Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
Prepublished online as a Blood First Edition Paper on April 17, 2002; DOI 10.1182/blood-2001-12-0321.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2001-12-0321v1
100/2/458    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lacaud, G.
Right arrow Articles by Keller, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lacaud, G.
Right arrow Articles by Keller, G.
Related Collections
Right arrow Hematopoiesis and Stem Cells
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, 15 July 2002, Vol. 100, No. 2, pp. 458-466

HEMATOPOIESIS

Runx1 is essential for hematopoietic commitment at the hemangioblast stage of development in vitro

Georges Lacaud, Lia Gore, Marion Kennedy, Valerie Kouskoff, Paul Kingsley, Christopher Hogan, Leif Carlsson, Nancy Speck, James Palis, and Gordon Keller

From the Carl C. Icahn Institute for Gene Therapy and Molecular Medicine, Mount Sinai School of Medicine, New York, NY; Department of Pediatrics, Division of Hematology-Oncology, and the Division of Medical Oncology, University of Colorado Health Sciences Center and Children's Hospital, Denver; Department of Pediatrics and the Center for Human Genetics and Molecular Pediatric Disease, University of Rochester, NY; Department of Molecular Biology, Umeå University, Sweden; and Department of Biochemistry, Dartmouth Medical School, Hanover, NH.


    Abstract
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

In this report we demonstrate a role for Runx1 (AML1) at the hemangioblast stage of hematopoietic and endothelial development in embryonic stem (ES) cell-derived embryoid bodies (EBs). Runx1 is expressed in EBs during the appearance of precursors with hemangioblast properties, the blast colony-forming cells (BL-CFCs). Cell sorting studies revealed that all BL-CFCs within EBs express Runx1. Runx1-deficient EBs consistently generate 10- to 20-fold fewer blast colonies than wild-type controls and display a complete block in definitive hematopoiesis. Despite this defect, Runx1-/- EBs and yolk sacs from mutant embryos generate normal numbers of primitive erythroid precursors. These observations clearly demonstrate that Runx1 functions early in hematopoietic development, and they support the interpretation that the primitive erythroid lineage is established early by a subset of BL-CFCs that develop in a Runx1-independent fashion. (Blood. 2002;100:458-466)

© 2002 by The American Society of Hematology.

    Introduction
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Hematopoiesis in the mouse embryo begins in the yolk sac, where blood islands of mesodermal origin develop at approximately day 8 of gestation (E8).1,2 These blood islands consist of 2 distinct lineages, a population of erythroblasts and a surrounding layer of angioblasts that will form the first vascular structures.3 The parallel temporal development of these lineages in physical proximity provided the basis for the hypothesis that they arise from a common precursor, a cell called the hemangioblast.4,5 Erythroid cells within the blood islands, known as embryonic or primitive erythrocytes, are large and nucleated, and they produce the embryonic forms of globin.1,6,7 Generation of the primitive erythroid lineage is known as primitive hematopoiesis, and it represents a transient developmental program that is restricted to the yolk sac between the primitive streak and 20 somite pair (sp) stages of development.8-10 Definitive hematopoiesis encompasses the development of all lineages other than primitive erythroid and includes definitive erythroid, myeloid, and lymphoid. As with primitive hematopoiesis, the first definitive hematopoietic precursors also develop in the yolk sac and can be detected as early as the primitive streak stage of development.10 Although initiated in this extra-embryonic region, definitive hematopoiesis is most often associated with intra-embryonic sites such as the para-aortic splanchnopleura (P-Sp), the aorta-gonad-mesonephros (AGM), and the fetal liver, where long-term repopulating stem cells and precursor populations from different lineages undergo significant expansion and maturation.11-15

Although yolk sac blood islands were identified as the earliest site of hematopoietic and endothelial development almost 100 years ago, attempts to identify, isolate, and characterize the precursors representing these initial stages of lineage commitment, including the elusive hemangioblast, have been largely hampered by the inaccessibility of the early mammalian embryo. One promising alternative approach to study early hematopoietic development is the model system based on the differentiation potential of embryonic stem (ES) cells in culture.16-21 Most evidence suggests that the events leading to the establishment of the hematopoietic and endothelial lineages in embryoid bodies (EBs) generated from ES cells in culture are similar, if not identical, to those in the early yolk sac.19,22-29 Using the ES/EB differentiation model, cells with hemangioblast potential have been identified.30,31 In the presence of vascular endothelial growth factor (VEGF) in methylcellulose cultures, these EB-derived precursors generate blast cell colonies that display hematopoietic and endothelial potential.30,32 The cells that give rise to these blast colonies, the blast colony-forming cells (BL-CFCs), represent a transient population that appears in EBs before the establishment of any other hematopoietic lineages. The developmental potential of the BL-CFC strongly suggests that it represents the in vitro equivalent of the hemangioblast and, as such, the earliest stage of hematopoietic and endothelial commitment.

Although a precursor with hemangioblast properties remains to be identified in the early embryo, insights into the molecular events involved in the establishment of the earliest hematopoietic and endothelial lineages have been provided by gene-targeting experiments. Such studies have uncovered the role of specific genes at distinct stages in this process and, in doing so, have been instrumental in defining key developmental steps in the commitment, growth, and maturation of these lineages. Flk-1, a gene that encodes a receptor tyrosine kinase, is required early in ontogeny and is essential for the development of the hematopoietic and the endothelial components of the blood island.33 Cell tracking studies have indicated that the Flk-1 receptor is initially involved in migration of the mesodermal precursor cells to the extraembryonic region of the embryo, the site of yolk sac development.34 These migrating precursors may be similar to the EB-derived BL-CFCs that have been shown to express Flk-135 and to grow in response to its ligand, VEGF.32

Scl, a member of the helix-loop-helix family of transcription factors,36 appears to function at a slightly later developmental stage than Flk-1. The yolk sacs of Scl-/- embryos develop a primary vascular network but contain no primitive or definitive hematopoietic cells, indicating a pivotal role for Scl in hematopoietic commitment but not in the early stages of vasculogenesis.36-38 Although not essential for establishment of the endothelial lineage, Scl does appear to be required for remodeling and maturation of the vascular system.39 In vitro differentiation studies with Scl-/- ES cells showed a complete block in primitive and definitive hematopoietic potential, confirming the developmental defect observed in vivo.24 Further analysis of the Scl-/- EBs revealed a defect as early as the BL-CFC because the mutant ES cells were unable to generate blast cell colonies.29,35 Scl-/- ES cells were, however, able to generate precursors that gave rise to transitional colonies that represent a stage of development slightly earlier than the blast cell colony.29

The AML1 gene (recently renamed Runx1), which encodes the DNA-binding subunit of a transcription factor of the core binding factor (CBF) family,40-42 is required for the establishment of definitive but not primitive hematopoiesis. Runx1-/- embryos develop normal blood islands and progress through the yolk sac phase of hematopoiesis but die between E11 and E12.5.26,27 Before death, the liver rudiment contains primitive nucleated erythrocytes but lacks all definitive erythroid, myeloid, and megakaryocytic cells, indicating a complete block in the development of the definitive hematopoietic program. Analysis of Runx1-/- EBs revealed a similar block in definitive hematopoietic potential.26,43 In addition to the hematopoietic abnormalities, Runx1-deficient animals show extensive central nervous system hemorrhage and necrosis, suggesting an additional vascular defect.

Although these targeting studies position Runx1 at the establishment and expansion of the definitive hematopoietic program, expression analysis suggest that it may function at earlier stages of development. Using mice with the LacZ gene targeted to the Runx1 locus (Runx1+/Z mice), North et al44 demonstrated expression of Runx1 (LacZ) in subpopulations of endothelial cells in the yolk sac, in the vitelline and umbilical arteries, and in the ventral wall of the dorsal aorta. Expression was also detected in emerging primitive erythrocytes early in the yolk sac. Expression in these cells was transient, declined significantly by E8.5, and was undetectable by E10.5. The presence of Runx1 transcripts in primitive erythrocytes and in subpopulations of endothelial cells suggests that this gene may be expressed and may function at the level of a cell with hemangioblast properties.

To investigate the role of Runx1 at the earliest stage of hematopoietic commitment, we analyzed its expression pattern and function during ES/EB differentiation and in early yolk sac development. Our results indicate that Runx1 is expressed in yolk sac mesodermal cells before the establishment of the blood islands and within the BL-CFCs in EBs. Analysis of Runx1-deficient ES cells demonstrated that this gene is essential for the generation of normal numbers of blast colonies and, as such, provides evidence that it does function at the equivalent of the hemangioblast stage of development. BL-CFCs that develop in the deficient EBs appear to be primitive erythroid restricted, suggesting that the functional requirement for Runx1 may define subpopulations of these precursors.


