| |
|
|
|
|
|
|
|||
|
Prepublished online as a Blood First Edition Paper on April 17, 2002; DOI 10.1182/blood-2001-12-0321.
HEMATOPOIESIS
From the Carl C. Icahn Institute for Gene Therapy and
Molecular Medicine, Mount Sinai School of Medicine, New York, NY;
Department of Pediatrics, Division of Hematology-Oncology, and the
Division of Medical Oncology, University of Colorado Health Sciences
Center and Children's Hospital, Denver; Department of Pediatrics and
the Center for Human Genetics and Molecular Pediatric Disease,
University of Rochester, NY; Department of Molecular Biology, Umeå
University, Sweden; and Department of Biochemistry, Dartmouth Medical
School, Hanover, NH.
In this report we demonstrate a role for Runx1 (AML1)
at the hemangioblast stage of hematopoietic and endothelial development in embryonic stem (ES) cell-derived embryoid bodies (EBs).
Runx1 is expressed in EBs during the appearance of
precursors with hemangioblast properties, the blast colony-forming
cells (BL-CFCs). Cell sorting studies revealed that all BL-CFCs within
EBs express Runx1. Runx1-deficient EBs
consistently generate 10- to 20-fold fewer blast colonies than
wild-type controls and display a complete block in definitive hematopoiesis. Despite this defect, Runx1 Hematopoiesis in the mouse embryo begins in
the yolk sac, where blood islands of mesodermal origin develop at
approximately day 8 of gestation (E8).1,2 These blood
islands consist of 2 distinct lineages, a population of erythroblasts
and a surrounding layer of angioblasts that will form the first
vascular structures.3 The parallel temporal development of
these lineages in physical proximity provided the basis for the
hypothesis that they arise from a common precursor, a cell called the
hemangioblast.4,5 Erythroid cells within the blood
islands, known as embryonic or primitive erythrocytes, are large and
nucleated, and they produce the embryonic forms of
globin.1,6,7 Generation of the primitive erythroid lineage
is known as primitive hematopoiesis, and it represents a transient
developmental program that is restricted to the yolk sac between the
primitive streak and 20 somite pair (sp) stages of
development.8-10 Definitive hematopoiesis encompasses the
development of all lineages other than primitive erythroid and includes
definitive erythroid, myeloid, and lymphoid. As with primitive
hematopoiesis, the first definitive hematopoietic precursors also
develop in the yolk sac and can be detected as early as the primitive
streak stage of development.10 Although initiated in this
extra-embryonic region, definitive hematopoiesis is most often
associated with intra-embryonic sites such as the para-aortic splanchnopleura (P-Sp), the aorta-gonad-mesonephros (AGM), and the
fetal liver, where long-term repopulating stem cells and precursor populations from different lineages undergo significant expansion and
maturation.11-15
Although yolk sac blood islands were identified as the earliest
site of hematopoietic and endothelial development almost 100 years ago,
attempts to identify, isolate, and characterize the precursors
representing these initial stages of lineage commitment, including the
elusive hemangioblast, have been largely hampered by the
inaccessibility of the early mammalian embryo. One promising alternative approach to study early hematopoietic development is the
model system based on the differentiation potential of embryonic stem
(ES) cells in culture.16-21 Most evidence suggests that
the events leading to the establishment of the hematopoietic and
endothelial lineages in embryoid bodies (EBs) generated from ES cells
in culture are similar, if not identical, to those in the early yolk
sac.19,22-29 Using the ES/EB differentiation model, cells
with hemangioblast potential have been identified.30,31 In
the presence of vascular endothelial growth factor (VEGF) in methylcellulose cultures, these EB-derived precursors generate blast
cell colonies that display hematopoietic and endothelial potential.30,32 The cells that give rise to these blast
colonies, the blast colony-forming cells (BL-CFCs), represent a
transient population that appears in EBs before the establishment of
any other hematopoietic lineages. The developmental potential of the BL-CFC strongly suggests that it represents the in vitro equivalent of
the hemangioblast and, as such, the earliest stage of hematopoietic and
endothelial commitment.
Although a precursor with hemangioblast properties remains to be
identified in the early embryo, insights into the molecular events
involved in the establishment of the earliest hematopoietic and
endothelial lineages have been provided by gene-targeting experiments.
Such studies have uncovered the role of specific genes at distinct
stages in this process and, in doing so, have been instrumental in
defining key developmental steps in the commitment, growth, and
maturation of these lineages. Flk-1, a gene that encodes a
receptor tyrosine kinase, is required early in ontogeny and is
essential for the development of the hematopoietic and the endothelial
components of the blood island.33 Cell tracking studies
have indicated that the Flk-1 receptor is initially involved in
migration of the mesodermal precursor cells to the extraembryonic region of the embryo, the site of yolk sac development.34
These migrating precursors may be similar to the EB-derived BL-CFCs that have been shown to express Flk-135 and to
grow in response to its ligand, VEGF.32
Scl, a member of the helix-loop-helix family of
transcription factors,36 appears to function at a slightly
later developmental stage than Flk-1. The yolk sacs of
Scl The AML1 gene (recently renamed Runx1), which
encodes the DNA-binding subunit of a transcription factor of the core
binding factor (CBF) family,40-42 is required for the
establishment of definitive but not primitive hematopoiesis.
Runx1 Although these targeting studies position Runx1 at the
establishment and expansion of the definitive hematopoietic program, expression analysis suggest that it may function at earlier stages of
development. Using mice with the LacZ gene targeted to the Runx1 locus (Runx1+/Z mice), North et
al44 demonstrated expression of Runx1 (LacZ) in
subpopulations of endothelial cells in the yolk sac, in the vitelline
and umbilical arteries, and in the ventral wall of the dorsal aorta.
Expression was also detected in emerging primitive erythrocytes early
in the yolk sac. Expression in these cells was transient, declined
significantly by E8.5, and was undetectable by E10.5. The presence of
Runx1 transcripts in primitive erythrocytes and in
subpopulations of endothelial cells suggests that this gene may be
expressed and may function at the level of a cell with hemangioblast properties.
To investigate the role of Runx1 at the earliest stage of
hematopoietic commitment, we analyzed its expression pattern and function during ES/EB differentiation and in early yolk sac
development. Our results indicate that Runx1 is expressed in
yolk sac mesodermal cells before the establishment of the blood islands
and within the BL-CFCs in EBs. Analysis of Runx1-deficient
ES cells demonstrated that this gene is essential for the generation of
normal numbers of blast colonies and, as such, provides evidence that
it does function at the equivalent of the hemangioblast stage of
development. BL-CFCs that develop in the deficient EBs appear to
be primitive erythroid restricted, suggesting that the functional
requirement for Runx1 may define subpopulations of these precursors.
