for Fc-sNRP-1 (sNRP-1 dimer) was significantly prolonged as compared with mice injected with Ad-LacZ. Further analyses showed a reduction in circulating leukemic cells and infiltration of liver and spleen as well as bone marrow neovascularization and cellularity. Taken together, these results demonstrate that angiogenic factors such as VEGF promote AML progression in vivo. The use of VEGF antagonists as an antiangiogenesis approach offers a potential treatment for AML. Finally, our novel in vivo drug delivery model may be useful for testing the activities of other peptide antiangiogenic factors. (Blood. 2002;100:4622-4628)

© 2002 by The American Society of Hematology.

    Introduction
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

In recent years it has become evident that solid tumors beyond a given volume are dependent on the supply of oxygen and nutrients from the vascular system.1 Therefore, the vascular network has to grow concomitantly with the tumor, similar to embryonic development. The process of growing capillaries from pre-existing vessels has been termed angiogenesis.2 The importance of angiogenesis in tumor growth has been demonstrated in numerous studies.3-5 Several factors are being produced from tumor cells in hypoxic areas in order to enhance vascular formation. Among those, vascular endothelial growth factor (VEGF) plays a central role in promoting migration, proliferation, and differentiation of endothelial cells.6 There are 5 different VEGF subgroups which have been characterized, with VEGF-A being the most potent angiogenic factor.7 VEGF-A (hereafter VEGF) is a secreted homodimeric protein with various isoforms, consisting of 121, 165, and 189 amino acids, that are generated by alternative splicing.8 There are 4 receptors for VEGF which have been identified: Flt-1 (VEGFR-1), Flk-1/KDR (VEGFR-2), Flt-4 (VEGFR-3), and neuropilin-1 (NRP-1). The first 3 have a typical cytoplasmic tyrosine kinase domain, whereas NRP-1 has a short cytoplasmatic domain lacking enzymatic activity. NRP-1 binds specifically the VEGF165 isoform and enhances its binding to VEGFR-1, suggesting that it functions as a coreceptor.9

Expression levels of VEGF and its receptors as well as microvessel density as indicators of angiogenesis are accepted parameters in solid tumors and have been shown to correlate with clinical outcome in various cancers.10,11 Perez-Atayde et al12 were the first to describe increased microvessel density in the bone marrow of children with acute lymphatic leukemia (ALL) as an indicator of enhanced angiogenesis in hematologic malignancy. Fiedler et al13 demonstrated that acute myeloid leukemia (AML) blasts not only express VEGF but also its receptors. Endothelial cells responded to conditioned media of myeloblasts with increased production of hematopoetic growth factors, implying a paracrine loop. Autocrine stimulation of leukemic cells expressing KDR by VEGF in vitro was demonstrated by Dias et al in a recent report.14 They also showed inhibition of leukemia progression in vivo with KDR-blocking antibodies.14

We studied the role of VEGF in the progression of AML using murine and human leukemic cell lines that express VEGF and VEGF receptors. A model of chloroma, using M1 cells, was established in order to test the in vivo effects of VEGF. Delivery of VEGF165 and a VEGF antagonist, soluble NRP-1, was achieved using microencapsulation of cells overexpressing the recombinant proteins. VEGF supplementation significantly enhanced M1 tumor growth and tumor weights, whereas in sNRP-1-treated animals tumors grew slower, as compared with the control group. In a systemic leukemia model, administration of sNRP-1 inhibited AML progression, as determined by analyses of peripheral blood and bone marrow and liver infiltration, and resulted in prolonged survival. Our results demonstrate that angiogenic factors such as VEGF promote AML progression in vivo and that a soluble form of NRP-1 might be used for antiangiogenesis therapy.


    Materials and methods
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Cell culture

Leukemic cell lines M1, HEL, UKE-1,15 and U937 and WEHI (ATCC, Rockville, MD) were cultured in RPMI with 10% fetal bovine serum (FBS), penicillin (100 U/mL), and streptomycin (100 µg/mL). Cells of the murine line 32D (ATCC) were cultured in Dulbecco modified Eagle medium (DMEM) with 10% FBS and addition of 1% WEHI-conditioned medium. Normal murine mammary gland (NMuMG) epithelial cells were cultured in DMEM with high glucose, 10% FBS, and penicillin/streptomycin. Leukemic cells of patients with newly diagnosed AML were isolated from peripheral blood using Ficoll-Histopaque (Pharmacia, Uppsala, Sweden).

Reverse transcriptase-polymerase chain reaction

RNA from clinical specimens and cultured cells was isolated using the RNAzol reagent according to the manufacturer's protocol (Tel-Test, Friendswood, TX). RNA (1 µg) was processed for cDNA synthesis using Superscript II reverse transcriptase (RT) with random hexamers (Life Technologies, Rockville, MD). The cDNA (1 µl) was used for polymerase chain reaction (PCR) in a final volume of 30 µL with 200 nM dNTP, 15 pM of each primer, 0.3 U Taq DNA polymerase, and reaction buffer (Boehringer, Mannheim, Germany), in a PTC-100 cycler (MJ-Research, Watertown, MA). All primers were obtained from Life Technologies. The primers used for human VEGF (5' ATGAACTTTCTGCTGTCTTGG and 3' TCACCGCCTCGGCTTGTCACA, 30 cycles, annealing at 60°C) amplified fragments of 450 bp, 570 bp, and 650 bp for the 121, 165, and 189 isoforms of VEGF, respectively. Glyceraldehyde phosphate dehydrogenase (GAPDH) primers (5' GTCTTCACCACCATGGAG, 3' CCACCCTGTTGCTGTAGC, 28 cycles at 60°C) amplified a fragment of 673 bp. Murine Flk-1 primer (5' GCATCACCAGCAGCCAGAG, 3' GCAACACACCGAAAGACCAC, 35 cycles at 60°C) and human KDR primer (5' TTACAGATCTCCATTTATTGC, 3'TTCATCTCACTCCCAGACT, 35 cycles at 60°C) yielded fragments of 390 bp and 479 bp, respectively. Murine (5' GGTTTTAACTGCGAGTTTG, 3' ATCATCCACAGCAATTCCACC, 30 cycles at 55°C) and human (5' TTTCGCAACGATAAATGTGGCGAT, 3' TATCACTCCACTAGGTGTTG, 30 cycles at 55°C) NRP-1 were detected as bands of 452 bp and 409 bp. PCR products were resolved on a 2% agarose gel and stained with ethidium bromide. The amplified DNA was visualized under UV light and images were obtained by the "Eagle Eye" digital camera (Stratagene, La Jolla, CA).