    Materials and methods
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

In situ hybridization

In situ hybridization of outbred ICR (Taconic, Germantown, NY) murine embryos was performed as previously described9 with the following modifications. Single-stranded 33P-labeled antisense Runx1 and sense control probes (accession number W29200) were prepared at specific activities of 4 × 109 dpm/µg. After hybridization and high-stringency washes, tissues were counterstained with hematoxylin. Bright-field and dark-field images were captured with a Polaroid digital camera and were processed, including pseudocolorizing grains, using Adobe Photoshop (Adobe Systems). No signal above background was observed in the negative controls.

Embryonic stem cell growth and differentiation

The generation of Runx1+/-, Runx1-/-, and Runx1+/z J1 ES cells has been previously described.27,44 ES cells were maintained on irradiated embryonic feeder cells in Dulbecco modified Eagle medium supplemented with 15% fetal calf serum (FCS), penicillin, streptomycin, leukemia inhibitory factor (LIF) (1% conditioned medium), and 1.5 × 10-4 M monothioglycerol (MTG; Sigma, St Louis, MO). Two days before the onset of differentiation, cells were transferred to gelatinized plates in the same media. For the generation of EBs, ES cells were trypsinized and plated at various densities in differentiation cultures. Differentiation of EBs was carried out in 60-mm Petri-grade dishes in Iscoves modified Dulbecco medium (IMDM) supplemented with 15% FCS, 2 mM L-glutamine (Gibco/BRL, Grand Island, NY), transferrin (200 µg/mL), 0.5 mM ascorbic acid (Sigma), and 4.5 × 10-4 M MTG. Cultures were maintained in a humidified chamber in a 5% CO2-air mixture at 37°C.

Colony assays

For the generation of blast cell colonies (BL-CFC assay), EB cells were plated in 1% methylcellulose supplemented with 10% FCS (Summit, Fort Collins, CO), VEGF (5 ng/mL), c-kit ligand (KL; 1% conditioned medium), interleukin-6 (IL-6; 5 ng/mL), and 25% D4T endothelial cell-conditioned medium.32 Transitional colonies were generated in the same basic conditions in the absence of VEGF. Colonies were scored after 4 days of culture. For the growth of hematopoietic precursors, cells were plated in 1% methylcellulose containing 10% plasma-derived serum (Antech, Tyler, TX), 5% protein-free hybridoma medium (PFHM-II; Gibco-BRL), and cytokines KL (1% conditioned medium), thrombopoietin (5 ng/mL), Erythropoietin (2 U/mL), IL-11 (25 ng/mL), IL-3 (1% conditioned medium), granulocyte-macrophage colony-stimulating factor (GM-CSF; 3 ng/mL), G-CSF (30 ng/mL), M-CSF (5 ng/mL), and IL-6 (5 ng/mL). Cultures were maintained at 37°C, 5% CO2. Primitive erythroid colonies were scored at day 5 to 6 of culture, whereas definitive erythroid, macrophage, and multilineage colonies were counted after 7 to 10 days of culture.

For expansion of blast cell colonies, individual colonies were transferred to Matrigel-coated (Collaborative Research, San Jose, CA) microtiter wells containing IMDM with 10% FCS (Hyclone, Logan, UT), 10% horse serum (Biocell, Rancho Dominguez, CA), VEGF (5 ng/mL), insulinlike growth factor 1 (IGF-1) (10 ng/mL), erythropoietin (2 U/mL), basic fibroblast growth factor (bFGF) (10 ng/mL), IL-11 (50 ng/mL), KL (1% conditioned medium), IL-3 (1% conditioned medium), L-glutamine (1%), and 4.5 × 10-4 M MTG. After 4 days of growth, the nonadherent cells of each well were harvested and cultured in 1 mL methylcellulose containing the above mixture of cytokines used for the growth of hematopoietic precursors. LIF and c-kit ligand were derived from media conditioned by Chinese hamster ovary cells transfected with LIF and KL expression vectors, respectively (kindly provided by Genetics Institute, Cambridge, MA). IL-3 was obtained from medium conditioned by X63 AG8-653 myeloma cells transfected with a vector expressing IL-3.45 VEGF, GM-CSF, M-CSF, G-CSF, thrombopoietin, IL-6, and IL-11 were purchased from R&D Systems (Minneapolis, MN).

X-gal staining

Undifferentiated ES cells, differentiated EBs, and hematopoietic colonies were fixed in 1× phosphate-buffered saline (PBS) containing 0.5% glutaraldehyde (Sigma) and 1 mM MgCl2 for 10 to 15 minutes. After fixation, the cells were rinsed in 1× PBS and stained with 1 mM MgCl2, 3.3 mM K4Fe(CN)6, 3.3 mM K3Fe(CN)6, 0.02% NP-40, and 0.1 vol 2% X-gal (Sigma) overnight at 37°C. Positive cells were detected by the presence of blue staining visualized under light microscopy.

FACS-gal analysis

Fluorescein di-beta -D-galactopyrosanide (FDG; Sigma), hydrolyzed to fluorescein by intracellular beta -galactosidase, was used to detect LacZ activity. EB-derived cells were washed and resuspended in 1× PBS-20% FCS to a final maximum concentration of 107 cells/mL. Hypotonic loading was achieved by a 2-minute incubation at 37°C with an equal volume of prewarmed 2 mM FDG (in water). After the loading procedure, 10 vol cold IMDM-15% FCS were added, and the mixture was incubated 20 minutes on ice. Stained suspensions were analyzed on a FACScan (Becton Dickinson, San Jose, CA) or sorted on a MoFlo (Cytomation Systems, Fort Collins, CO) cell sorter.

Gene expression analysis

For polyA+ global amplification polymerase chain reaction (PCR), reverse transcription (RT), poly-A tailing, and PCR procedures were performed as described by Brady et al,46 with the exception that the X-dT oligonucleotide was shortened to 5'-GTTAACTCGAGAATTC(T)24-3'. Amplified products from PCR were separated on agarose gels and transferred to a Zeta-probe GT membrane (Bio-Rad, Hercules, CA). Resultant blots were hybridized with 32P randomly primed cDNA fragments (Ready-to-Go Labeling; Pharmacia, Piscataway, NJ) corresponding to the 3' region of the genes (for all except beta -H1). A beta  H1-specific probe was prepared by annealing 2 oligonucleotides, TGGAGTCAAAGAGGGCATCATAGACACATGGG and CAGTACACTGGCAATCCCATGTG, that share an 8-base homology at their 3' termini. This beta  H1-specific probe was labeled with 32P using a Klenow fill-in reaction. For gene-specific PCR, total RNA was extracted from each sample with the RNeasy mini-kit and treated with Rnase-free DNase (Qiagen, Valencia, CA). Two micrograms total RNA were reverse-transcribed into cDNA with random hexamer using the Omniscript RT kit (Qiagen). PCR was carried out using the following oligonucleotides: beta -actin, 5'ATGAAGATCCTGACCGAGCG3' (sense), 5'TACTTGCGCTCAGGAGGAGC3' (antisense); Brachyury, 5'CTAGTACTCTTTCTTGCTGG3' (sense), 5'GGTCTCGGGAAAGCAGTGGC3' (antisense); Runx1, 5'CCAGCAAGCTGAGGAGCGGCG3' (sense), 5'CGGATTTGTAAAGACGGTGA3' (antisense); Flk1, 5'CACCTGGCACTCTCCACCTTC3'(sense), 5'GATTTCATCCCACTACCGAAAG3' (antisense); and Scl, 5'ATGGAGATTTCTGATGGTCCTCAC3' (sense), 5'AAGTGTGCTTGGGTGTTGGCTC3 (antisense).

PCR was performed with 2.5 U Taq polymerase (Promega, Madison, WI), PCR buffer, 2.5 mM MgCl2, 0.2 µM each primer, and 0.2 mM dNTP. Cycling conditions were as follows; 94°C for 5 minutes followed by 35 cycles of amplification (94°C denaturation for 1 minute, 60°C annealing for 1 minute, 72°C elongation for 1 minute), with a final incubation at 72°C for 7 minutes.


    Results
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Runx1 is expressed during gastrulation in extra-embryonic mesoderm before formation of blood islands

To further assess the role of Runx1 in the establishment of the hematopoietic system, we mapped its expression before and during the development of blood islands in E7.25 to E8.25 embryos. Runx1 transcripts were detected at the mid-to-late primitive streak stage (E7.25), specifically in extraembryonic mesoderm cells adjacent to visceral endoderm (Figure 1A). This pattern of expression in extraembryonic mesoderm persisted in early neural plate embryos (E7.5, Figure 1B). At mid-to-late neural plate stages, Runx1 mRNA was present predominantly in nascent yolk sac blood islands (Figure 1C and data not shown). In addition, there was a low level of expression in the developing chorion that increased by early somite pair stages (E8.25, Figure 1D). At E8.25, the predominant accumulation of Runx1 mRNA was in the developing yolk sac blood islands (Figure 1D). The early expression of Runx1 described here is similar to that observed for Scl47 and is consistent with a role in the commitment of mesoderm to hematopoietic-endothelial fates.