In situ hybridization
Embryonic stem cell growth and differentiation
Colony assays For the generation of blast cell colonies (BL-CFC assay), EB cells were plated in 1% methylcellulose supplemented with 10% FCS (Summit, Fort Collins, CO), VEGF (5 ng/mL), c-kit ligand (KL; 1% conditioned medium), interleukin-6 (IL-6; 5 ng/mL), and 25% D4T endothelial cell-conditioned medium.32 Transitional colonies were generated in the same basic conditions in the absence of VEGF. Colonies were scored after 4 days of culture. For the growth of hematopoietic precursors, cells were plated in 1% methylcellulose containing 10% plasma-derived serum (Antech, Tyler, TX), 5% protein-free hybridoma medium (PFHM-II; Gibco-BRL), and cytokines KL (1% conditioned medium), thrombopoietin (5 ng/mL), Erythropoietin (2 U/mL), IL-11 (25 ng/mL), IL-3 (1% conditioned medium), granulocyte-macrophage colony-stimulating factor (GM-CSF; 3 ng/mL), G-CSF (30 ng/mL), M-CSF (5 ng/mL), and IL-6 (5 ng/mL). Cultures were maintained at 37°C, 5% CO2. Primitive erythroid colonies were scored at day 5 to 6 of culture, whereas definitive erythroid, macrophage, and multilineage colonies were counted after 7 to 10 days of culture.For expansion of blast cell colonies, individual colonies were
transferred to Matrigel-coated (Collaborative Research, San Jose, CA)
microtiter wells containing IMDM with 10% FCS (Hyclone, Logan, UT),
10% horse serum (Biocell, Rancho Dominguez, CA), VEGF (5 ng/mL),
insulinlike growth factor 1 (IGF-1) (10 ng/mL), erythropoietin (2 U/mL), basic fibroblast growth factor (bFGF) (10 ng/mL), IL-11 (50 ng/mL), KL (1% conditioned medium), IL-3 (1% conditioned medium), L-glutamine (1%), and 4.5 × 10 X-gal staining Undifferentiated ES cells, differentiated EBs, and hematopoietic colonies were fixed in 1× phosphate-buffered saline (PBS) containing 0.5% glutaraldehyde (Sigma) and 1 mM MgCl2 for 10 to 15 minutes. After fixation, the cells were rinsed in 1× PBS and stained with 1 mM MgCl2, 3.3 mM K4Fe(CN)6, 3.3 mM K3Fe(CN)6, 0.02% NP-40, and 0.1 vol 2% X-gal (Sigma) overnight at 37°C. Positive cells were detected by the presence of blue staining visualized under light microscopy.FACS-gal analysis Fluorescein di- -D-galactopyrosanide (FDG; Sigma), hydrolyzed
to fluorescein by intracellular -galactosidase, was used to detect
LacZ activity. EB-derived cells were washed and resuspended in 1×
PBS-20% FCS to a final maximum concentration of 107
cells/mL. Hypotonic loading was achieved by a 2-minute incubation at
37°C with an equal volume of prewarmed 2 mM FDG (in water). After the
loading procedure, 10 vol cold IMDM-15% FCS were added, and the
mixture was incubated 20 minutes on ice. Stained suspensions were
analyzed on a FACScan (Becton Dickinson, San Jose, CA) or sorted on a
MoFlo (Cytomation Systems, Fort Collins, CO) cell sorter.
Gene expression analysis For polyA+ global amplification polymerase chain reaction (PCR), reverse transcription (RT), poly-A tailing, and PCR procedures were performed as described by Brady et al,46 with the exception that the X-dT oligonucleotide was shortened to 5'-GTTAACTCGAGAATTC(T)24-3'. Amplified products from PCR were separated on agarose gels and transferred to a Zeta-probe GT membrane (Bio-Rad, Hercules, CA). Resultant blots were hybridized with 32P randomly primed cDNA fragments (Ready-to-Go Labeling; Pharmacia, Piscataway, NJ) corresponding to the 3' region of the genes (for all except -H1). A H1-specific probe was
prepared by annealing 2 oligonucleotides,
TGGAGTCAAAGAGGGCATCATAGACACATGGG and CAGTACACTGGCAATCCCATGTG, that
share an 8-base homology at their 3' termini. This H1-specific probe was labeled with 32P using a Klenow
fill-in reaction. For gene-specific PCR, total RNA was extracted from
each sample with the RNeasy mini-kit and treated with Rnase-free DNase
(Qiagen, Valencia, CA). Two micrograms total RNA were
reverse-transcribed into cDNA with random hexamer using the
Omniscript RT kit (Qiagen). PCR was carried out using the following
oligonucleotides: -actin, 5'ATGAAGATCCTGACCGAGCG3' (sense), 5'TACTTGCGCTCAGGAGGAGC3' (antisense); Brachyury,
5'CTAGTACTCTTTCTTGCTGG3' (sense), 5'GGTCTCGGGAAAGCAGTGGC3' (antisense);
Runx1, 5'CCAGCAAGCTGAGGAGCGGCG3' (sense),
5'CGGATTTGTAAAGACGGTGA3' (antisense); Flk1,
5'CACCTGGCACTCTCCACCTTC3'(sense), 5'GATTTCATCCCACTACCGAAAG3'
(antisense); and Scl, 5'ATGGAGATTTCTGATGGTCCTCAC3' (sense),
5'AAGTGTGCTTGGGTGTTGGCTC3 (antisense).
PCR was performed with 2.5 U Taq polymerase (Promega, Madison, WI), PCR buffer, 2.5 mM MgCl2, 0.2 µM each primer, and 0.2 mM dNTP. Cycling conditions were as follows; 94°C for 5 minutes followed by 35 cycles of amplification (94°C denaturation for 1 minute, 60°C annealing for 1 minute, 72°C elongation for 1 minute), with a final incubation at 72°C for 7 minutes.
Runx1 is expressed during gastrulation in extra-embryonic mesoderm before formation of blood islands To further assess the role of Runx1 in the establishment of the hematopoietic system, we mapped its expression before and during the development of blood islands in E7.25 to E8.25 embryos. Runx1 transcripts were detected at the mid-to-late primitive streak stage (E7.25), specifically in extraembryonic mesoderm cells adjacent to visceral endoderm (Figure 1A). This pattern of expression in extraembryonic mesoderm persisted in early neural plate embryos (E7.5, Figure 1B). At mid-to-late neural plate stages, Runx1 mRNA was present predominantly in nascent yolk sac blood islands (Figure 1C and data not shown). In addition, there was a low level of expression in the developing chorion that increased by early somite pair stages (E8.25, Figure 1D). At E8.25, the predominant accumulation of Runx1 mRNA was in the developing yolk sac blood islands (Figure 1D). The early expression of Runx1 described here is similar to that observed for Scl47 and is consistent with a role in the commitment of mesoderm to hematopoietic-endothelial fates.