KDR phosphorylation studies

KDR phosphorylation was assessed as previously described.16 Leukemic (M1, HEL, U937), porcine aortic endothelial (PAE), and PAE-KDR17 cells were starved for 12 hours and then incubated in serum-free medium with 25 ng/mL VEGF for 30 minutes at 4°C. The cells were shifted to 37°C for 7 minutes and then lyzed. Cellular proteins were absorbed on Con A Sepharose, separated by 6% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and blotted onto a membrane, which was probed with antiphosphotyrosine-specific antibodies (4G-10, Upstate Biotechnology, Lake Placid, NY).

In vitro proliferation studies

After 12 hours incubation in serum-free medium, leukemic cells (M1, HEL) were counted and incubated in 48-well dishes (5000 cells per well) in serum-free medium in the presence or absence of VEGF (10 ng/mL). Cell numbers were obtained after 24 hours and 48 hours using a Coulter cell counter.

Transfection and encapsulation of cells releasing VEGF165 and sNRP-1

VEGF165 cDNA and the encoding sequence for the extracellular portion of human NRP-1 (amino acids 1-853) were cloned into the pcDNA3.1 expression vector (Invitrogen). NMuMG cells were transfected with the expression vector using the lipofectamine reagent (Life Technologies). Stable clones expressing large amounts of VEGF165 and sNRP-1 were isolated. NmuMG, NMuMG/VEGF, and NMuMG/sNRP-1 cells were trypsinyzed and resuspended in 1.2% sodium alginate. The cell suspension was passed through a nozzle and the resulting capsules were collected in 1.5% mM CaCl2/13 mM HEPES (N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid) buffer and subsequently coated with poly-L-lysine, as described.18

Construction of adenovirus vectors

Adenovirus (Ad) vectors encoding for VEGF and beta -galactozidase (LacZ) were kindly provided by the Harvard Gene Therapy Initiative core facility. Ad-Fc-sNRP-1 (a dimeric form of sNRP-1) was constructed as previously described.16

Murine chloroma experiments and immunohistochemistry

M1 cells (2 × 106 per mouse) were injected subcutaneously to severe combined immunodeficiency (SCID) mice. After 72 hours, encapsulated NMuMG, NMuMG/VEGF, and NMuMG/sNRP-1 cells (5 × 105 cells per mouse) were injected near the leukemic cells. Mice (10 per group) were followed for tumor growth and tumor size was measured. After 21 days tumors were harvested and their weight was measured. Tumor tissues were fixed in Histochoice (Amresco, Solon, OH) for 24 hours, processed, and embedded in paraffin. Tissue sections were stained with hematoxylin and eosin (H&E) or incubated overnight with monoclonal anti-mouse CD31 (1:100 dilution; BD Pharmingen, San Diego, CA) and polyclonal anti-human VEGF (1:250 dilution; R&D Systems, Minneapolis, MN) antibodies. The primary antibodies were detected using ABC and DAB substrate kits (Vector Laboratories, Burlingame, CA) and the sections were counterstained with "Gills" hematoxylin. Microvessel density (MVD) was determined by the counting of stained capillary structures in 10 high-power fields (HPF) of each tumor.

Systemic leukemia model

M1 cells (2 × 106 cells per mouse) were injected intravenously into SCID mice. After 7 days, adenoviral vectors (Ad) encoding for Fc-sNRP-1, VEGF, and LacZ were injected intravenously (Ad-Fc-sNRP-1 and Ad-LacZ, 2 × 108 pfu/mouse; Ad-VEGF, 5 × 107 pfu/mouse) and mice (10 mice per group) were followed for survival. On day 28, 2 mice from each group were analyzed by blood smears and histology of liver, spleen, and bones. Small pieces of the liver were used for a functional staining of LacZ, as previously described.19 Femoral bones were fixed in 3.7% formaldehyde, decalcified in 0.5 M EDTA (ethylenediaminetetraacetic acid), pH 8.0, and embedded in paraffin. Bone sections were stained with H&E and immunostained with monoclonal anti-mouse CD31 antibodies, as described for the chloroma model.


    Results
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Expression of VEGF and VEGF receptors by leukemic cells

Leukemic cells were analyzed for expression of VEGF, VEGFR-2 (human KDR and murine Flk-1), and neuropilin-1 (NRP-1) using RT-PCR. The VEGF primers were designed to amplify all splicing forms of VEGF, and species-specific primers were used for KDR, Flk-1, and NRP-1. In order to ensure equal mRNA levels, the expression of GAPDH mRNA was monitored. Most cell lines (Figure 1A) and all of the freshly isolated human leukemic cells (Figure 1B) expressed VEGF mRNA with comparable levels of VEGF121 and VEGF165 isoforms. Expression of KDR was found in M1 and UKE-1 lines and in all of the freshly isolated human leukemic cells. Low levels were found in HEL cells. NRP-1 was expressed by M1 HEL and U937 lines and in all of the freshly isolated human leukemic cells. This result indicates that VEGF and its receptors KDR and NRP-1 are expressed by murine and human AML blasts but not in basophilic cells such as 32D.


View larger version (41K):
[in this window]
[in a new window]
 
Figure 1. Expression of VEGF and VEGF receptors in leukemic cells. RNA was isolated from leukemic cell lines grown in culture (A) and freshly isolated human leukemia cells (B) as described in "Materials and methods." RT-PCR was performed on the RNA, using primers corresponding for human VEGF, KDR, NRP-1, and GAPDH cDNA sequences and murine Flk-1 (KDR) and NRP-1 cDNA sequences, as indicated. PCR products were resolved on a 2% agarose gel, stained with ethidium bromide, and visualized under UV light.

VEGF autocrine stimulation of leukemic cells

Since many leukemic cell lines express VEGF and VEGF receptors, we tested a possible VEGF autocrine stimulation in these cells. First, VEGF receptor phosphorylation was evaluated (Figure 2A). PAE, PAE-KDR, and leukemic cell lines were transiently incubated with VEGF in order to induce receptor phosphorylation. VEGF induced abundant KDR phosphorylation in PAE-KDR, as previously shown.16 In contrast, no phosphorylated proteins corresponding to the size of the VEGF receptors could be detected in leukemic cell lines that do not express KDR (U937) or that express low levels of KDR (M1). Interestingly, HEL cells that express low levels of KDR showed an unchanged KDR phosphorylation, suggesting maximal autocrine stimulation by endogenous VEGF in these cells. Subsequently, we evaluated VEGF-induced proliferation of M1 and HEL cells, which showed different KDR phosphorylation patterns. M1 and HEL cells were starved for 12 hours and incubated in the presence of 10 ng/mL VEGF165 in serum-free medium. Cell numbers were obtained after 24 hours and 48 hours (Figure 2B). Although HEL showed a higher proliferation rate than M1, exogenously added VEGF did not induce an increase in cell numbers compared with untreated cells. These results suggest that M1 and HEL cells do not proliferate in response to VEGF and support the previous findings that VEGF treatment did not induce KDR phosphorylation in M1 cells and did not increase the phosphorylation of KDR in HEL cells over a constitutive level.