View larger version (106K):
[in this window]
[in a new window]
 
Figure 1. Expression of Runx1 mRNA during gastrulation in the mouse embryo (E7.25-E8.25). (A) Mid-to-late primitive streak stage embryo (E7.25) with Runx1 mRNA accumulation in mesoderm cells adjacent to visceral endoderm in the forming yolk sac (arrowhead). (B) Early neural plate embryo (E7.5) with increased Runx1 transcripts in the yolk sac mesoderm (arrowhead). (C) Late neural plate embryo (E7.75) reveals Runx1 expression in nascent yolk sac blood islands (arrowhead) and in the mesoderm component of the chorion (open triangle). (D) Early somite-stage embryo (E8.25) displays Runx1 mRNA accumulation in expanding blood islands of the yolk sac (arrowheads) and in the chorion (open triangles). a indicates amniotic cavity.

Runx1 expression is up-regulated at the hemangioblast stage of EB differentiation

The above analyses indicate that Runx1 is expressed at the earliest stage of blood island development, suggesting a potential role at the level of the putative hemangioblast. To further investigate the function of Runx1 at the onset of hematopoietic development, we analyzed its expression pattern in EBs over a 10-day differentiation period. A low level of Runx1 expression was detected in undifferentiated ES cells and in EBs after the first few days of differentiation (Figure 2A). Runx1 expression increased significantly between days 3 and 4 of differentiation and remained elevated thereafter. Based on real-time PCR analysis, the magnitude of the increase in Runx1 expression over this 24-hour period was found to be approximately 10-fold (not shown). No Runx1 cDNA was detected in EBs generated from Runx1-/- ES cells. Comparative analysis of Runx1 expression with other genes demonstrated a striking similarity to the temporal expression pattern of Flk-1. The up-regulation of both Runx1 and Flk-1 was preceded by the expression of Brachyury, a marker of early mesoderm development.48 Rex-1, a zinc finger transcription factor expressed in ES cells but not in their differentiated progeny,49 was readily detected in undifferentiated ES cells but not significantly in day 3 EBs. Scl was expressed at low levels as early as day 3.5 of differentiation. The levels increased over the next few days and then remained relatively constant. Gata-1, a transcription factor expressed in hematopoietic but not endothelial cells50 and in the embryonic beta  H1 and adult beta  major globins, followed the onset of Scl expression. These findings suggest that Runx1 expression is up-regulated at the hemangioblast stage of development (as defined by Flk-1 and Scl), following the establishment of the earliest mesodermal population (Brachyury) but preceding the commitment to the hematopoietic lineage (Gata-1, beta  H1, beta  major globin).


View larger version (57K):
[in this window]
[in a new window]
 
Figure 2. Gene expression analysis of EBs. (A) Gene expression in Runx1+/+ and Runx1-/- EBs. Numbers on top of the figure indicate day of EB differentiation. ES represents undifferentiated ES cells. Runx1 and beta -actin expression was determined using specific oligonucleotides. Expression of other genes was evaluated using a polyA+ global amplification PCR method.46 Hybridization with a 3' probe from the L32 ribosomal protein gene was included to control for amounts of cDNA loaded. (B) X-gal staining of Runx1+/+ and Runx1+/Z EBs. Numbers indicate day of EB differentiation. Original magnification day 0, × 400; days 2 to 4, × 200; and days 6 to 10, × 40. (C) Flow cytometry analysis of FDG stained Runx1+/+ and Runx1+/Z EBs. (D) FACS analysis of Flk-1 and Runx1 expression in days 3, 3.5, and 4 Runx1+/Z EBs. Numbers in quadrant represent the percentage of total population in each fraction.

The up-regulation of Runx1 expression detected during EB differentiation could reflect an increase in the level of expression within a subset of cells or an increase in the number of cells expressing this gene. To distinguish between these 2 possibilities, we analyzed EBs generated from Runx1+/Z ES cells that contain the LacZ gene targeted to the Runx1 gene.44 LacZ expression was evaluated either by direct X-gal staining or by FDG staining followed by flow cytometry analyses. Using both methods of detection, no significant staining was observed in undifferentiated ES cells (day 0) or in early EBs (up to 2.5 days) (Figure 2B-C). LacZ+ cells were first detected within the EBs by day 3 of differentiation, at which time approximately 5% of cells expressed this marker as determined by fluorescence-activated cell sorter (FACS) analysis. The number of positive cells increased dramatically over the next 24 hours, reaching levels greater than 30% of the total EB population by day 4 of differentiation. The frequency of LacZ+ cells remained elevated (from 30% to 50%) in EBs between days 5 and 10 of differentiation (Figure 2B and not shown). X-gal staining revealed that a large portion of individual EBs at day 4 to 6 of differentiation expressed LacZ. No significant level of beta -galactosidase activity was detected in control wild-type (Runx1+/+) EBs. These findings demonstrate an early and rapid expansion of cells expressing Runx1, with kinetics almost identical to the expansion of the Flk-1+ population51 and the development of the BL-CFC.30 To determine whether the Runx1+ and Flk-1+ cells represent distinct or overlapping populations, we analyzed developing EBs for the presence of both markers. At days 3.0 and 3.5 of differentiation, most LacZ+ cells also expressed Flk-1 (Figure 2D). By day 4 of differentiation, however, a significant population of Flk1-/LacZ+ cells was detected. These patterns suggest that the expression of Runx1 within a subpopulation of Flk-1+ cells at these early stages of differentiation could define the emergence of the BL-CFC.

Runx1 is expressed in blast colonies and BL-CFCs

Given the early expression pattern observed in EBs, we next investigated Runx1 expression in blast colonies and populations derived from them. As shown in Figure 3A, blast colonies generated from Runx1+/Z EBs uniformly stained positive for beta -galactosidase activity. In contrast, no staining was observed in control Runx1+/+ blast colonies. This indicates that the cells within these colonies, which have previously been shown to represent hematopoietic and endothelial precursors,30 express Runx1. When individual blast colonies are transferred to microtiter wells under appropriate growth conditions, these precursors grow and mature into adherent endothelial cells and a nonadherent population of hematopoietic cells after 4 days of culture. Analysis of these subpopulations demonstrated extensive LacZ expression in the hematopoietic cells (Figure 3B). Expression was also detected in the adherent cells, though the levels were significantly lower than in the hematopoietic population (Figure 3B, arrowheads). Expression in the adherent population is consistent with the observation that Runx1 is expressed in subsets of endothelial cells in the yolk sac and embryo proper.44


View larger version (57K):
[in this window]
[in a new window]
 
Figure 3. Runx1 gene expression in blast colonies and BL-CFC. (A) X-gal staining of Runx1+/+ and Runx1+/Z blast colonies. Colonies were generated from day 3.5 EB-derived cells and were stained after 4 days of growth. Original magnification × 200. (B) X-gal staining of nonadherent and adherent cells derived from Runx1+/+ and Runx1+/Z blast colonies. Arrowheads indicate LacZ+ adherent cells. Original magnification × 400. (C) Upper portion of figure shows FACS profile of FDG-stained day 3.75 Runx1+/Z EBs. LacZ-negative (Neg) and -positive (Pos) fractions isolated by cell sorting are indicated. Sorting gates were set by comparing the staining of the +/Z cells to the wild-type (+/+) cells. Middle portion shows number of blast colonies generated by the different sorted fractions. Colonies were scored at day 4 of culture. Bars represent standard error of the mean number of colonies from at least 3 cultures. RT-PCR gene expression analysis of LacZ-positive and -negative fractions of day 3.75 EBs is depicted in the lower portion. PCR products for Runx1 and beta -actin were detected by hybridization with specific 32P-labeled probes. Products for Brachyury, Flk-1, Scl, Gata-1, and beta  H1 were visualized following ethidium bromide staining and are presented as a negative image. (D) Cell sorting of FDG-stained day 3 Runx1+/Z EBs. Secondary EBs (2° EBs), transitional colonies (Trans), and blast colonies (Blast) were scored 4 days following replating of the isolated fractions. Bars represent standard error of the mean number of colonies from at least 3 cultures.

To determine whether the BL-CFC also expresses Runx1, day 3.75 Runx1+/Z EB cells were fractionated for beta -galactosidase activity by cell sorting (Figure 3C). Higher levels of Runx1 expression were detected in cells from the LacZ-positive fraction than in those from the negative fraction, confirming that separation of cells based on beta -galactosidase activity resulted in an enrichment of Runx1-expressing cells. Analysis of BL-CFC content revealed that most precursors were present in the LacZ+ population, demonstrating that most BL-CFCs isolated from day 3.75 EBs express Runx1. To further define the developmental status of the day 3.75 LacZ+ (Runx1+) cells, we analyzed this fraction for the expression of other genes known to play a role in early hematopoietic commitment and maturation. Runx1+ cells were found to contain lower levels of Brachyury than those in the negative fraction, indicating that this population is exiting the mesodermal stage of development. Flk-1 was expressed in both the positive and the negative fractions, a finding consistent with the previous FACS analyses that demonstrated the presence of Flk-1+/Runx1+ and Flk-1+/Runx1- populations in comparably staged EBs (Figure 2D). The higher levels of Scl and Gata-1 in the positive fraction are consistent with its elevated BL-CFC content and further support the interpretation that Runx1 expression defines one of the earliest stages of hematopoietic commitment. Low levels of beta H1 globin were present in the LacZ+ (Runx1+) fraction, indicating the onset of differentiation to the primitive erythroid lineage.