Runx1 expression is up-regulated at the hemangioblast stage of EB differentiation The above analyses indicate that Runx1 is expressed at the earliest stage of blood island development, suggesting a potential role at the level of the putative hemangioblast. To further investigate the function of Runx1 at the onset of hematopoietic development, we analyzed its expression pattern in EBs over a 10-day differentiation period. A low level of Runx1 expression was detected in undifferentiated ES cells and in EBs after the first few days of differentiation (Figure 2A). Runx1 expression increased significantly between days 3 and 4 of differentiation and remained elevated thereafter. Based on real-time PCR analysis, the magnitude of the increase in Runx1 expression over this 24-hour period was found to be approximately 10-fold (not shown). No Runx1 cDNA was detected in EBs generated from Runx1 / ES cells. Comparative analysis of
Runx1 expression with other genes demonstrated a striking
similarity to the temporal expression pattern of Flk-1. The
up-regulation of both Runx1 and Flk-1 was preceded by the expression of Brachyury, a marker of early
mesoderm development.48 Rex-1, a zinc finger
transcription factor expressed in ES cells but not in their
differentiated progeny,49 was readily detected in
undifferentiated ES cells but not significantly in day 3 EBs.
Scl was expressed at low levels as early as day 3.5 of
differentiation. The levels increased over the next few days and then
remained relatively constant. Gata-1, a transcription factor
expressed in hematopoietic but not endothelial cells50 and
in the embryonic H1 and adult major
globins, followed the onset of Scl expression. These
findings suggest that Runx1 expression is up-regulated at
the hemangioblast stage of development (as defined by Flk-1
and Scl), following the establishment of the earliest
mesodermal population (Brachyury) but preceding the commitment to the hematopoietic lineage (Gata-1, H1, major globin).
The up-regulation of Runx1 expression detected during EB
differentiation could reflect an increase in the level of expression within a subset of cells or an increase in the number of cells expressing this gene. To distinguish between these 2 possibilities, we
analyzed EBs generated from Runx1+/Z ES cells
that contain the LacZ gene targeted to the Runx1
gene.44 LacZ expression was evaluated either by
direct X-gal staining or by FDG staining followed by flow cytometry
analyses. Using both methods of detection, no significant staining was
observed in undifferentiated ES cells (day 0) or in early EBs (up to
2.5 days) (Figure 2B-C). LacZ+ cells were first detected
within the EBs by day 3 of differentiation, at which time approximately
5% of cells expressed this marker as determined by
fluorescence-activated cell sorter (FACS) analysis. The number of
positive cells increased dramatically over the next 24 hours, reaching
levels greater than 30% of the total EB population by day 4 of
differentiation. The frequency of LacZ+ cells remained
elevated (from 30% to 50%) in EBs between days 5 and 10 of
differentiation (Figure 2B and not shown). X-gal staining revealed that
a large portion of individual EBs at day 4 to 6 of differentiation
expressed LacZ. No significant level of Runx1 is expressed in blast colonies and BL-CFCs Given the early expression pattern observed in EBs, we next investigated Runx1 expression in blast colonies and populations derived from them. As shown in Figure 3A, blast colonies generated from Runx1+/Z EBs uniformly stained positive for -galactosidase activity. In contrast, no staining was observed in
control Runx1+/+ blast colonies. This indicates
that the cells within these colonies, which have previously been shown
to represent hematopoietic and endothelial precursors,30
express Runx1. When individual blast colonies are
transferred to microtiter wells under appropriate growth conditions,
these precursors grow and mature into adherent endothelial cells and a
nonadherent population of hematopoietic cells after 4 days of culture.
Analysis of these subpopulations demonstrated extensive LacZ
expression in the hematopoietic cells (Figure 3B). Expression was also
detected in the adherent cells, though the levels were significantly
lower than in the hematopoietic population (Figure 3B, arrowheads).
Expression in the adherent population is consistent with the
observation that Runx1 is expressed in subsets of
endothelial cells in the yolk sac and embryo proper.44
To determine whether the BL-CFC also expresses Runx1, day
3.75 Runx1+/Z EB cells were fractionated for
To evaluate whether earlier developing BL-CFCs also express
Runx1, day 3 Runx1+/Z EBs were
fractionated for Runx1 / , Runx1+/ ,
and Runx1+/+ ES cells were analyzed for BL-CFC
content. At both time points, the Runx1 / EB
cells displayed a profound defect in BL-CFC potential.
Runx1-deficient EBs consistently generated 10- to 20-fold
fewer blast colonies than wild-type controls (Figure
4A). The blast colonies that did develop
from the Runx1 / EB cells were similar in
morphology to those generated from wild-type cells (Figure
5A, top). To confirm that
Runx1 was indeed critical for blast colony development, we
attempted to rescue the defect by retroviral-mediated expression of
this gene in deficient cells. As shown in Figure 4B, day 3 and 3.75 EBs
generated from Runx1 / ES cells infected with
a retroviral vector encoding Runx1, and selected for
puromycin resistance, produced higher numbers of blast colonies than
EBs from ES cells infected with the empty retrovirus. These findings
strongly suggest that Runx1 plays a pivotal role at the
stage of BL-CFC development.
In the next set of experiments, we assessed the developmental
potential of the blast colonies generated from the
Runx1 Replating studies revealed that the nonadherent populations from most
Runx1+/+ and Runx1+/ Runx1 deficiency does not affect primitive hematopoietic development The defect in blast colony development in Runx1 / EBs prompted us to investigate the
primitive hematopoietic potential of these cells and those of the yolk
sac of Runx1 / embryos. Previous analysis of
the primitive erythroid lineage, by estimation of circulating red cell
number in Runx1 / embryos, suggested that
this population was relatively unaffected by the deletion of this
gene.26,27 However, because quantitative analysis of
primitive erythroid precursors was not performed, it is possible that
the Runx1 mutation did cause subtle defects in the
development of this lineage.