View larger version (37K):
[in this window]
[in a new window]
 
Figure 2. The leukemic cell lines M1 and HEL do not respond to exogenous VEGF. (A) KDR phosphorylation. PAE, PAE-KDR, M1, HEL, and U937 were incubated in the presence (+) or absence (-) of VEGF165 (20 ng/mL) for 30 minutes on ice and then shifted to 37°C for 7 minutes, as described in "Materials and methods." Cells were lysed and proteins were absorbed on ConA Sepharose and resolved by a 6% SDS-PAGE. Proteins were blotted onto polyvinylidenefluoride (PVDF) membrane, which was subsequently probed with antiphosphotyrosine antibodies. Phosphorylated KDR (Phos KDR) was detected as a band with a molecular weight of approximately 220 kd. (B) Cell proliferation. M1 and HEL cells were incubated in the presence (VEGF) or the absence (control) of VEGF (10 ng/mL) in serum-free medium, as described in "Materials and methods." Cell numbers were obtained after 24 and 48 hours. Cell numbers represent the average of 3 individual wells.

Effect of VEGF and the VEGF antagonist, sNRP-1, on chloroma growth in vivo

We have established an in vivo model of M1 cells in SCID mice. Upon subcutaneous injection, M1 cells (2 × 106 per mouse) form solid tumors, that is, chloromas. This model allows quantitative tumor volume measurements for the study of tumor growth in vivo. For constant delivery of VEGF and the VEGF antagonist, sNRP-1, we used the cell encapsulation technique,18 with NMuMG/VEGF and NMuMG/sNRP-1 cells that have been engineered to produce high levels of recombinant VEGF and sNRP-1, respectively. The encapsulated cells (5 × 105 per mouse) were injected next to the M1 cell injection site 3 days later, and the mice were followed for tumor growth for an additional 20 days. Mice injected with VEGF-producing cells showed an accelerated tumor growth compared with mice injected with control NMuMG cells, with tumor volumes of 1774 ± 633 mm3 and 646 ± 241 mm3 after 20 days, respectively (Figure 3A). In contrast, mice injected with sNRP-1-producing cells developed smaller tumors (278 ± 187 mm3). At the end of the experiment, tumors were harvested and weighed (Figure 3B). A significant weight difference was noted between the groups, with weights of 0.82 ± 0.22 g, 1.735 ± 0.48 g, and 0.43 ± 0.2 g for control, VEGF, and sNRP-1, respectively (VEGF vs control, P < .002; sNRP-1 vs control, P < .03).


View larger version (11K):
[in this window]
[in a new window]
 
Figure 3. The effects of VEGF and sNRP-1 supplementation on chloroma growth in vivo. (A) Tumor volume curves. M1 cells (2 × 106 per mouse) were injected subcutaneously into SCID mice. NMuMG-encapsulated (open circle ), NMuMG/VEGF-encapsulated (), and NMuMG/sNRP-1-encapsulated (black-triangle) cells (5 × 105 cells per mouse) were injected at the site of M1 cell injection, 72 hours later. The mice (10 per group) were followed for tumor volumes at the indicated times. (B) Final tumor weights. Tumors were harvested 21 days after M1 cell injection and weighed. The average weight and standard deviations were calculated for NMuMG (control), NMuMG/VEGF (VEGF), and NMuMG/sNRP-1 (sNRP-1) groups.

The tumors and surrounding tissue were retrieved for histologic analysis. Immunostaining for human VEGF revealed a concentric staining pattern around the capsules with high immunoreactivity at their borders (Figure 4A). Several VEGF-producing cells could be detected within the capsules and extracellular matrix-bound VEGF in the tissues surrounding the capsules. Tumor specimens were further analyzed by H&E staining, revealing healthy and packed cells in control and VEGF-treated tumors but large necrotic areas in the sNRP-1-injected group (Figure 4B, top panels). Staining of tumor sections with anti-CD31 antibodies (Figure 4B, bottom panels) revealed a dense capillary network in tumors retrieved from mice that were injected with VEGF-producing cells. A developed capillary network was also observed in tumors of mice that were injected with control NMuMG cells. In contrast, the tumors in mice that were injected with sNRP-1-producing cells showed fewer and smaller capillaries, consistent with the necrosis of the tumors observed in these mice. Quantification of microvessel density (MVD) revealed 40 ± 8 capillaries per high-power field in controls and 49.2 ± 14 capillaries in VEGF-treated mice, without a significant difference (Figure 4C). MVD was significantly lower (P < .05) in mice treated with sNRP-1, with 27.4 ± 7 capillaries per field. These results indicate that supplementation of VEGF at the site of chloroma tumors induces tumor vascularization and promotes tumor growth. On the other hand, the VEGF antagonist sNRP-1 repressed tumor vascularization and, subsequently, tumor growth.


View larger version (85K):
[in this window]
[in a new window]
 
Figure 4. Opposite effects of VEGF and sNRP-1 on chloroma neovascularization. (A) In vivo secretion of VEGF. Tumors from mice injected with encapsulated NMuMG/VEGF cells were harvested after 21 days and processed for histologic examination. Tissue sections were stained with anti-human VEGF antibodies and photographed under × 100 (left) and × 400 (right) original magnification. A cross-sectioned capsule and surrounding tumor tissue is shown. Some VEGF-positive stained cells can be seen within the capsule. (B) Tumor neovascularization. Tumors from NMuMG (control), NMuMG/VEGF (VEGF), and NMuMG/sNRP-1 (sNRP-1) groups, as indicated, were harvested and processed for histologic examination. Tumor sections were stained with H&E (top panels) and with anti-mouse CD31 antibodies (bottom panels) and photographed under × 400. (C) Microvessel density (MVD) was determined by counting 10 high-power fields (HPFs) from the CD31 stained sections in panel B. The numbers represent the MVD average, and standard deviations were calculated.