To evaluate whether earlier developing BL-CFCs also express Runx1, day 3 Runx1+/Z EBs were fractionated for beta -galactosidase activity. In addition to BL-CFCs, EBs at this stage of development contain some residual ES cells and precursors (Trans-CFC) that generate transitional colonies. Transitional colonies represent an earlier stage of development than blast colonies and contain cell populations undergoing commitment of mesoderm to the hematopoietic and endothelial lineages.29 As observed for day 3.75 BL-CFCs, almost all day 3.0 BL-CFCs were present in the LacZ+ fraction (Figure 3D). In contrast, the Trans-CFC and the ES cells that generate secondary EBs segregated to the LacZ- fraction, indicating that they do not express Runx1 (Figure 3D). Taken together, the findings from the cell-sorting studies clearly demonstrate that the BL-CFC, a precursor with hemangioblast characteristics, expresses Runx1.

Runx1-/- ES cells display a defect in BL-CFC developmental potential

To examine the requirement for the Runx1 gene in BL-CFC development, day 3.5 and 4 EBs generated from Runx1-/-, Runx1+/-, and Runx1+/+ ES cells were analyzed for BL-CFC content. At both time points, the Runx1-/- EB cells displayed a profound defect in BL-CFC potential. Runx1-deficient EBs consistently generated 10- to 20-fold fewer blast colonies than wild-type controls (Figure 4A). The blast colonies that did develop from the Runx1-/- EB cells were similar in morphology to those generated from wild-type cells (Figure 5A, top). To confirm that Runx1 was indeed critical for blast colony development, we attempted to rescue the defect by retroviral-mediated expression of this gene in deficient cells. As shown in Figure 4B, day 3 and 3.75 EBs generated from Runx1-/- ES cells infected with a retroviral vector encoding Runx1, and selected for puromycin resistance, produced higher numbers of blast colonies than EBs from ES cells infected with the empty retrovirus. These findings strongly suggest that Runx1 plays a pivotal role at the stage of BL-CFC development.


View larger version (24K):
[in this window]
[in a new window]
 
Figure 4. Analysis of BL-CFC potential of Runx1+/+, Runx1+/-, and Runx1-/- EBs. (A) Number of blast colonies generated by day 3.5 and 4 Runx1+/+ (+/+), Runx1+/- (+/-), and Runx1-/- (-/-) EB-derived cells. Two Runx1-/- clones (-/-A, -/-B) were analyzed. Bars represent standard error of the mean number of colonies from at least 3 cultures. (B) Rescue of the BL-CFC potential of Runx1-/- ES cells. Runx1-/- ES cells infected with either a retrovirus expressing the Runx1b isoform of the gene (MSCV Runx1) or with an empty virus control (MSCV) and selected with puromycin were differentiated for the indicated periods of time. EBs were harvested and analyzed for BL-CFCs. Bars represent standard error of the mean number of colonies from at least 3 cultures.



View larger version (61K):
[in this window]
[in a new window]
 
Figure 5. Developmental potential of Runx1-/- blast colonies. (A) Morphology of Runx1+/+ and Runx1-/- blast cell colonies (top, original magnification × 200) and the adherent and nonadherent cells generated from them following 2 days of culture (bottom, original magnification × 400). (B) Gene expression analysis of adherent cells generated by individual blast colonies. Analysis was performed by the polyA+ global amplification method. Each lane represents adherent cells derived from one blast colony. Control primitive erythroid (EP) and definitive erythroid (ED) samples are indicated. (C) Hematopoietic potential of the nonadherent population derived from expanded Runx1+/+ (+/+), Runx1+/- (+/-), and Runx1-/- (-/-) blast colonies. Nonadherent cells derived from individual colonies were harvested, and the cells were plated in conditions that support the growth of primitive and definitive colonies. The frequency of wells giving rise to total secondary colonies (clonal precursors), primitive erythroid colonies (ERY/P), or definitive hematopoietic colonies (MAC, macrophage; ERY/D, definitive erythroid; and MIX, multilineage) is represented. (D) beta  H1 globin expression in nonadherent cells generated by individual colonies. Each lane corresponds to the nonadherent cells from one expanded blast colony.

In the next set of experiments, we assessed the developmental potential of the blast colonies generated from the Runx1-/- and the rescued Runx1-/- ES cells and compared it to that of colonies from heterozygous and wild-type cells. Two different assays were used in this analysis. As a first approach, colonies were picked, transferred to microtiter wells, and cultured for 4 days to determine their potential to generate adherent (endothelial) and nonadherent (hematopoietic) cells. Colonies from each of the groups generated both types of cells (Runx1+/+ and Runx1-/-, shown in Figure 5A, bottom). After expansion, a fraction of the nonadherent cells of each well was replated in methylcellulose to assay hematopoietic potential. The remainder of the nonadherent population was analyzed for beta H1 globin gene expression as a measure of primitive erythroid potential. Adherent cells from the wild-type and Runx1-/- colonies were cultured for an additional week and then harvested and analyzed for the expression of genes associated with the endothelial lineage. This expression analysis demonstrated the presence of Flk-1 and Tie-252 transcripts in the adherent populations derived from Runx1-/- and the Runx1+/+ individual blast colonies, indicating that these cells are of the endothelial lineage (Figure 5B).

Replating studies revealed that the nonadherent populations from most Runx1+/+ and Runx1+/- blast colonies contained precursors with colony-forming potential (Figure 5C). All expanded populations that replated were found to contain definitive hematopoietic precursors. Approximately 30% of the cultures with definitive precursors also contained primitive erythroid precursors. Cultures with only primitive erythroid precursors were not detected in this set of experiments. In contrast to the wild-type cells, nonadherent populations from Runx1-/- blast colonies contained few, if any, precursors. No precursors were detected in the experiment shown in Figure 5C; however, primitive erythroid precursors were occasionally found in other studies. The nonadherent fraction of the rescued Runx1-/- blast colonies did contain precursors of the definitive hematopoietic lineages (macrophage and mix), demonstrating that this potential was rescued in the BL-CFCs. Although the precursor content was low in the nonrescued Runx1-/- cultures, beta H1 globin expression was readily detectable in the nonadherent cells, indicating the presence of primitive erythroid cells (Figure 5D). The presence of beta H1, together with the lack of clonable precursors in the Runx1-deficient cultures, suggests that the primitive erythroid cells had matured beyond the precursor stage during the expansion phase. In the second analysis, we assayed the hematopoietic potential of the Runx1-/- blast colonies before expansion in culture to determine if they did contain primitive erythroid precursors. For this assay, individual Runx1-/- blast colonies were picked, and the cells were dispersed and replated directly in secondary methylcellulose cultures. Under these conditions, approximately 40% of the replated colonies gave rise to secondary primitive erythroid colonies. Colonies of definitive hematopoietic cells were never observed in these secondary cultures. Collectively, these findings demonstrate that Runx1 is essential for the generation of normal numbers of blast colonies. Blast colonies that develop from Runx1-/- EBs appear to be restricted to the primitive erythroid and endothelial lineages, a finding consistent with the interpretation that Runx1 is essential for definitive hematopoietic development.

Runx1 deficiency does not affect primitive hematopoietic development

The defect in blast colony development in Runx1-/- EBs prompted us to investigate the primitive hematopoietic potential of these cells and those of the yolk sac of Runx1-/- embryos. Previous analysis of the primitive erythroid lineage, by estimation of circulating red cell number in Runx1-/- embryos, suggested that this population was relatively unaffected by the deletion of this gene.26,27 However, because quantitative analysis of primitive erythroid precursors was not performed, it is possible that the Runx1 mutation did cause subtle defects in the development of this lineage.

Analyses of the yolk sac of Runx1-/- embryos, ranging in stage from 4 to 6 sp (E8.25) to 13 to 15sp (E8.5), revealed the presence of normal numbers of primitive erythroid precursors (Figure 6A). This tissue was devoid of definitive hematopoietic precursors, including those of the macrophage and definitive erythroid lineages. In contrast, definitive precursors could be detected in the yolk sac of Runx1+/+ and Runx1+/- embryos as early as the 7 to 9sp stage of development. Yolk sacs from Runx1+/- embryos contained fewer definitive precursors than those from wild-type embryos, indicating a hemizygous affect of Runx1 at these early stages of definitive hematopoiesis. These findings clearly demonstrate that the primitive lineage, at the level of the precursor stage, is intact in the Runx1-/- embryos and that the definitive hematopoietic program is affected at the earliest stages of its development.