Analyses of the yolk sac of Runx1
As observed in the yolk sac, EBs generated from
Runx1 The previous observation of Runx1 expression in yolk sac primitive erythrocytes44 and our sorting studies indicating that all BL-CFCs are Runx1+ suggested that ES-derived committed primitive erythroid precursors are also likely to express this gene. To address this issue, we sorted day 4.75 Runx1+/Z EBs for LacZ expression and analyzed the fractions for primitive erythroid potential (Figure 6D). Replating studies indicated that almost all primitive erythroid precursors were found in the Runx1+ fraction (Figure 6D). As expected, the earliest macrophage precursors developing in these EBs were also Runx1+. Additional studies demonstrated that all definitive precursors found in day 6 EBs were Runx1+ (data not shown). These findings extend our BL-CFC analysis and demonstrate that Runx1 expression defines the earliest stages of primitive and definitive hematopoiesis. Although primitive erythroid precursors express Runx1,
mature cells within colonies generated from them appear to have
down-regulated expression as indicated by the low levels of
Previous studies have established Runx1 as a pivotal
player in the development of the definitive hematopoietic system in the mouse embryo.26,27 Given this association with definitive
hematopoiesis, Runx1 is generally considered to exert its
primary function within the embryo proper, following the primitive
erythroid stage of development in the yolk sac. In this report, we
investigated the role of Runx1 in hematopoietic development
in ES cell-derived EBs and demonstrated that it is essential for the
establishment or differentiation of the BL-CFC, a precursor that
represents the earliest stage of hematopoietic and endothelial
commitment in this model system. Our data clearly show that
Runx1 is expressed within BL-CFCs and is required for the
development of normal numbers of blast colonies from these precursors.
Several lines of evidence indicate that the observed effect on the
number of blast colonies truly reflects a critical role for Runx1
at this stage of development and is not simply due to reduced
potential resulting from ES cell clonal variation. First, the defect in
BL-CFC development was found in several independent
Runx1 The expression and cell separation studies presented here
indicate that the up-regulation of Runx1 expression defines
the earliest stage of hematopoietic and endothelial commitment. The low
levels of expression found in ES cells and early EBs by RT-PCR were not
detected by LacZ staining. This discrepancy may reflect the early
expression of minor isoforms of Runx1 that do not use the
exons containing the LacZ gene53 or differences
in the sensitivity of the methods used in the analyses. Based on RT-PCR
and LacZ expression, Runx1 expression was found
to be up-regulated between days 3 and 4 of differentiation. The
increase in Runx1 expression overlaps with the onset of
Flk-1 and Scl expression and with the development
of BL-CFCs. Although previous analyses have demonstrated that all
BL-CFCs express Flk-1,35 only a small fraction
of the Flk-1+ population appears to represent the BL-CFC
precursor. Our results clearly demonstrate that the BL-CFC expresses
Runx1 and that Runx1 expression at days 3 and 3.5 of differentiation is limited to a subpopulation of Flk-1+
cells. These observations suggest that the up-regulation of
Runx1 expression may mark the developmental progression from
the prehemangioblast (Flk-1+/Runx1 Although the deletion of Runx1 leads to a dramatic reduction
in the number of blast colonies and a complete block in definitive hematopoiesis, it has little or no impact on the generation of the
primitive erythroid lineage. These findings suggest that these hematopoietic programs may diverge at an early stage of development, possibly at the level of the BL-CFC as depicted in Figure
7. In this model, 2 populations of
BL-CFCs with distinct hematopoietic potential would be generated from a
multipotential BL-CFC with primitive and definitive potential.
Emergence of the primitive restricted BL-CFC would be a
Runx1-independent event, whereas the generation of a
functional definitive restricted precursor would require
Runx1. This model is supported by our previous studies in
which we identified 3 different populations of BL-CFC, those with
primitive and definitive hematopoietic potential, those that display
definitive but little if any primitive potential, and those that appear
to be restricted to the primitive erythroid lineage.30,32
The primitive erythroid-restricted BL-CFCs were the least abundant and
represented approximately 3% of the total population. This frequency
is similar to the frequency of BL-CFC found in
Runx1
Most BL-CFCs within the developing EBs are Runx1 dependent
and would belong to the definitive subpopulation of precursors in the
above model. This finding is consistent with our previous studies
demonstrating that most BL-CFCs had definitive but no detectable
primitive potential.30,32 The significant reduction in
blast cell colonies developing from Runx1 The existence of a definitive restricted hemangioblast in vivo is supported by a number of reports that indicate that hematopoietic cells "bud" from a subset of endothelial cells referred to as hemogenic endothelium54-56 found in the dorsal aorta of the developing embryo. This subpopulation of endothelial cells may represent definitive hemangioblasts. Evidence for a role for Runx1 at this stage of development has been provided by North et al,44 who demonstrated that a functional gene is essential for the development of these hematopoietic cell clusters but not for the underlying endothelial cells. Runx1-dependent hematopoietic clusters were also found associated with the endothelial lining of the vitelline and umbilical arteries and with vessels in the yolk sac capillaries.44,57 The function of the definitive hemangioblast in vivo would be first to generate the definitive precursors found early in the yolk sac and subsequently to establish intra-embryonic hematopoiesis in the P-Sp/AGM region of the embryo. These in vivo studies do support this model, but formal proof for the existence of a hemangioblast in the yolk sac or AGM will require clonal analysis. In summary, the data presented in this report position Runx1 functionally at the earliest stages of hematopoietic and endothelial commitment in developing EBs. Expression of Runx1 in early EBs defines a subset of the Flk-1+ population that contains most, if not all, BL-CFCs, the in vitro equivalent of the putative hemangioblast. Access to these early populations through Runx1 expression provides a unique opportunity to define the molecular events involved in the establishment of the primitive and definitive hematopoietic programs.
We thank members of the Keller laboratory for critically reading the manuscript and Anne Trumble for expert technical assistance.
Submitted December 27, 2001; accepted March 6, 2002.
Prepublished online as Blood First Edition Paper, April 17, 2002; DOI 10.1182/blood-2001-12-0321.
Supported by National Institutes of Health grants R01 HL48834 and R01 HL65169.
G.L. and L.G. contributed equally to this work.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Gordon Keller, Carl C. Icahn Institute for Gene Therapy and Molecular Medicine, Mount Sinai School of Medicine, New York, NY; e-mail: gordon.keller{at}mssm.edu.
1. Russel E. Hereditary anemias of the mouse: a review for geneticists. Adv Genet. 1979;20:357-459[Medline] [Order article via Infotrieve]. 2. Moore M, Metcalf D. Ontogeny of the hematopoietic system: yolk sac origin of in vivo and in vitro colony forming cells in the developing mouse embryo. Br J Hematol. 1970;18:279-296[Medline] [Order article via Infotrieve]. 3. Haar JL, Ackerman GA. Ultrastructural changes in mouse yolk sac associated with the initiation of vitelline circulation. Anat Rec. 1971;170:437-456[CrossRef][Medline] [Order article via Infotrieve]. 4. Sabin FR. Studies on the origin of blood vessels and of red corpuscles as seen in the living blastoderm of the chick during the second day of incubation: contributions to embryology. 1920;9:213-262. 5. Murray PDF. The development in vitro of the blood of the early chick embryo. Proc R Soc London. 1932;11:497-521. 6. Barker J. Development of the mouse hematopoietic system, I: types of hemoglobin produced in embryonic yolk sac and liver. Dev Biol. 1968;18:14-29[CrossRef][Medline] [Order article via Infotrieve].