The VEGF antagonist, sNRP-1, inhibits progression of systemic leukemia

SCID mice injected intravenously with murine M1 cells develop leukemia with bone marrow infiltration and circulating blasts. In order to achieve maximal systemic levels of a VEGF antagonist, we used an adenoviral vector producing a dimeric form of sNRP-1, Fc-sNRP-1. Dimeric sNRP-1 has a higher binding affinity for VEGF than the monomer and is a more potent inhibitor of VEGF binding to endothelial cells (not shown). Since high concentrations of VEGF lead to early morbidity and mortality, VEGF treatment in this experiment was carried out using injection of a low titer of an adenoviral vector-producing VEGF. M1 cells were injected intravenously into SCID mice (2 × 106 cells per mouse) and after 7 days adenoviruses coding for Fc-sNRP-1 (Ad.Fc-sNRP-1), VEGF (Ad.VEGF), or lacZ (Ad.LacZ) as control, were injected intravenously. After 28 days, 2 mice from each group were killed and peripheral blood samples were analyzed for the proportion of leukemic cells. Blood samples from Ad.LacZ- and Ad.VEGF-injected mice had 49% and 60% leukemia blast cells, respectively. In contrast, mice injected with Ad.Fc-sNRP-1 had only 6.3% leukemia blast cells. Liver tissue specimens were tested for the expression of LacZ using a functional assay that stained the expressing cells blue (Figure 5Ai,iv,vii). Only mice injected with Ad.LacZ had blue cells within the liver, the preferred site of adenovirus infection, indicating efficient viral infection. Liver and spleen specimens were also analyzed for cell infiltration by H&E staining (Figures 5Aii,v,viii and iii,vi,ix, respectively). Massive leukemic cell infiltration was observed in the liver and spleen of mice injected with Ad.VEGF. In contrast, liver specimens of Ad.Fc-sNRP-1-injected mice had a normal abundance of lymphocytelike cells. Analyses of bone marrow sections by H&E staining (Figure 5Bi-iii) revealed higher cellularity in Ad.VEGF-injected mice than in control, Ad.LacZ mice. Mice injected with Ad.Fc-sNRP-1 had lower cellular content than control mice. Identification of M1 cells in the bone marrow was confirmed using Ad.LacZ-infected M1 cells and lacZ staining of bone sections (not shown). Immunostaining of bone sections using anti-CD31 antibodies (Figure 5Biv-vi) revealed many bone marrow capillaries in Ad.VEGF-injected mice. Far fewer capillaries were observed in Ad.LacZ- and Ad.Fc-sNRP-1-injected mice.


View larger version (52K):
[in this window]
[in a new window]
 
Figure 5. Soluble NRP-1 inhibits liver, spleen, and bone infiltration of leukemic cells. M1 cells (2 × 106 cells per mouse) were injected intravenously into SCID mice. After 7 days, adenoviral vectors encoding for Fc-sNRP-1 (Avii-ix and Biii-iv), VEGF (Aiv,vi and Bii,v), and lacZ (Ai-iii and Bi,iv) were injected intravenously, as described in "Materials and methods." On day 28, 2 mice from each group were killed and their bones, livers, and spleens were processed for histologic examination. (A) Liver tissues were processed for LacZ staining (Ai,iv,vii), as described in "Materials and methods." Liver and spleen tissues were also stained with H&E (ii,v,viii and iii,vi,ix, respectively). Stained sections were examined microscopically and representative images were recorded (original magnification × 200). (B) Bone sections were stained with H&E (i-iii) and with anti-mouse CD31 antibodies (iv-vi). Stained sections were examined microscopically and representative images were recorded (original magnification × 200).

The mice were followed for 45 days in order to test the effect of the VEGF antagonist on leukemic mouse survival (Figure 6). There was no significant difference in the median survival of mice treated with Ad.LacZ and Ad.VEGF (approximately 28 days), whereas leukemic mice injected with Ad.Fc-sNRP-1 had a significantly higher median survival rate (approximately 42 days; P < .001). These results indicate that inhibition of VEGF decreases leukemia-induced neoangiogenesis in bone marrow and liver and spleen infiltration and slowed mouse death due to leukemia.


View larger version (16K):
[in this window]
[in a new window]
 
Figure 6. Soluble NRP-1 prolonged the survival of leukemic mice. SCID mice were injected with M1 cells followed by intravenous injection of adenoviral vectors encoding for Fc-sNRP-1 (Ad.Fc-sNRP-1; ), VEGF (Ad.VEGF; ), and lacZ (Ad.LacZ; triangle ), as described in the Figure 5 legend. Mice (10 per group) were followed for 45 days after viral injection and a survival curve was generated. Mice injected with Ad.LacZ or Ad.VEGF had a mean survival of 28 days and mice injected with Ad.Fc-sNRP-1 had a mean survival of 35 days.


    Discussion
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Acute myeloid leukemia is a rapid progressive disease characterized by high proliferation of leukemic blasts with consequent repression of normal hematopoiesis in the bone marrow.20 Although the bone marrow space is filled mainly with hematopoietic cells, it contains other cells such as adipocytes, fibroblasts, osteogenic cells, and endothelial cells.21 The endothelium forms a network of vasculature spanning the whole cavity, thus providing a blood supply like in solid organs. Perez-Atayde et al showed a significantly higher density of bone marrow capillaries in children with acute lymphatic leukemia as compared with healthy volunteers.12 It was shown that leukemic cells secrete VEGF and thereby stimulate the microenvironment to produce cytokines, thus providing a paracrine loop.13,22,23 Angiogenesis seems to play a key role not only in AML but also in other hematologic malignancies like chronic lymphatic leukemia (CLL), non-Hodgkin lymphomas, and multiple myeloma.24-26

In this study we investigated how exogenously supplied VEGF affects the progression of AML in vivo and conversely, if VEGF antagonists repress this process. VEGF is a potent angiogenic factor in vivo and has been implicated in the growth of a wide variety of solid tumors.27 NRP-1 acts as a high-affinity receptor for VEGF on endothelial and tumor-derived cells9,28 but it does not have a kinase enzymatic activity and acts as a coreceptor for KDR by enhancing VEGF binding to KDR.16 A naturally occurring sNRP-1 protein is produced by tumor cells and it can inhibit VEGF receptor binding in vitro and tumor growth in vivo when overexpressed in prostate cancer cells.29