View larger version (44K):
[in this window]
[in a new window]
 
Figure 6. Analysis of primitive and definitive hematopoietic potential of Runx1+/+, Runx1+/-, and Runx1-/- embryos and ES cells. (A) Primitive erythroid, definitive erythroid, and macrophage colonies generated by yolk sac cells from Runx1+/+ (+/+), Runx1+/- (+/-), and Runx1-/- (-/-) embryos. The stage of development (number of somite pairs) is indicated. The number of embryos analyzed at each stage is as follows: 4-6sp: 3 +/+, 2 +/-, 2-/-; 7-9sp: 3 +/+, 3 +/-, 4-/-; 10-12sp: 3 +/+, 12 +/-, 3-/-; and 13-15sp: 1 +/+, 4 +/-, 2-/-. (B) Primitive erythroid precursors generated by Runx1+/+ (+/+), Runx1+/- (+/-), and Runx1-/- (-/-) EBs. Numbers are days of EB differentiation.-/-A and -/-B represent 2 independent clones of Runx1-/- ES cells. Bars, where visible, represent standard error of the mean number of colonies from at least 3 cultures. (C) Definitive hematopoietic potential of Runx1+/+ (+/+), Runx1+/- (+/-), and Runx1-/- (-/-) EBs at day 6 of differentiation. Macrophage (MAC), definitive erythroid (ERY/D), and multilineage (MIX) colonies were scored. Bars represent standard error of the mean number of colonies from at least 3 cultures. (D) FACS profile of day 4.75 Runx1+/Z EB cells stained with FDG (left panel). Negative (Neg) and positive (Pos) fractions were isolated and assayed for precursor potential. Number of primitive erythroid (ERY/P) and macrophage (MAC) colonies generated by the sorted fractions is shown in right panel. Bars represent standard error of the mean number of colonies from at least 3 cultures. (E) X-gal staining of Runx1+/+ (+/+) and Runx1+/Z (+/Z) primitive erythroid (ERY/P) and macrophage (MAC) colonies following 4 days of culture.

As observed in the yolk sac, EBs generated from Runx1-/- ES cells showed little or no defect in primitive erythroid potential (Figure 6B). The only discernible difference was that primitive erythroid development in the Runx1-/- EBs appeared to be restricted to a narrower window of differentiation than found in wild-type and heterozygous EBs. The reason for this restriction is unknown. No definitive precursors were found in the Runx1-/- EBs, confirming the findings in the mouse embryo that this gene is absolutely essential for the development of these lineages (Figure 6C). As with the yolk sacs, Runx1+/- EBs generated fewer definitive precursors than those differentiated from wild-type ES cells (Figure 6C).

The previous observation of Runx1 expression in yolk sac primitive erythrocytes44 and our sorting studies indicating that all BL-CFCs are Runx1+ suggested that ES-derived committed primitive erythroid precursors are also likely to express this gene. To address this issue, we sorted day 4.75 Runx1+/Z EBs for LacZ expression and analyzed the fractions for primitive erythroid potential (Figure 6D). Replating studies indicated that almost all primitive erythroid precursors were found in the Runx1+ fraction (Figure 6D). As expected, the earliest macrophage precursors developing in these EBs were also Runx1+. Additional studies demonstrated that all definitive precursors found in day 6 EBs were Runx1+ (data not shown). These findings extend our BL-CFC analysis and demonstrate that Runx1 expression defines the earliest stages of primitive and definitive hematopoiesis.

Although primitive erythroid precursors express Runx1, mature cells within colonies generated from them appear to have down-regulated expression as indicated by the low levels of beta -galactosidase staining (Figure 6E). In contrast, colonies of definitive hematopoietic cells maintain high levels of expression (Figure 6E and data not shown). These results indicate that all hematopoietic precursors express Runx1. As the primitive erythroid lineage matures, the cells appear to rapidly lose Runx1 expression, a pattern similar to that observed in vivo in the yolk sac blood islands.


    Discussion
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Previous studies have established Runx1 as a pivotal player in the development of the definitive hematopoietic system in the mouse embryo.26,27 Given this association with definitive hematopoiesis, Runx1 is generally considered to exert its primary function within the embryo proper, following the primitive erythroid stage of development in the yolk sac. In this report, we investigated the role of Runx1 in hematopoietic development in ES cell-derived EBs and demonstrated that it is essential for the establishment or differentiation of the BL-CFC, a precursor that represents the earliest stage of hematopoietic and endothelial commitment in this model system. Our data clearly show that Runx1 is expressed within BL-CFCs and is required for the development of normal numbers of blast colonies from these precursors. Several lines of evidence indicate that the observed effect on the number of blast colonies truly reflects a critical role for Runx1 at this stage of development and is not simply due to reduced potential resulting from ES cell clonal variation. First, the defect in BL-CFC development was found in several independent Runx1-/- clones. Second, Runx1-/- ES cells were able to generate wild-type numbers of primitive erythroid precursors, indicating normal developmental potential for this lineage. Third, the defect at the level of BL-CFC development could be rescued by reintroduction and expression of a wild-type Runx1 gene in Runx1-/- ES cells.

The expression and cell separation studies presented here indicate that the up-regulation of Runx1 expression defines the earliest stage of hematopoietic and endothelial commitment. The low levels of expression found in ES cells and early EBs by RT-PCR were not detected by LacZ staining. This discrepancy may reflect the early expression of minor isoforms of Runx1 that do not use the exons containing the LacZ gene53 or differences in the sensitivity of the methods used in the analyses. Based on RT-PCR and LacZ expression, Runx1 expression was found to be up-regulated between days 3 and 4 of differentiation. The increase in Runx1 expression overlaps with the onset of Flk-1 and Scl expression and with the development of BL-CFCs. Although previous analyses have demonstrated that all BL-CFCs express Flk-1,35 only a small fraction of the Flk-1+ population appears to represent the BL-CFC precursor. Our results clearly demonstrate that the BL-CFC expresses Runx1 and that Runx1 expression at days 3 and 3.5 of differentiation is limited to a subpopulation of Flk-1+ cells. These observations suggest that the up-regulation of Runx1 expression may mark the developmental progression from the prehemangioblast (Flk-1+/Runx1-) to the hemangioblast (Flk-1+/Runx1+) in EBs.

Although the deletion of Runx1 leads to a dramatic reduction in the number of blast colonies and a complete block in definitive hematopoiesis, it has little or no impact on the generation of the primitive erythroid lineage. These findings suggest that these hematopoietic programs may diverge at an early stage of development, possibly at the level of the BL-CFC as depicted in Figure 7. In this model, 2 populations of BL-CFCs with distinct hematopoietic potential would be generated from a multipotential BL-CFC with primitive and definitive potential. Emergence of the primitive restricted BL-CFC would be a Runx1-independent event, whereas the generation of a functional definitive restricted precursor would require Runx1. This model is supported by our previous studies in which we identified 3 different populations of BL-CFC, those with primitive and definitive hematopoietic potential, those that display definitive but little if any primitive potential, and those that appear to be restricted to the primitive erythroid lineage.30,32 The primitive erythroid-restricted BL-CFCs were the least abundant and represented approximately 3% of the total population. This frequency is similar to the frequency of BL-CFC found in Runx1-/- EBs relative to wild-type controls. The BL-CFCs that develop in the Runx1-/- EBs may represent a combination of primitive erythroid- restricted precursors and multipotential precursors that are unable to generate definitive hematopoietic progeny. Although there is no direct evidence for the presence of hemangioblasts in the yolk sac, histologic studies demonstrating a close developmental association of the primitive erythroblasts and the endothelial cells within the blood islands would be consistent with the existence of a cell with properties of the primitive BL-CFC. The role of the proposed primitive restricted BL-CFC in vivo would be to generate the primitive erythroid lineage and the early yolk sac vasculature.


View larger version (18K):
[in this window]
[in a new window]
 
Figure 7. Model of early hematopoietic development. Numbers indicate stages at which development could be blocked in Runx1-deficient cells.

Most BL-CFCs within the developing EBs are Runx1 dependent and would belong to the definitive subpopulation of precursors in the above model. This finding is consistent with our previous studies demonstrating that most BL-CFCs had definitive but no detectable primitive potential.30,32 The significant reduction in blast cell colonies developing from Runx1-/- EBs could be interpreted as a block in the generation of definitive BL-CFC (Figure 7, block 1). Alternatively, it is possible that the developmental block is at the level of BL-CFC commitment to the definitive hematopoietic lineages (block 2) rather that in the generation of the BL-CFC. In this case, the definitive BL-CFC would be generated but only capable of giving rise to endothelial cells. The endothelial component alone may not grow well in methylcellulose or may generate colonies that are not recognized as typical blast colonies. We favor the second scenario (block 2) because a block at this level would not significantly impact endothelial development and be consistent with the observation that vascular development is not dramatically affected in the Runx1-/- embryos.