7.
Brotherton T, Chui D, Gauldie J, Patterson M.
Hemoglobin ontogeny during normal mouse fetal development.
Proc Natl Acad Sci U S A.
1979;76:2853-2857 8. Haar JL, Ackerman GA. A phase and electron microscopic study of vasculogenesis and erythropoiesis in the yolk sac of the mouse. Anat Rec. 1971;170:199-223[CrossRef][Medline] [Order article via Infotrieve].
9.
Palis J, McGrath KE, Kingsley PD.
Initiation of hematopoiesis and vasculogenesis in murine yolk sac explants.
Blood.
1995;86:156-163 10. Palis J, Robertson S, Kennedy M, Wall C, Keller G. Development of erythroid and myeloid progenitors in the yolk sac and embryo proper of the mouse. Development. 1999;126:5073-5084[Abstract]. 11. Dieterlen-Lievre F. On the origin of haemopoietic stem cells in the avian embryo: an experimental approach. J Embryol Exp Morphol. 1975;33:607-619[Medline] [Order article via Infotrieve]. 12. Godin IE, Garcia-Porrero JA, Coutinho A, Dieterlen-Lievre F, Marcos MA. Para-aortic splanchnopleura from early mouse embryos contains B1a cell progenitors. Nature. 1993;364:67-70[CrossRef][Medline] [Order article via Infotrieve]. 13. Medvinsky AL, Samoylina NL, Müller AM, Dzierzak EA. An early pre-liver intra-embryonic source of CFU-S in the developing mouse. Nature. 1993;364:64-67[CrossRef][Medline] [Order article via Infotrieve]. 14. Muller AM, Medvinsky A, Strouboulis J, Grosveld F, Dzierzak E. Development of hematopoietic stem cell activity in the mouse embryo. Immunity. 1994;1:291-301[CrossRef][Medline] [Order article via Infotrieve].
15.
Godin I, Dieterlen-Lievre F, Cumano A.
Emergence of multipotent hemopoietic cells in the yolk sac and paraaortic splanchnopleura in mouse embryos, beginning at 8.5 days postcoitus.
Proc Natl Acad Sci U S A.
1995;92:773-777 16. Doetschman TC, Eistetter H, Katz M, Schmidt W, Kemler R. The in vitro development of blastocyst-derived embryonic stem cell lines: formation of visceral yolk sac, blood islands and myocardium. J Embryol Exp Morphol. 1985;87:27-45[Medline] [Order article via Infotrieve].
17.
Schmitt R, Bruyns E, Snodgrass H.
Hematopoietic development of embryonic stem cells in vitro: cytokine and receptor gene expression.
Genes Dev.
1991;5:728-740 18. Burkert U, von Ruden T, Wagner EF. Early fetal hematopoietic development from in vitro differentiated embryonic stem cells. New Biol. 1991;3:698-708[Medline] [Order article via Infotrieve].
19.
Keller G, Kennedy M, Papayannopoulou T, Wiles M.
Hematopoietic commitment during embryonic stem cell differentiation in culture.
Mol Cell Biol.
1993;13:473-486
20.
Nakano T, Kodama H, Honjo T.
Generation of lymphohematopoietic cells from embryonic stem cells in culture.
Science.
1994;265:1098-1101 21. Keller G. In vitro differentiation of embryonic stem cells. Curr Opin Cell Biol. 1995;7:862-869[CrossRef][Medline] [Order article via Infotrieve].
22.
Weiss M, Keller G, Orkin S.
Novel insights into erythroid development revealed through in vitro differentiation of GATA-1 23. Tsai FY, Keller G, Kuo FC, et al. An early haematopoietic defect in mice lacking the transcription factor GATA-2. Nature. 1994;371:221-226[CrossRef][Medline] [Order article via Infotrieve]. 24. Porcher C, Swat W, Rockwell K, Fujiwara Y, Alt FW, Orkin SH. The T cell leukemia oncoprotein SCL/tal-1 is essential for development of all hematopoietic lineages. Cell. 1996;86:47-57[CrossRef][Medline] [Order article via Infotrieve].
25.
Vittet D, Prandini MH, Berthier R, et al.
Embryonic stem cells differentiate in vitro to endothelial cells through successive maturation steps.
Blood.
1996;88:3424-3431 26. Okuda T, van Deursen J, Hiebert SW, Grosveld G, Downing JR. AML1, the target of multiple chromosomal translocations in human leukemia, is essential for normal fetal liver hematopoiesis. Cell. 1996;84:321-330[CrossRef][Medline] [Order article via Infotrieve].
27.
Wang Q, Stacy T, Binder M, Marin-Padilla M, Sharpe A, Speck N.
Disruption of the Cbfa2 gene causes necrosis and hemorrhaging in the central nervous system and blocks definitive hematopoiesis.
Proc Natl Acad Sci U S A.
1996;93:3444-3449
28.
Elefanty AG, Robb L, Birner R, Begley CG.
Hematopoietic-specific genes are not induced during in vitro differentiation of scl-null embryonic stem cells.
Blood.
1997;90:1435-1447 29. Robertson SM, Kennedy M, Shannon JM, Keller G. A transitional stage in the commitment of mesoderm to hematopoiesis requiring the transcription factor SCL/tal-1. Development. 2000;127:2447-2459[Abstract]. 30. Choi K, Kennedy M, Kazarov A, Papadimitriou JC, Keller G. A common precursor for hematopoietic and endothelial cells. Development. 1998;125:725-732[Abstract]. 31. Nishikawa SI, Nishikawa S, Hirashima M, Matsuyoshi N, Kodama H. Progressive lineage analysis by cell sorting and culture identifies FLK1+VE-cadherin+ cells at a diverging point of endothelial and hemopoietic lineages. Development. 1998;125:1747-1757[Abstract]. 32. Kennedy M, Firpo M, Choi K, et al. A common precursor for primitive erythropoiesis and definitive haematopoiesis. Nature. 1997;386:488-493[CrossRef][Medline] [Order article via Infotrieve]. 33. Shalaby F, Rossant J, Yamaguchi TP, et al. Failure of blood-island formation and vasculogenesis in Flk-1-deficient mice. Nature. 1995;376:62-66[CrossRef][Medline] [Order article via Infotrieve]. 34. Shalaby F, Ho J, Stanford WL, et al. A requirement for Flk1 in primitive and definitive hematopoiesis and vasculogenesis. Cell. 1997;89:981-990[CrossRef][Medline] [Order article via Infotrieve]. 35. Faloon P, Arentson E, Kazarov A, et al. Basic fibroblast growth factor positively regulates hematopoietic development. Development. 2000;127:1931-1941[Abstract].