We tested several human and murine cell lines for the expression of VEGF, KDR, and NRP-1 by RT-PCR. We found VEGF expression in all lines tested except for 32D, which is a basophilic line, and in freshly isolated human leukemia cells. Additionally, most leukemic cells expressed mRNA for KDR and NRP-1. Recently, Flt-4 (VEGFR-3), a receptor for VEGF-C, was detected on leukemic cell lines and on primary leukemia cells.30 VEGF-C induced leukemia cell proliferation and provided protection from chemotherapy-induced apoptosis.30 These results may point to hemangioblasts as a common origin of leukemia and endothelial cells.31 Several studies have shown that a high percentage of leukemic cells express VEGF and VEGF receptors,13,22,32 suggesting a possible autocrine stimulation of the malignant cells. VEGF was shown to stimulate proliferation of leukemic cells in vitro,14,33 as well as to act as an antiapoptotic factor.34 VEGF activation of KDR was postulated to lead to its angiogenic effects. To test this hypothesis, we have analyzed KDR phosphorylation in our leukemic cell system. KDR was constitutively phosphorylated in HEL cells, possibly through autocrine VEGF stimulation, and its phosphorylation did not increase with the addition of exogenous VEGF. On the other hand, M1 cells expressed VEGF receptors but did not induce KDR phosporylation. These results were supported by cell proliferation experiments, which showed no enhancement in HEL and M1 cell numbers upon addition of VEGF. This result suggests that M1 cells may not be affected by VEGF or VEGF antagonism. It is possible that leukemic cells express different amounts of VEGF or its receptors, which determines whether the receptors will be constitutively activated or they could be further activated by exogenous VEGF. Alternatively, VEGF expression may be up-regulated in leukemia cells as a result of relative hypoxia or cytokine induction.35

In order to examine the role of VEGF in AML progression in vivo, we established 2 mouse models with M1 cells forming chloromas when injected subcutaneously or leukemia when injected intravenously into SCID mice. M1 cells in a chloroma model formed solid tumors. VEGF and sNRP-1 were supplied in vivo from encapsulated cells producing high amounts of recombinant proteins. Analysis of VEGF secretion from encapsulated cells in vivo revealed a concentric pattern of VEGF release from the capsules into the surrounding tissue. This control release system allows continuous delivery of recombinant proteins avoiding in vivo DNA transfection.18 VEGF dramatically enhanced growth of M1 chloromas with earlier onset and formation of larger tumors, whereas release of sNRP-1 resulted in a significant inhibition of chloroma growth. Analysis of tumor sections showed tightly packed cells in the VEGF and control groups but areas with necrosis were present in sNRP-1-treated tumors. Accordingly, the microvessel density was significantly higher in the VEGF group and significantly lower in the sNRP-1 group as compared with controls. Blood capillaries in sNRP-1-treated chloromas were not only fewer but also smaller in size. Similar results were seen in human patients with AML following treatments with chemotherapy or with a KDR antagonist SU5416.36,37 Since VEGF is required for the growth and maintenance of blood capillaries, VEGF inhibition may lead to a reduction in the total number of capillaries as well as their size. These results indicate that chloroma progression is regulated by the availability of angiogenesis factors to the leukemia cells and suggest that this process is angiogenic dependent, like the growth of a solid tumor.

Since a chloroma does not involve the bone marrow environment and the systemic nature of acute leukemia, we tested VEGF inhibition in a leukemia model using M1 cells. To achieve systemic delivery of sNRP-1 we chose to use an adenovirus-mediated delivery of recombinant proteins. Coupling recombinant proteins to carriers, such as the immunoglobulin G (IgG) Fc domain, may enhance their stability and prolong their presence in the circulation. In this study we used an adenovirus vector encoding for the Fc-sNRP-1 fusion protein that produces dimers of sNRP-1. Although the exact molecular interaction between NRP-1 and VEGF is not clear, the affinity of VEGF165 to NRP-1 is dramatically increased with increasing NRP-1 density.38 We observed higher 125I-VEGF165 binding capacity of sNRP-1 dimers compared with sNRP-1 monomers (M.N. and S.S., unpublished data, August 2001). Adenoviral delivery of Fc-sNRP-1 resulted in prolonged survival of the leukemic mice. Accordingly, massive M1 infiltration to liver and spleen was evident in VEGF-treated (Ad.VEGF-injected) mice compared with Fc-sNRP-1-treated (Ad.Fc-sNRP-1-injected) mice. Fc-sNRP-1-treated mice had significantly lower numbers of circulating blasts 4 weeks after M1 cell injection. Examination of bone marrow sections revealed enhanced neovascularization of control (Ad.LacZ-injected) and VEGF-treated mice. In contrast, mice treated with Fc-sNRP-1 exhibited only a few bone marrow capillaries, similar to the effects of sNRP-1 seen in the chloroma model. Bone marrow neovascularization was associated with increased bone marrow infiltration of M1 cells in VEGF-treated mice and conversely, decreased cellularity in Fc-sNRP-1-treated mice. Taken together, these results show the opposite effects of VEGF and sNRP-1 on leukemia progression in 2 different mouse models. These findings are supported by clinical data, which show increased microvessel density in the bone marrow of patients with AML and myelodysplastic syndrome.39-42 Aguayo et al found that intracellular VEGF levels associated with the leukemic cells could serve to predict the outcome of patients with AML.43

We have engineered a VEGF antagonist, based on the sequence of the extracellular portion of NRP-1. This region contains the VEGF-binding site of NRP-138,44 and was shown to specifically block VEGF165 activity.27 Since many tumor cells express NRP-1 and bind VEGF via this receptor,9,17 sNRP-1 represents a novel VEGF antagonist that can bind circulating VEGF and prevent it from interacting with tumor endothelial cells and displace tumor cell NRP-1-bound VEGF. We have previously shown that rat prostate tumor cells expressing high levels of sNRP-1 formed tumors with large necrotic areas, probably due to insufficient blood supply caused by VEGF inhibition.29 In our chloroma model, sNRP-1 released from encapsulated cells had similar VEGF inhibition effects, as suggested by the many necrotic areas within the tumors. In the systemic leukemia model, inhibition of bone marrow vascularization by sNRP-1 may affect circulation and survival of the leukemic cells. Since we have not detected a direct effect of VEGF on M1 cells, a direct effect of sNRP-1 is not likely. However, we are currently testing sNRP-1-induced apoptosis of leukemia cell lines and freshly isolated leukemia cells.