The existence of a definitive restricted hemangioblast in vivo is supported by a number of reports that indicate that hematopoietic cells "bud" from a subset of endothelial cells referred to as hemogenic endothelium54-56 found in the dorsal aorta of the developing embryo. This subpopulation of endothelial cells may represent definitive hemangioblasts. Evidence for a role for Runx1 at this stage of development has been provided by North et al,44 who demonstrated that a functional gene is essential for the development of these hematopoietic cell clusters but not for the underlying endothelial cells. Runx1-dependent hematopoietic clusters were also found associated with the endothelial lining of the vitelline and umbilical arteries and with vessels in the yolk sac capillaries.44,57 The function of the definitive hemangioblast in vivo would be first to generate the definitive precursors found early in the yolk sac and subsequently to establish intra-embryonic hematopoiesis in the P-Sp/AGM region of the embryo. These in vivo studies do support this model, but formal proof for the existence of a hemangioblast in the yolk sac or AGM will require clonal analysis.

In summary, the data presented in this report position Runx1 functionally at the earliest stages of hematopoietic and endothelial commitment in developing EBs. Expression of Runx1 in early EBs defines a subset of the Flk-1+ population that contains most, if not all, BL-CFCs, the in vitro equivalent of the putative hemangioblast. Access to these early populations through Runx1 expression provides a unique opportunity to define the molecular events involved in the establishment of the primitive and definitive hematopoietic programs.


    Acknowledgments

We thank members of the Keller laboratory for critically reading the manuscript and Anne Trumble for expert technical assistance.


    Footnotes

Submitted December 27, 2001; accepted March 6, 2002.

Prepublished online as Blood First Edition Paper, April 17, 2002; DOI 10.1182/blood-2001-12-0321.

Supported by National Institutes of Health grants R01 HL48834 and R01 HL65169.

G.L. and L.G. contributed equally to this work.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: Gordon Keller, Carl C. Icahn Institute for Gene Therapy and Molecular Medicine, Mount Sinai School of Medicine, New York, NY; e-mail: gordon.keller{at}mssm.edu.


    References
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

1. Russel E. Hereditary anemias of the mouse: a review for geneticists. Adv Genet. 1979;20:357-459[Medline] [Order article via Infotrieve].

2. Moore M, Metcalf D. Ontogeny of the hematopoietic system: yolk sac origin of in vivo and in vitro colony forming cells in the developing mouse embryo. Br J Hematol. 1970;18:279-296[Medline] [Order article via Infotrieve].

3. Haar JL, Ackerman GA. Ultrastructural changes in mouse yolk sac associated with the initiation of vitelline circulation. Anat Rec. 1971;170:437-456[CrossRef][Medline] [Order article via Infotrieve].

4. Sabin FR. Studies on the origin of blood vessels and of red corpuscles as seen in the living blastoderm of the chick during the second day of incubation: contributions to embryology. 1920;9:213-262.

5. Murray PDF. The development in vitro of the blood of the early chick embryo. Proc R Soc London. 1932;11:497-521.

6. Barker J. Development of the mouse hematopoietic system, I: types of hemoglobin produced in embryonic yolk sac and liver. Dev Biol. 1968;18:14-29[CrossRef][Medline] [Order article via Infotrieve].

7. Brotherton T, Chui D, Gauldie J, Patterson M. Hemoglobin ontogeny during normal mouse fetal development. Proc Natl Acad Sci U S A. 1979;76:2853-2857[Abstract/Free Full Text].

8. Haar JL, Ackerman GA. A phase and electron microscopic study of vasculogenesis and erythropoiesis in the yolk sac of the mouse. Anat Rec. 1971;170:199-223[CrossRef][Medline] [Order article via Infotrieve].

9. Palis J, McGrath KE, Kingsley PD. Initiation of hematopoiesis and vasculogenesis in murine yolk sac explants. Blood. 1995;86:156-163[Abstract/Free Full Text].

10. Palis J, Robertson S, Kennedy M, Wall C, Keller G. Development of erythroid and myeloid progenitors in the yolk sac and embryo proper of the mouse. Development. 1999;126:5073-5084[Abstract].

11. Dieterlen-Lievre F. On the origin of haemopoietic stem cells in the avian embryo: an experimental approach. J Embryol Exp Morphol. 1975;33:607-619[Medline] [Order article via Infotrieve].

12. Godin IE, Garcia-Porrero JA, Coutinho A, Dieterlen-Lievre F, Marcos MA. Para-aortic splanchnopleura from early mouse embryos contains B1a cell progenitors. Nature. 1993;364:67-70[CrossRef][Medline] [Order article via Infotrieve].

13. Medvinsky AL, Samoylina NL, Müller AM, Dzierzak EA. An early pre-liver intra-embryonic source of CFU-S in the developing mouse. Nature. 1993;364:64-67[CrossRef][Medline] [Order article via Infotrieve].

14. Muller AM, Medvinsky A, Strouboulis J, Grosveld F, Dzierzak E. Development of hematopoietic stem cell activity in the mouse embryo. Immunity. 1994;1:291-301[CrossRef][Medline] [Order article via Infotrieve].

15. Godin I, Dieterlen-Lievre F, Cumano A. Emergence of multipotent hemopoietic cells in the yolk sac and paraaortic splanchnopleura in mouse embryos, beginning at 8.5 days postcoitus. Proc Natl Acad Sci U S A. 1995;92:773-777[Abstract/Free Full Text].

16. Doetschman TC, Eistetter H, Katz M, Schmidt W, Kemler R. The in vitro development of blastocyst-derived embryonic stem cell lines: formation of visceral yolk sac, blood islands and myocardium. J Embryol Exp Morphol. 1985;87:27-45[Medline] [Order article via Infotrieve].

17. Schmitt R, Bruyns E, Snodgrass H. Hematopoietic development of embryonic stem cells in vitro: cytokine and receptor gene expression. Genes Dev. 1991;5:728-740[Abstract/Free Full Text].

18. Burkert U, von Ruden T, Wagner EF. Early fetal hematopoietic development from in vitro differentiated embryonic stem cells. New Biol. 1991;3:698-708[Medline] [Order article via Infotrieve].

19. Keller G, Kennedy M, Papayannopoulou T, Wiles M. Hematopoietic commitment during embryonic stem cell differentiation in culture. Mol Cell Biol. 1993;13:473-486[Abstract/Free Full Text].

20. Nakano T, Kodama H, Honjo T. Generation of lymphohematopoietic cells from embryonic stem cells in culture. Science. 1994;265:1098-1101[Abstract/Free Full Text].

21. Keller G. In vitro differentiation of embryonic stem cells. Curr Opin Cell Biol. 1995;7:862-869[CrossRef][Medline] [Order article via Infotrieve].

22. Weiss M, Keller G, Orkin S. Novel insights into erythroid development revealed through in vitro differentiation of GATA-1- embryonic stem cells. Genes Dev. 1994;8:1184-1197[Abstract/Free Full Text].

23. Tsai FY, Keller G, Kuo FC, et al. An early haematopoietic defect in mice lacking the transcription factor GATA-2. Nature. 1994;371:221-226[CrossRef][Medline] [Order article via Infotrieve].

24. Porcher C, Swat W, Rockwell K, Fujiwara Y, Alt FW, Orkin SH. The T cell leukemia oncoprotein SCL/tal-1 is essential for development of all hematopoietic lineages. Cell. 1996;86:47-57[CrossRef][Medline] [Order article via Infotrieve].

25. Vittet D, Prandini MH, Berthier R, et al. Embryonic stem cells differentiate in vitro to endothelial cells through successive maturation steps. Blood. 1996;88:3424-3431[Abstract/Free Full Text].

26. Okuda T, van Deursen J, Hiebert SW, Grosveld G, Downing JR. AML1, the target of multiple chromosomal translocations in human leukemia, is essential for normal fetal liver hematopoiesis. Cell. 1996;84:321-330[CrossRef][Medline] [Order article via Infotrieve].

27. Wang Q, Stacy T, Binder M, Marin-Padilla M, Sharpe A, Speck N. Disruption of the Cbfa2 gene causes necrosis and hemorrhaging in the central nervous system and blocks definitive hematopoiesis. Proc Natl Acad Sci U S A. 1996;93:3444-3449[Abstract/Free Full Text].

28. Elefanty AG, Robb L, Birner R, Begley CG. Hematopoietic-specific genes are not induced during in vitro differentiation of scl-null embryonic stem cells. Blood. 1997;90:1435-1447[Abstract/Free Full Text].