36.
Begley CG, Aplan PD, Denning S, et al.
The gene SCL is expressed during early hematopoiesis and encodes a differentiation-related DNA-binding motif.
Proc Natl Acad Sci U S A.
1989;86:10128-10132
37.
Robb L, Lyons I, Li R, et al.
Absence of yolk sac hematopoiesis from mice with a targeted disruption of the scl gene.
Proc Natl Acad Sci U S A.
1995;92:7075-7079 38. Shivdasani R, Mayer E, Orkin SH. Absence of blood formation in mice lacking the T-cell leukemia oncoprotein tal-1/SCL. Nature. 1995;373:432-434[CrossRef][Medline] [Order article via Infotrieve].
39.
Visvader JE, Fujiwara Y, Orkin SH.
Unsuspected role for the T-cell leukemia protein SCL/tal-1 in vascular development.
Genes Dev.
1998;12:473-479
40.
Ogawa E, Maruyama M, Kagoshima H, et al.
PEBP2/PEA2 represents a family of transcription factors homologous to the products of the Drosophila runt gene and the human AML1 gene.
Proc Natl Acad Sci U S A.
1993;90:6859-6863 41. Ogawa E, Inuzuka M, Maruyama M, et al. Molecular cloning and characterization of PEBP2 beta, the heterodimeric partner of a novel Drosophila runt-related DNA binding protein PEBP2 alpha. Virology. 1993;194:314-331[CrossRef][Medline] [Order article via Infotrieve].
42.
Wang SW, Speck NA.
Purification of core-binding factor, a protein that binds the conserved core site in murine leukemia virus enhancers.
Mol Cell Biol.
1992;12:89-102
43.
Miller JD, Stacy T, Liu PP, Speck NA.
Core-binding factor beta (CBF 44. North T, Gu TL, Stacy T, et al. Cbfa2 is required for the formation of intra-aortic hematopoietic clusters. Development. 1999;126:2563-2575[Abstract]. 45. Karasuyama H, Melchers F. Establishment of mouse cell lines which constitutively secrete large quantities of interleukin 2, 3, 4, or 5 using modified cDNA expression vectors. Eur J Immunol. 1988;18:97-104[Medline] [Order article via Infotrieve]. 46. Brady G, Barbara M, Iscove N. Representative in vitro cDNA amplification from individual hematopoietic cells and colonies. Methods Mol Cell Biol. 1990;2:17-25.
47.
Silver L, Palis J.
Initiation of murine embryonic erythropoiesis: a spatial analysis.
Blood.
1997;89:1154-1164 48. Herrmann BG, Labeit S, Poustka A, King TR, Lehrach H. Cloning of the T gene required in mesoderm formation in the mouse [see comments]. Nature. 1990;343:617-622[CrossRef][Medline] [Order article via Infotrieve]. 49. Rogers MB, Hosler BA, Gudas LJ. Specific expression of a retinoic acid-regulated, zinc-finger gene, Rex-1, in preimplantation embryos, trophoblast and spermatocytes. Development. 1991;113:815-824[Abstract].
50.
Orkin S.
GATA-binding transcription factors in hematopoietic cells.
Blood.
1992;80:575-581 51. Kabrun N, Buhring HJ, Choi K, Ullrich A, Risau W, Keller G. Flk-1 expression defines a population of early embryonic hematopoietic precursors. Development. 1997;124:2039-2048[Abstract]. 52. Dumont DJ, Yamaguchi TP, Conlon RA, Rossant J, Breitman ML. Tek, a novel tyrosine kinase gene located on mouse chromosome 4, is expressed in endothelial cells and their presumptive precursors. Oncogene. 1992;7:1471-1480[Medline] [Order article via Infotrieve]. 53. Tsuji K, Noda M. Identification and expression of a novel 3'-exon of mouse Runx1/Pebp2alphaB/Cbfa2/AML1 gene. Biochem Biophys Res Commun. 2000;274:171-176[CrossRef][Medline] [Order article via Infotrieve]. 54. Garcia-Porrero JA, Godin IE, Dieterlen-Lievre F. Potential intraembryonic hemogenic sites at pre-liver stages in the mouse. Anat Embryol (Berl). 1995;192:425-435[Medline] [Order article via Infotrieve]. 55. Dieterlen-Lievre F, Martin C. Diffuse intraembryonic hemopoiesis in normal and chimeric avian development. Dev Biol. 1981;88:180-191[CrossRef][Medline] [Order article via Infotrieve].
56.
Tavian M, Coulombel L, Luton D, Clemente HS, Dieterlen-Lievre F, Peault B.
Aorta-associated CD34+ hematopoietic cells in the early human embryo.
Blood.
1996;87:67-72
57.
Yokomizo T, Ogawa M, Osato M, et al.