Other VEGF antagonists have been used as antiangiogenic factors. Promising results have been observed using antibodies to VEGF, soluble receptors, or antibodies to receptors of VEGF.45-47 Treatment of human leukemic cell lines expressing KDR with anti-KDR antibodies was shown to inhibit leukemia progression in nonobese diabetic (NOD)-SCID mice.14 Combination treatment of anti-KDR and anti-Flk-1 (murine KDR) completely inhibited tumor growth of these cell lines in mice. The authors concluded that VEGF may play a dual role in AML progression by inducing leukemic cell proliferation via an autocrine stimulation loop as well as induction of host endothelium-dependent angiogenesis via a paracrine loop. Our results suggest that in patients with AML, where the leukemic cells are not able to directly respond to VEGF, tumor progression might be promoted by induction of host-dependent angiogenesis. The use of sNRP-1 as a VEGF antagonist prevents VEGF-induced angiogenesis and AML tumor progression. Interestingly, VEGF was shown to promote AML progression via an alternative pathway. A positive correlation was shown between VEGF production and the engraftment of leukemic cells in NOD-SCID mice.48 Clinical trials using the antiangiogenesis approach to treat hematologic cancers are underway. KDR inhibitors such as SU5416 and PTK78749 or thalidomide50 showed encouraging preliminary results.

Collectively, we have demonstrated that AML progression is induced by VEGF and that a VEGF antagonist, sNRP-1, significantly inhibited AML progression in vivo. Thus, our results suggest that AML progression is angiogenic dependent and that VEGF antagonist therapy with soluble receptor proteins and blocking antibodies might represent a promising alternative to the current therapy approaches.


    Acknowledgments

The authors wish to thank Dr Michael Klagsbrun for helpful discussions and Dr Evelyn Flynn for her assistance in the immunostaining procedures.


    Footnotes

Submitted May 14, 2001; accepted August 19, 2002.

Supported by a grant of Deutsche Krebshilfe (G.S.).

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: Shay Soker, Department of Urology, Children's Hospital, Harvard Medical School, 300 Longwood Ave, Boston, MA 02115; e-mail: shay.soker{at}tch.harvard.edu.


    References
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

1. Folkman J. Tumor angiogenesis: therapeutic implications. N Engl J Med. 1971;285:1182-1186[Medline] [Order article via Infotrieve].

2. Risau W. Mechanisms of angiogenesis. Nature. 1997;386:671-674[CrossRef][Medline] [Order article via Infotrieve].

3. Folkman J. What is the evidence that tumors are angiogenesis dependent? J Natl Cancer Inst. 1990;82:4-6[Free Full Text].

4. Plate KH, Breier G, Weich HA, Risau W. Vascular endothelial growth factor is a potential tumor angiogenesis factor in gliomas in vivo. Nature. 1992;359:845-848[CrossRef][Medline] [Order article via Infotrieve].

5. Zhang HAT, Craft P, Scott PAE, et al. Enhancement of tumor growth and vascular density by transfection of vascular endothelial growth factor into MCF-7 human breast carcinoma cells. J Natl Cancer Inst. 1995;87:213-218[Abstract/Free Full Text].

6. Plouet J, Schilling J, Gospodarowicz D. Isolation and characterization of a newly identified endothelial cell mitogen produced by AtT-20 cells. EMBO J. 1989;8:3801-3806[Medline] [Order article via Infotrieve].

7. Klagsbrun M, D'Amore PA. Vascular endothelial growth factor and its receptors. Cytokine Growth Factor Rev. 1996;7:259-270[CrossRef][Medline] [Order article via Infotrieve].

8. Tischer E, Mitchell R, Hartman T, et al. The human gene for vascular endothelial growth factor: multiple protein forms are encoded through alternative exon splicing. J Biol Chem. 1991;266:11947-11954[Abstract/Free Full Text].

9. Soker S, Takashima S, Miao HQ, Neufeld G, Klagsbrun M. Neuropilin-1 is expressed by endothelial and tumor cells as an isoform-specific receptor for vascular endothelial growth factor. Cell. 1998;92:735-745[CrossRef][Medline] [Order article via Infotrieve].

10. Takahashi Y, Kitadai Y, Bucana CD, Cleary KR, Ellis LM. Expression of vascular endothelial growth factor and its receptor, KDR, correlates with vascularity, metastasis and proliferation in human colon cancer. Cancer Res. 1995;55:3964-3968[Abstract/Free Full Text].

11. Ikeda N, Adachi M, Taki T, et al. Prognostic significance of angiogenesis in human pancreatic cancer. Br J Cancer. 1999;79:1553-1563[CrossRef][Medline] [Order article via Infotrieve].

12. Perez-Atayde AR, Sallan SE, Tedrow U, Connors S, Allred E, Folkman J. Spectrum of tumor angiogenesis in the bone marrow of children with acute lymphoblastic leukemia. Am J Pathol. 1997;150:815-821[Abstract].

13. Fiedler W, Graeven U, Erguen S, et al. Vascular endothelial growth factor, a possible paracrine growth factor in human acute myeloid leukemia. Blood. 1997;89:1870-1875[Abstract/Free Full Text].

14. Dias S, Hattori K, Zhu Z, et al. Autocrine stimulation of VEGFR-2 activates human leukemic cell growth and migration. J Clin Invest. 2000;106:511-521[Medline] [Order article via Infotrieve].

15. Fiedler W, Henke RP, Erguen S, et al. Derivation of a new hematopoetic cell line with endothelial cell features from a patient with transformed myeloproliferative syndrome. Cancer. 2000;88:344-351[CrossRef][Medline] [Order article via Infotrieve].

16. Soker S, Miao HQ, Nomi M, Takashima S, Klagsbrun M. VEGF(165) mediates formation of complexes containing VEGFR-2 and neuropilin-1 that enhance VEGF(165)-receptor binding. J Cell Biochem. 2002;85:357-368[CrossRef][Medline] [Order article via Infotrieve].

17. Soker S, Gollamudi-Payne S, Fidder H, Charmahelli H, Klagsbrun M. Inhibition of vascular endothelial growth factor (VEGF)-induced endothelial cell proliferation by a peptide corresponding to the exon 7-encoded domain of VEGF165. J Biol Chem. 1998;272:31582-31588.

18. Joki T, Machluf M, Atala A, et al. Continuous release of endostatin from microencapsulated engineered cells for tumor therapy. Nat Biotechnol. 2001;19:35-39[CrossRef][Medline] [Order article via Infotrieve].

19. Asahara T, Takahashi T, Masuda H, et al. VEGF contributes to postnatal neovascularization by mobilizing bone marrow-derived endothelial progenitor cells. EMBO J. 1999;70:3964-3972[CrossRef].

20. Löwenberg B, Downing JR, Burnett A. Acute myeloid leukemia. N Engl J Med. 1999;341:1051-1062[Free Full Text].

21. Zhang W, Knieling G, Vohwinkel G, et al. Origin of stroma cells in long-term bone marrow cultures from patients with acute myeloid leukemia. Ann Hematol. 1999;78:305-314[CrossRef][Medline] [Order article via Infotrieve].