29. Robertson SM, Kennedy M, Shannon JM, Keller G. A transitional stage in the commitment of mesoderm to hematopoiesis requiring the transcription factor SCL/tal-1. Development. 2000;127:2447-2459[Abstract].

30. Choi K, Kennedy M, Kazarov A, Papadimitriou JC, Keller G. A common precursor for hematopoietic and endothelial cells. Development. 1998;125:725-732[Abstract].

31. Nishikawa SI, Nishikawa S, Hirashima M, Matsuyoshi N, Kodama H. Progressive lineage analysis by cell sorting and culture identifies FLK1+VE-cadherin+ cells at a diverging point of endothelial and hemopoietic lineages. Development. 1998;125:1747-1757[Abstract].

32. Kennedy M, Firpo M, Choi K, et al. A common precursor for primitive erythropoiesis and definitive haematopoiesis. Nature. 1997;386:488-493[CrossRef][Medline] [Order article via Infotrieve].

33. Shalaby F, Rossant J, Yamaguchi TP, et al. Failure of blood-island formation and vasculogenesis in Flk-1-deficient mice. Nature. 1995;376:62-66[CrossRef][Medline] [Order article via Infotrieve].

34. Shalaby F, Ho J, Stanford WL, et al. A requirement for Flk1 in primitive and definitive hematopoiesis and vasculogenesis. Cell. 1997;89:981-990[CrossRef][Medline] [Order article via Infotrieve].

35. Faloon P, Arentson E, Kazarov A, et al. Basic fibroblast growth factor positively regulates hematopoietic development. Development. 2000;127:1931-1941[Abstract].

36. Begley CG, Aplan PD, Denning S, et al. The gene SCL is expressed during early hematopoiesis and encodes a differentiation-related DNA-binding motif. Proc Natl Acad Sci U S A. 1989;86:10128-10132[Abstract/Free Full Text].

37. Robb L, Lyons I, Li R, et al. Absence of yolk sac hematopoiesis from mice with a targeted disruption of the scl gene. Proc Natl Acad Sci U S A. 1995;92:7075-7079[Abstract/Free Full Text].

38. Shivdasani R, Mayer E, Orkin SH. Absence of blood formation in mice lacking the T-cell leukemia oncoprotein tal-1/SCL. Nature. 1995;373:432-434[CrossRef][Medline] [Order article via Infotrieve].

39. Visvader JE, Fujiwara Y, Orkin SH. Unsuspected role for the T-cell leukemia protein SCL/tal-1 in vascular development. Genes Dev. 1998;12:473-479[Abstract/Free Full Text].

40. Ogawa E, Maruyama M, Kagoshima H, et al. PEBP2/PEA2 represents a family of transcription factors homologous to the products of the Drosophila runt gene and the human AML1 gene. Proc Natl Acad Sci U S A. 1993;90:6859-6863[Abstract/Free Full Text].

41. Ogawa E, Inuzuka M, Maruyama M, et al. Molecular cloning and characterization of PEBP2 beta, the heterodimeric partner of a novel Drosophila runt-related DNA binding protein PEBP2 alpha. Virology. 1993;194:314-331[CrossRef][Medline] [Order article via Infotrieve].

42. Wang SW, Speck NA. Purification of core-binding factor, a protein that binds the conserved core site in murine leukemia virus enhancers. Mol Cell Biol. 1992;12:89-102[Abstract/Free Full Text].

43. Miller JD, Stacy T, Liu PP, Speck NA. Core-binding factor beta (CBFbeta ), but not CBFbeta -smooth muscle myosin heavy chain, rescues definitive hematopoiesis in CBFbeta -deficient embryonic stem cells. Blood. 2001;97:2248-2256[Abstract/Free Full Text].

44. North T, Gu TL, Stacy T, et al. Cbfa2 is required for the formation of intra-aortic hematopoietic clusters. Development. 1999;126:2563-2575[Abstract].

45. Karasuyama H, Melchers F. Establishment of mouse cell lines which constitutively secrete large quantities of interleukin 2, 3, 4, or 5 using modified cDNA expression vectors. Eur J Immunol. 1988;18:97-104[Medline] [Order article via Infotrieve].

46. Brady G, Barbara M, Iscove N. Representative in vitro cDNA amplification from individual hematopoietic cells and colonies. Methods Mol Cell Biol. 1990;2:17-25.

47. Silver L, Palis J. Initiation of murine embryonic erythropoiesis: a spatial analysis. Blood. 1997;89:1154-1164[Abstract/Free Full Text].

48. Herrmann BG, Labeit S, Poustka A, King TR, Lehrach H. Cloning of the T gene required in mesoderm formation in the mouse [see comments]. Nature. 1990;343:617-622[CrossRef][Medline] [Order article via Infotrieve].

49. Rogers MB, Hosler BA, Gudas LJ. Specific expression of a retinoic acid-regulated, zinc-finger gene, Rex-1, in preimplantation embryos, trophoblast and spermatocytes. Development. 1991;113:815-824[Abstract].

50. Orkin S. GATA-binding transcription factors in hematopoietic cells. Blood. 1992;80:575-581[Free Full Text].

51. Kabrun N, Buhring HJ, Choi K, Ullrich A, Risau W, Keller G. Flk-1 expression defines a population of early embryonic hematopoietic precursors. Development. 1997;124:2039-2048[Abstract].

52. Dumont DJ, Yamaguchi TP, Conlon RA, Rossant J, Breitman ML. Tek, a novel tyrosine kinase gene located on mouse chromosome 4, is expressed in endothelial cells and their presumptive precursors. Oncogene. 1992;7:1471-1480[Medline] [Order article via Infotrieve].

53. Tsuji K, Noda M. Identification and expression of a novel 3'-exon of mouse Runx1/Pebp2alphaB/Cbfa2/AML1 gene. Biochem Biophys Res Commun. 2000;274:171-176[CrossRef][Medline] [Order article via Infotrieve].

54. Garcia-Porrero JA, Godin IE, Dieterlen-Lievre F. Potential intraembryonic hemogenic sites at pre-liver stages in the mouse. Anat Embryol (Berl). 1995;192:425-435[Medline] [Order article via Infotrieve].

55. Dieterlen-Lievre F, Martin C. Diffuse intraembryonic hemopoiesis in normal and chimeric avian development. Dev Biol. 1981;88:180-191[CrossRef][Medline] [Order article via Infotrieve].

56. Tavian M, Coulombel L, Luton D, Clemente HS, Dieterlen-Lievre F, Peault B. Aorta-associated CD34+ hematopoietic cells in the early human embryo. Blood. 1996;87:67-72[Abstract/Free Full Text].

57. Yokomizo T, Ogawa M, Osato M, et al. Requirement of Runx1/AML1/PEBP2alpha B for the generation of haematopoietic cells from endothelial cells. Genes Cells. 2001;6:13-23[Abstract].

© 2002 by The American Society of Hematology.
 