Requirement of Runx1/AML1/PEBP2
© 2002 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
M. Hoogenkamp, M. Lichtinger, H. Krysinska, C. Lancrin, D. Clarke, A. Williamson, L. Mazzarella, R. Ingram, H. Jorgensen, A. Fisher, et al. Early chromatin unfolding by RUNX1: a molecular explanation for differential requirements during specification versus maintenance of the hematopoietic gene expression program Blood, July 9, 2009; 114(2): 299 - 309. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. M. Perez-Campo, J. Borrow, V. Kouskoff, and G. Lacaud The histone acetyl transferase activity of monocytic leukemia zinc finger is critical for the proliferation of hematopoietic precursors Blood, May 14, 2009; 113(20): 4866 - 4874. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. McKinney-Freeman, C. Lengerke, I.-H. Jang, S. Schmitt, Y. Wang, M. Philitas, J. Shea, and G. Q. Daley Modulation of murine embryonic stem cell-derived CD41+c-kit+ hematopoietic progenitors by ectopic expression of Cdx genes Blood, May 15, 2008; 111(10): 4944 - 4953. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Pearson, P. Sroczynska, G. Lacaud, and V. Kouskoff The stepwise specification of embryonic stem cells to hematopoietic fate is driven by sequential exposure to Bmp4, activin A, bFGF and VEGF Development, April 15, 2008; 135(8): 1525 - 1535. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Yokomizo, K. Hasegawa, H. Ishitobi, M. Osato, M. Ema, Y. Ito, M. Yamamoto, and S. Takahashi Runx1 is involved in primitive erythropoiesis in the mouse Blood, April 15, 2008; 111(8): 4075 - 4080. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-R. Landry, S. Kinston, K. Knezevic, M. F.T.R. de Bruijn, N. Wilson, W. T. Nottingham, M. Peitz, F. Edenhofer, J. E. Pimanda, K. Ottersbach, et al. Runx genes are direct targets of Scl/Tal1 in the yolk sac and fetal liver Blood, March 15, 2008; 111(6): 3005 - 3014. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. K. Williamson, D. L. Smith, D. Blinco, R. D. Unwin, S. Pearson, C. Wilson, C. Miller, L. Lancashire, G. Lacaud, V. Kouskoff, et al. Quantitative Proteomics Analysis Demonstrates Post-transcriptional Regulation of Embryonic Stem Cell Differentiation to Hematopoiesis Mol. Cell. Proteomics, March 1, 2008; 7(3): 459 - 472. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Walmsley, D. Cleaver, and R. Patient Fibroblast growth factor controls the timing of Scl, Lmo2, and Runx1 expression during embryonic blood development Blood, February 1, 2008; 111(3): 1157 - 1166. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. T. Nottingham, A. Jarratt, M. Burgess, C. L. Speck, J.-F. Cheng, S. Prabhakar, E. M. Rubin, P.-S. Li, J. Sloane-Stanley, J. Kong-a-San, et al. Runx1-mediated hematopoietic stem-cell emergence is controlled by a Gata/Ets/SCL-regulated enhancer Blood, December 15, 2007; 110(13): 4188 - 4197. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Wang, P. W. Faloon, Z. Tan, Y. Lv, P. Zhang, Y. Ge, H. Deng, and J.-W. Xiong Mouse lysocardiolipin acyltransferase controls the development of hematopoietic and endothelial lineages during in vitro embryonic stem-cell differentiation Blood, November 15, 2007; 110(10): 3601 - 3609. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Pick, L. Azzola, A. Mossman, E. G. Stanley, and A. G. Elefanty Differentiation of Human Embryonic Stem Cells in Serum-Free Medium Reveals Distinct Roles for Bone Morphogenetic Protein 4, Vascular Endothelial Growth Factor, Stem Cell Factor, and Fibroblast Growth Factor 2 in Hematopoiesis Stem Cells, September 1, 2007; 25(9): 2206 - 2214. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. C. R. Perlingeiro Endoglin is required for hemangioblast and early hematopoietic development Development, August 15, 2007; 134(16): 3041 - 3048. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Yao, B. Liu, X. Wang, Y. Lan, N. Hou, X. Yang, and N. Mao Identification of High Proliferative Potential Precursors with Hemangioblastic Activity in the Mouse Aorta-Gonad- Mesonephros Region Stem Cells, June 1, 2007; 25(6): 1423 - 1430. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Li, K. K. Sinha, M. A. Hay, C. R. Rinaldi, Y. Saunthararajah, and G. Nucifora RUNX1-RUNX1 Homodimerization Modulates RUNX1 Activity and Function J. Biol. Chem., May 4, 2007; 282(18): 13542 - 13551. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Tober, A. Koniski, K. E. McGrath, R. Vemishetti, R. Emerson, K. K. L. de Mesy-Bentley, R. Waugh, and J. Palis The megakaryocyte lineage originates from hemangioblast precursors and is an integral component both of primitive and of definitive hematopoiesis Blood, February 15, 2007; 109(4): 1433 - 1441. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. T. Fraser, J. Isern, and M. H. Baron Maturation and enucleation of primitive erythroblasts during mouse embryogenesis is accompanied by changes in cell-surface antigen expression Blood, January 1, 2007; 109(1): 343 - 352. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. M. Zeigler, D. Sugiyama, M. Chen, Y. Guo, K. M. Downs, and N. A. Speck The allantois and chorion, when isolated before circulation or chorio-allantoic fusion, have hematopoietic potential Development, November 1, 2006; 133(21): 4183 - 4192. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Li, J.-W. Xiong, C. S. Shelley, H. Park, and M. A. Arnaout The transcription factor ZBP-89 controls generation of the hematopoietic lineage in zebrafish and mouse embryonic stem cells Development, September 15, 2006; 133(18): 3641 - 3650. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Liu, L. Carlsson, and T. Grundstrom Identification of an N-terminal Transactivation Domain of Runx1 That Separates Molecular Function from Global Differentiation Function J. Biol. Chem., September 1, 2006; 281(35): 25659 - 25669. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Abe and Y. Sato Puromycin insensitive leucyl-specific aminopeptidase (PILSAP) is required for the development of vascular as well as hematopoietic system in embryoid bodies. Genes Cells, July 1, 2006; 11(7): 719 - 729. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Arufe, M. Lu, A. Kubo, G. Keller, T. F. Davies, and R.-Y. Lin Directed Differentiation of Mouse Embryonic Stem Cells into Thyroid Follicular Cells Endocrinology, June 1, 2006; 147(6): 3007 - 3015. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Willey, A. Ayuso-Sacido, H. Zhang, S. T. Fraser, K. E. Sahr, M. J. Adlam, M. Kyba, G. Q. Daley, G. Keller, and M. H. Baron Acceleration of mesoderm development and expansion of hematopoietic progenitors in differentiating ES cells by the mouse Mix-like homeodomain transcription factor Blood, April 15, 2006; 107(8): 3122 - 3130. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Olsen, D. L. Stachura, and M. J. Weiss Designer blood: creating hematopoietic lineages from embryonic stem cells Blood, February 15, 2006; 107(4): 1265 - 1275. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Taoudi, A. M. Morrison, H. Inoue, R. Gribi, J. Ure, and A. Medvinsky Progressive divergence of definitive haematopoietic stem cells from the endothelial compartment does not depend on contact with the foetal liver Development, September 15, 2005; 132(18): 4179 - 4191. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Hirai, I. M Samokhvalov, T. Fujimoto, S. Nishikawa, J. Imanishi, and S.