22. Bellamy WT, Richter L, Frutiger Y, Grogan TM. Expression of vascular endothelial growth factor and its receptors in hematopoetic malignancies. Cancer Res. 1999;59:728-733[Abstract/Free Full Text].

23. Dias S, Hattori K, Heissig B, et al. Inhibition of both paracrine and autocrine VEGF/ VEGFR-2 signaling pathways is essential to induce long-term remission of xenotransplanted human leukemias. Proc Natl Acad Sci U S A. 2001;98:10857-10862[Abstract/Free Full Text].

24. Chen H, Treweeke AT, West DC, et al. In vitro and in vivo production of vascular endothelial growth factor by chronic lymphatic leukemia cells. Blood. 2000;96:3181-3187[Abstract/Free Full Text].

25. Salven P, Teerenhovi L, Joensuu H. A high pretreatment basic fibroblast growth factor concentration is an independent predictor of poor prognosis in non-Hodgkin's lymphoma. Blood. 1999;94:3334-3339[Abstract/Free Full Text].

26. Vacca A, Ribatti D, Presta M, et al. Bone marrow neovascularization, plasma cell angiogenic potential, and matrix metalloproteinase-2 secretion parallel progression of human multiple myeloma. Blood. 1999;93:3064-3073[Abstract/Free Full Text].

27. Ferrara N, Gerber HP. The role of vascular endothelial growth factor in angiogenesis. Acta Haematol. 2001;106:148-156[CrossRef][Medline] [Order article via Infotrieve].

28. Miao HQ, Lee P, Lin H, Soker S, Klagsbrun M. Neuropilin-1 expression by tumor cells promotes tumor angiogenesis and progression. FASEB J. 2000;14:2532-2539[Abstract/Free Full Text].

29. Gagnon ML, Bielenberg DR, Gechtman Z, et al. Identification of a natural soluble neuropilin-1 that binds vascular endothelial growth factor: in vivo expression and antitumor activity. Proc Natl Acad Sci U S A. 2000;97:2573-2578[Abstract/Free Full Text].

30. Dias S, Choy M, Alitalo K, Rafii S. Vascular endothelial growth factor (VEGF)-C signaling through FLT-4 (VEGFR-3) mediates leukemic cell proliferation, survival, and resistance to chemotherapy. Blood. 2002;99:2179-2184[Abstract/Free Full Text].

31. Moore MA, Hattori K, Heissig B, et al. Mobilization of endothelial and hematopoetic stem and progenitor cells by adenovector-mediated elevation of serum levels of SDF-1, VEGF, and angiopoietin-1. Ann N Y Acad Sci. 2001;938:36-45[Medline] [Order article via Infotrieve].

32. Fiedler W, Graeven U, Erguen S, et al. Expression of FLT4 and its ligand VEGF-C in acute myeloid leukemia. Leukemia. 1997;11:1234-1237[CrossRef][Medline] [Order article via Infotrieve].

33. Ratajczak MZ, Ratajczak J, Machalinski B, et al. Role of vascular endothelial growth factor (VEGF) and placenta-derived growth factor (PlGF) in regulating human haematopoetic cell growth. Br J Haematol. 1998;103:969-979[CrossRef][Medline] [Order article via Infotrieve].

34. Katoh O, Takahashi T, Oguri T, et al. Vascular endothelial growth factor inhibits apoptotic death in hematopoetic cells after exposure to chemotherapeutic drugs by inducing MCL1 acting as an antiapoptotic factor. Cancer Res. 1998;58:5565-5569[Abstract/Free Full Text].

35. Akeno N, Robins J, Zhang M, Czyzyk-Krzeska MF, Clemens TL. Induction of vascular endothelial growth factor by IGF-1 in osteoblast-like cells is mediated by the PI3K signalling pathway through the hypoxia-inducible factor-2alpha. Endocrinology. 2002;143:420-425[Abstract/Free Full Text].

36. de Bont ES, Rosati S, Jacobs S, Kamps WA, Vellenga E. Increased bone marrow vascularization in patients with acute myeloid leukemia: a possible role for vascular endothelial growth factor. Br J Haematol. 2001;113:296-304[CrossRef][Medline] [Order article via Infotrieve].

37. Mesters RM, Padro T, Bieker R, et al. Stable remission after administration of the receptor tyrosine kinase inhibitor SU5416 in a patient with refractory acute myeloid leukemia. Blood. 2001;98:241-243[Abstract/Free Full Text].

38. Fuh G, Garcia KC, de Vos AM. The interaction of neuropilin-1 with vascular endothelial growth factor and its receptor flt-1. J Biol Chem. 2000;275:26690-26695[Abstract/Free Full Text].

39. Hussong JW, Rodgers GM, Shami PJ. Evidence of increased angiogenesis in patients with acute myeloid leukemia. Blood. 2000;95:309-313[Abstract/Free Full Text].

40. Padro T, Ruiz S, Bieker R, et al. Increased angiogenesis in the bone marrow of patients with acute myeloid leukemia. Blood. 2000;95:2637-2644[Abstract/Free Full Text].

41. Aguayo A, Kantarjian H, Manshouri T, et al. Angiogenesis in acute and chronic leukemias and myelodysplastic disorders. Blood. 2000;96:2240-2245[Abstract/Free Full Text].

42. Pruneri G, Bertolini F, Soligo D, et al. Angiogenesis in myelodysplastic syndromes. Br J Cancer. 1999;81:1398-1401[CrossRef][Medline] [Order article via Infotrieve].

43. Aguayo A, Estey E, Kantarjian H, et al. Cellular vascular endothelial growth factor is a predictor of outcome in patients with acute myeloid leukemia. Blood. 1999;94:3717-3721[Abstract/Free Full Text].

44. Mamluk R, Gechtman Z, Kutcher ME, Gasiunas N, Gallagher J, Klagsbrun M. Neuropilin-1 binds vascular endothelial growth factor 165, placenta growth factor-2 and heparin via its b1b2 domain. J Biol Chem. 2002;277:24818-24825[Abstract/Free Full Text].

45. Kim KJ, Li B, Winer J, et al. Inhibition of vascular endothelial growth factor-induced angiogenesis suppresses tumour growth in vivo. Nature. 1993;362:841-844[CrossRef][Medline] [Order article via Infotrieve].

46. Goldman CK, Kendall RL, Cabrera G, et al. Paracrine expression of a native soluble vascular endothelial growth factor receptor inhibits tumor growth, metastasis, and mortality rate. Proc Natl Acad Sci U S A. 1998;95:8795-8800[Abstract/Free Full Text].

47. Yuan F, Chen Y, Dellian M, et al. Time-dependent vascular regression and permeability changes in established human tumor xenografts induced by an anti-vascular endothelial growth factor/vascular permeability factor antibody. Proc Natl Acad Sci U S A. 1996;93:14765-14770[Abstract/Free Full Text].

48. Fusetti L, Pruneri G, Gobbi A, et al. Human myeloid and lymphoid malignancies in the non-obese diabetic/severe combined immunodeficiency model: frequency of apoptotic cells in solid tumors and efficiency and speed of engraftment correlate with vascular endothelial growth factor production. Cancer Res. 2000;60:2527-2534[Abstract/Free Full Text].

49. Traxler P, Bold G, Buchdunger E, et al. Tyrosine kinase inhibitors: from rational drug design to clinical trials. Med Res Rev. 2001;21:499-512[CrossRef][Medline] [Order article via Infotrieve].

50. Steins MB, Padro T, Bieker R, et al. Efficacy and safety of thalidomide in patients with acute myeloid leukemia. Blood. 2002;99:834-839[Abstract/Free Full Text].

© 2002 by The American Society of Hematology.
 

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
BloodHome page
T. T.-F. Shih, H.-A. Hou, C.-Y. Liu, B.-B. Chen, J.-L. Tang, H.-Y. Chen, S.-Y. Wei, M. Yao, S.-Y. Huang, W.-C. Chou, et al.
Bone marrow angiogenesis magnetic resonance imaging in patients with acute myeloid leukemia: peak enhancement ratio is an independent predictor for overall survival
Blood, April 2, 2009; 113(14): 3161 - 3167.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A. Bagri, M. Tessier-Lavigne, and R. J. Watts
Neuropilins in Tumor Biology
Clin. Cancer Res., March 15, 2009; 15(6): 1860 - 1864.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. M. Kornblau, R. Tibes, Y. H. Qiu, W. Chen, H. M. Kantarjian, M. Andreeff, K. R. Coombes, and G. B. Mills
Functional proteomic profiling of AML predicts response and survival
Blood, January 1, 2009; 113(1): 154 - 164.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Narazaki, M. Segarra, and G. Tosato
Sulfated polysaccharides identified as inducers of neuropilin-1 internalization and functional inhibition of VEGF165 and semaphorin3A
Blood, April 15, 2008; 111(8): 4126 - 4136.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
T.-M. Hong, Y.-L. Chen, Y.-Y. Wu, A. Yuan, Y.-C. Chao, Y.-C. Chung, M.-H. Wu, S.-C. Yang, S.-H. Pan, J.-Y. Shih, et al.
Targeting Neuropilin 1 as an Antitumor Strategy in Lung Cancer
Clin. Cancer Res., August 15, 2007; 13(16): 4759 - 4768.
[Abstract] [Full Text] [PDF]


Home page
Journal of Bioactive and Compatible PolymersHome page
H. Lee, H. J. Chung, and T. G. Park
Perspectives On: Local and Sustained Delivery of Angiogenic Growth Factors
Journal of Bioactive and Compatible Polymers, January 1, 2007; 22(1): 89 - 114.
[Abstract] [PDF]


Home page
Clin. Cancer Res.Home page
I. A. Avramis, E. H. Panosyan, F. Dorey, J. S. Holcenberg, and V. I. Avramis
Correlation between High Vascular Endothelial Growth Factor-A Serum Levels and Treatment Outcome in Patients with Standard-Risk Acute Lymphoblastic Leukemia: A Report from Children's Oncology Group Study CCG-1962
Clin. Cancer Res., December 1, 2006; 12(23): 6978 - 6984.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
O. Awad, E. I. Dedkov, C. Jiao, S. Bloomer, R. J. Tomanek, and G. C. Schatteman
Differential Healing Activities of CD34+ and CD14+ Endothelial Cell Progenitors
Arterioscler. Thromb. Vasc. Biol., April 1, 2006; 26(4): 758 - 764.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
P. Klener, M. Szynal, Y. Cleuter, M. Merimi, H. Duvillier, F. Lallemand, C. Bagnis, P. Griebel, C. Sotiriou, A. Burny, et al.
Insights into Gene Expression Changes Impacting B-Cell Transformation: Cross-Species Microarray Analysis of Bovine Leukemia Virus Tax-Responsive Genes in Ovine B Cells
J. Virol., February 15, 2006; 80(4): 1922 - 1938.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. S. Tallman, D. G. Gilliland, and J. M. Rowe
Drug therapy for acute myeloid leukemia
Blood, August 15, 2005; 106(4): 1154 - 1163.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Murga, O. Fernandez-Capetillo, and G. Tosato
Neuropilin-1 regulates attachment in human endothelial cells independently of vascular endothelial growth factor receptor-2
Blood, March 1, 2005; 105(5): 1992 - 1999.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. LeCouter, C. Zlot, M. Tejada, F. Peale, and N. Ferrara
Bv8 and endocrine gland-derived vascular endothelial growth factor stimulate hematopoiesis and hematopoietic cell mobilization
PNAS, November 30, 2004; 101(48): 16813 - 16818.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
L. Bullinger, K. Dohner, E. Bair, S. Frohling, R. F. Schlenk, R. Tibshirani, H. Dohner, and J. R. Pollack
Use of Gene-Expression Profiling to Identify Prognostic Subclasses in Adult Acute Myeloid Leukemia
N. Engl. J. Med., April 15, 2004; 350(16): 1605 - 1616.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
G. Schuch, J. V. Heymach, M. Nomi, M. Machluf, J. Force, A. Atala, J. P. Eder Jr., J. Folkman, and S. Soker
Endostatin Inhibits the Vascular Endothelial Growth Factor-Induced Mobilization of Endothelial Progenitor Cells
Cancer Res., December 1, 2003; 63(23): 8345 - 8350.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. Machluf, A. Orsola, S. Boorjian, R. Kershen, and A. Atala
Microencapsulation of Leydig Cells: A System for Testosterone Supplementation
Endocrinology, November 1, 2003; 144(11): 4975 - 4979.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schuch, G.
Right arrow Articles by Soker, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schuch, G.
Right arrow Articles by Soker, S.
Related Collections
Right arrow Hemostasis, Thrombosis, and Vascular Biology
Right arrow Neoplasia
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2002 by American Society of Hematology         Online ISSN: 1528-0020