-I. Nishikawa Involvement of Runx1 in the down-regulation of fetal liver kinase-1 expression during transition of endothelial cells to hematopoietic cells Blood, September 15, 2005; 106(6): 1948 - 1955. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. S. Ng, R. P. Davis, L. Azzola, E. G. Stanley, and A. G. Elefanty Forced aggregation of defined numbers of human embryonic stem cells into embryoid bodies fosters robust, reproducible hematopoietic differentiation Blood, September 1, 2005; 106(5): 1601 - 1603. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. T. Zambidis, B. Peault, T. S. Park, F. Bunz, and C. I. Civin Hematopoietic differentiation of human embryonic stem cells progresses through sequential hematoendothelial, primitive, and definitive stages resembling human yolk sac development Blood, August 1, 2005; 106(3): 860 - 870. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Biggs, Y. Zhang, L. F. Peterson, M. Garcia, D.-E. Zhang, and A. S. Kraft Phosphorylation of AML1/RUNX1 Regulates Its Degradation and Nuclear Matrix Association Mol. Cancer Res., July 1, 2005; 3(7): 391 - 401. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kubo, V. Chen, M. Kennedy, E. Zahradka, G. Q. Daley, and G. Keller The homeobox gene HEX regulates proliferation and differentiation of hemangioblasts and endothelial cells during ES cell differentiation Blood, June 15, 2005; 105(12): 4590 - 4597. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Keller Embryonic stem cell differentiation: emergence of a new era in biology and medicine Genes & Dev., May 15, 2005; 19(10): 1129 - 1155. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. W.M. van Hinsbergh and T. J. Rabelink FGFR1 and the Bloodline of the Vasculature Arterioscler. Thromb. Vasc. Biol., May 1, 2005; 25(5): 883 - 886. [Full Text] [PDF] |
||||
![]() |
P. U. Magnusson, R. Ronca, P. Dell'Era, P. Carlstedt, L. Jakobsson, J. Partanen, A. Dimberg, and L. Claesson-Welsh Fibroblast Growth Factor Receptor-1 Expression Is Required for Hematopoietic but not Endothelial Cell Development Arterioscler. Thromb. Vasc. Biol., May 1, 2005; 25(5): 944 - 949. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. S. Ng, L. Azzola, K. Sourris, L. Robb, E. G. Stanley, and A. G. Elefanty The primitive streak gene Mixl1 is required for efficient haematopoiesis and BMP4-induced ventral mesoderm patterning in differentiating ES cells Development, March 1, 2005; 132(5): 873 - 884. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhang, J. R. Biggs, and A. S. Kraft Phorbol Ester Treatment of K562 Cells Regulates the Transcriptional Activity of AML1c through Phosphorylation J. Biol. Chem., December 17, 2004; 279(51): 53116 - 53125. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Schuringa, K. Wu, G. Morrone, and M. A.S. Moore Enforced Activation of STAT5A Facilitates the Generation of Embryonic Stem-Derived Hematopoietic Stem Cells That Contribute to Hematopoiesis In Vivo Stem Cells, December 1, 2004; 22(7): 1191 - 1204. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. K. Hadland, S. S. Huppert, J. Kanungo, Y. Xue, R. Jiang, T. Gridley, R. A. Conlon, A. M. Cheng, R. Kopan, and G. D. Longmore A requirement for Notch1 distinguishes 2 phases of definitive hematopoiesis during development Blood, November 15, 2004; 104(10): 3097 - 3105. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Ramirez-Bergeron, A. Runge, K. D. C. Dahl, H. J. Fehling, G. Keller, and M. C. Simon Hypoxia affects mesoderm and enhances hemangioblast specification during early development Development, September 15, 2004; 131(18): 4623 - 4634. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. K. Anderson, R. Pant, A. L. Miracle, X. Sun, C. A. Luer, C. J. Walsh, J. C. Telfer, G. W. Litman, and E. V. Rothenberg Evolutionary Origins of Lymphocytes: Ensembles of T Cell and B Cell Transcriptional Regulators in a Cartilaginous Fish J. Immunol., May 15, 2004; 172(10): 5851 - 5860. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Bowcock and W. O.C.M. Cookson The genetics of psoriasis, psoriatic arthritis and atopic dermatitis Hum. Mol. Genet., April 1, 2004; 13(90001): R43 - 55. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Telfer, E. E. Hedblom, M. K. Anderson, M. N. Laurent, and E. V. Rothenberg Localization of the Domains in Runx Transcription Factors Required for the Repression of CD4 in Thymocytes J. Immunol., April 1, 2004; 172(7): 4359 - 4370. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. S. Kaufman, R. L. Lewis, E. T. Hanson, R. Auerbach, J. Plendl, and J. A. Thomson Functional endothelial cells derived from rhesus monkey embryonic stem cells Blood, February 15, 2004; 103(4): 1325 - 1332. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Lacaud, V. Kouskoff, A. Trumble, S. Schwantz, and G. Keller Haploinsufficiency of Runx1 results in the acceleration of mesodermal development and hemangioblast specification upon in vitro differentiation of ES cells Blood, February 1, 2004; 103(3): 886 - 889. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Nobuhisa, M. Takizawa, S. Takaki, H. Inoue, K. Okita, M. Ueno, K. Takatsu, and T. Taga Regulation of Hematopoietic Development in the Aorta-Gonad-Mesonephros Region Mediated by Lnk Adaptor Protein Mol. Cell. Biol., December 1, 2003; 23(23): 8486 - 8494. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Alvarez-Silva, P. Belo-Diabangouaya, J. Salaun, and F. Dieterlen-Lievre Mouse placenta is a major hematopoietic organ Development, November 15, 2003; 130(22): 5437 - 5444. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Palis Putting a Hex on blood and endothelium Blood, October 1, 2003; 102(7): 2315 - 2316. [Full Text] [PDF] |
||||
![]() |
Y. Guo, R. Chan, H. Ramsey, W. Li, X. Xie, W. C. Shelley, J. P. Martinez-Barbera, B. Bort, K. Zaret, M. Yoder, et al. The homeoprotein Hex is required for hemangioblast differentiation Blood, October 1, 2003; 102(7): 2428 - 2435. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Ferkowicz, M. Starr, X. Xie, W. Li, S. A. Johnson, W. C. Shelley, P. R. Morrison, and M. C. Yoder CD41 expression defines the onset of primitive and definitive hematopoiesis in the murine embryo Development, September 15, 2003; 130(18): 4393 - 4403. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Chan, S. A. Johnson, Y. Li, M. C. Yoder, and G.-S. Feng A definitive role of Shp-2 tyrosine phosphatase in mediating embryonic stem cell differentiation and hematopoiesis Blood, September 15, 2003; 102(6): 2074 - 2080. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. J. Fehling, G. Lacaud, A. Kubo, M. Kennedy, S. Robertson, G. Keller, and V. Kouskoff Tracking mesoderm induction and its specification to the hemangioblast during embryonic stem cell differentiation Development, September 1, 2003; 130(17): 4217 - 4227. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Chadwick, L. Wang, L. Li, P. Menendez, B. Murdoch, A. Rouleau, and M. Bhatia Cytokines and BMP-4 promote hematopoietic differentiation of human embryonic stem cells Blood, August 1, 2003; 102(3): 906 - 915. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kubo and K. Alitalo The bloody fate of endothelial stem cells Genes & Dev., February 1, 2003; 17(3): 322 - 329. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2002 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||