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
BloodHome page
M. Hoogenkamp, M. Lichtinger, H. Krysinska, C. Lancrin, D. Clarke, A. Williamson, L. Mazzarella, R. Ingram, H. Jorgensen, A. Fisher, et al.
Early chromatin unfolding by RUNX1: a molecular explanation for differential requirements during specification versus maintenance of the hematopoietic gene expression program
Blood, July 9, 2009; 114(2): 299 - 309.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
F. M. Perez-Campo, J. Borrow, V. Kouskoff, and G. Lacaud
The histone acetyl transferase activity of monocytic leukemia zinc finger is critical for the proliferation of hematopoietic precursors
Blood, May 14, 2009; 113(20): 4866 - 4874.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. L. McKinney-Freeman, C. Lengerke, I.-H. Jang, S. Schmitt, Y. Wang, M. Philitas, J. Shea, and G. Q. Daley
Modulation of murine embryonic stem cell-derived CD41+c-kit+ hematopoietic progenitors by ectopic expression of Cdx genes
Blood, May 15, 2008; 111(10): 4944 - 4953.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
S. Pearson, P. Sroczynska, G. Lacaud, and V. Kouskoff
The stepwise specification of embryonic stem cells to hematopoietic fate is driven by sequential exposure to Bmp4, activin A, bFGF and VEGF
Development, April 15, 2008; 135(8): 1525 - 1535.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. Yokomizo, K. Hasegawa, H. Ishitobi, M. Osato, M. Ema, Y. Ito, M. Yamamoto, and S. Takahashi
Runx1 is involved in primitive erythropoiesis in the mouse
Blood, April 15, 2008; 111(8): 4075 - 4080.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J.-R. Landry, S. Kinston, K. Knezevic, M. F.T.R. de Bruijn, N. Wilson, W. T. Nottingham, M. Peitz, F. Edenhofer, J. E. Pimanda, K. Ottersbach, et al.
Runx genes are direct targets of Scl/Tal1 in the yolk sac and fetal liver
Blood, March 15, 2008; 111(6): 3005 - 3014.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. ProteomicsHome page
A. J. K. Williamson, D. L. Smith, D. Blinco, R. D. Unwin, S. Pearson, C. Wilson, C. Miller, L. Lancashire, G. Lacaud, V. Kouskoff, et al.
Quantitative Proteomics Analysis Demonstrates Post-transcriptional Regulation of Embryonic Stem Cell Differentiation to Hematopoiesis
Mol. Cell. Proteomics, March 1, 2008; 7(3): 459 - 472.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Walmsley, D. Cleaver, and R. Patient
Fibroblast growth factor controls the timing of Scl, Lmo2, and Runx1 expression during embryonic blood development
Blood, February 1, 2008; 111(3): 1157 - 1166.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
W. T. Nottingham, A. Jarratt, M. Burgess, C. L. Speck, J.-F. Cheng, S. Prabhakar, E. M. Rubin, P.-S. Li, J. Sloane-Stanley, J. Kong-a-San, et al.
Runx1-mediated hematopoietic stem-cell emergence is controlled by a Gata/Ets/SCL-regulated enhancer
Blood, December 15, 2007; 110(13): 4188 - 4197.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. Wang, P. W. Faloon, Z. Tan, Y. Lv, P. Zhang, Y. Ge, H. Deng, and J.-W. Xiong
Mouse lysocardiolipin acyltransferase controls the development of hematopoietic and endothelial lineages during in vitro embryonic stem-cell differentiation
Blood, November 15, 2007; 110(10): 3601 - 3609.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
M. Pick, L. Azzola, A. Mossman, E. G. Stanley, and A. G. Elefanty
Differentiation of Human Embryonic Stem Cells in Serum-Free Medium Reveals Distinct Roles for Bone Morphogenetic Protein 4, Vascular Endothelial Growth Factor, Stem Cell Factor, and Fibroblast Growth Factor 2 in Hematopoiesis
Stem Cells, September 1, 2007; 25(9): 2206 - 2214.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
R. C. R. Perlingeiro
Endoglin is required for hemangioblast and early hematopoietic development
Development, August 15, 2007; 134(16): 3041 - 3048.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
H. Yao, B. Liu, X. Wang, Y. Lan, N. Hou, X. Yang, and N. Mao
Identification of High Proliferative Potential Precursors with Hemangioblastic Activity in the Mouse Aorta-Gonad- Mesonephros Region
Stem Cells, June 1, 2007; 25(6): 1423 - 1430.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Li, K. K. Sinha, M. A. Hay, C. R. Rinaldi, Y. Saunthararajah, and G. Nucifora
RUNX1-RUNX1 Homodimerization Modulates RUNX1 Activity and Function
J. Biol. Chem., May 4, 2007; 282(18): 13542 - 13551.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. Tober, A. Koniski, K. E. McGrath, R. Vemishetti, R. Emerson, K. K. L. de Mesy-Bentley, R. Waugh, and J. Palis
The megakaryocyte lineage originates from hemangioblast precursors and is an integral component both of primitive and of definitive hematopoiesis
Blood, February 15, 2007; 109(4): 1433 - 1441.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. T. Fraser, J. Isern, and M. H. Baron
Maturation and enucleation of primitive erythroblasts during mouse embryogenesis is accompanied by changes in cell-surface antigen expression
Blood, January 1, 2007; 109(1): 343 - 352.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
B. M. Zeigler, D. Sugiyama, M. Chen, Y. Guo, K. M. Downs, and N. A. Speck
The allantois and chorion, when isolated before circulation or chorio-allantoic fusion, have hematopoietic potential
Development, November 1, 2006; 133(21): 4183 - 4192.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
X. Li, J.-W. Xiong, C. S. Shelley, H. Park, and M. A. Arnaout
The transcription factor ZBP-89 controls generation of the hematopoietic lineage in zebrafish and mouse embryonic stem cells
Development, September 15, 2006; 133(18): 3641 - 3650.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Liu, L. Carlsson, and T. Grundstrom
Identification of an N-terminal Transactivation Domain of Runx1 That Separates Molecular Function from Global Differentiation Function
J. Biol. Chem., September 1, 2006; 281(35): 25659 - 25669.
[Abstract] [Full Text] [PDF]


Home page
GENES CELLSHome page
M. Abe and Y. Sato
Puromycin insensitive leucyl-specific aminopeptidase (PILSAP) is required for the development of vascular as well as hematopoietic system in embryoid bodies.
Genes Cells, July 1, 2006; 11(7): 719 - 729.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. C. Arufe, M. Lu, A. Kubo, G. Keller, T. F. Davies, and R.-Y. Lin
Directed Differentiation of Mouse Embryonic Stem Cells into Thyroid Follicular Cells
Endocrinology, June 1, 2006; 147(6): 3007 - 3015.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Willey, A. Ayuso-Sacido, H. Zhang, S. T. Fraser, K. E. Sahr, M. J. Adlam, M. Kyba, G. Q. Daley, G. Keller, and M. H. Baron
Acceleration of mesoderm development and expansion of hematopoietic progenitors in differentiating ES cells by the mouse Mix-like homeodomain transcription factor
Blood, April 15, 2006; 107(8): 3122 - 3130.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. L. Olsen, D. L. Stachura, and M. J. Weiss
Designer blood: creating hematopoietic lineages from embryonic stem cells
Blood, February 15, 2006; 107(4): 1265 - 1275.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
S. Taoudi, A. M. Morrison, H. Inoue, R. Gribi, J. Ure, and A. Medvinsky
Progressive divergence of definitive haematopoietic stem cells from the endothelial compartment does not depend on contact with the foetal liver
Development, September 15, 2005; 132(18): 4179 - 4191.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H. Hirai, I. M Samokhvalov, T. Fujimoto, S. Nishikawa, J. Imanishi, and S.-I. Nishikawa
Involvement of Runx1 in the down-regulation of fetal liver kinase-1 expression during transition of endothelial cells to hematopoietic cells
Blood, September 15, 2005; 106(6): 1948 - 1955.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
E. S. Ng, R. P. Davis, L. Azzola, E. G. Stanley, and A. G. Elefanty
Forced aggregation of defined numbers of human embryonic stem cells into embryoid bodies fosters robust, reproducible hematopoietic differentiation
Blood, September 1, 2005; 106(5): 1601 - 1603.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
E. T. Zambidis, B. Peault, T. S. Park, F. Bunz, and C. I. Civin
Hematopoietic differentiation of human embryonic stem cells progresses through sequential hematoendothelial, primitive, and definitive stages resembling human yolk sac development
Blood, August 1, 2005; 106(3): 860 - 870.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
J. R. Biggs, Y. Zhang, L. F. Peterson, M. Garcia, D.-E. Zhang, and A. S. Kraft
Phosphorylation of AML1/RUNX1 Regulates Its Degradation and Nuclear Matrix Association
Mol. Cancer Res., July 1, 2005; 3(7): 391 - 401.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Kubo, V. Chen, M. Kennedy, E. Zahradka, G. Q. Daley, and G. Keller
The homeobox gene HEX regulates proliferation and differentiation of hemangioblasts and endothelial cells during ES cell differentiation
Blood, June 15, 2005; 105(12): 4590 - 4597.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
G. Keller
Embryonic stem cell differentiation: emergence of a new era in biology and medicine
Genes & Dev., May 15, 2005; 19(10): 1129 - 1155.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
V. W.M. van Hinsbergh and T. J. Rabelink
FGFR1 and the Bloodline of the Vasculature
Arterioscler. Thromb. Vasc. Biol., May 1, 2005; 25(5): 883 - 886.
[Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
P. U. Magnusson, R. Ronca, P. Dell'Era, P. Carlstedt, L. Jakobsson, J. Partanen, A. Dimberg, and L. Claesson-Welsh
Fibroblast Growth Factor Receptor-1 Expression Is Required for Hematopoietic but not Endothelial Cell Development
Arterioscler. Thromb. Vasc. Biol., May 1, 2005; 25(5): 944 - 949.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
E. S. Ng, L. Azzola, K. Sourris, L. Robb, E. G. Stanley, and A. G. Elefanty
The primitive streak gene Mixl1 is required for efficient haematopoiesis and BMP4-induced ventral mesoderm patterning in differentiating ES cells
Development, March 1, 2005; 132(5): 873 - 884.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Zhang, J. R. Biggs, and A. S. Kraft
Phorbol Ester Treatment of K562 Cells Regulates the Transcriptional Activity of AML1c through Phosphorylation
J. Biol. Chem., December 17, 2004; 279(51): 53116 - 53125.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
J. J. Schuringa, K. Wu, G. Morrone, and M. A.S. Moore
Enforced Activation of STAT5A Facilitates the Generation of Embryonic Stem-Derived Hematopoietic Stem Cells That Contribute to Hematopoiesis In Vivo
Stem Cells, December 1, 2004; 22(7): 1191 - 1204.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
B. K. Hadland, S. S. Huppert, J. Kanungo, Y. Xue, R. Jiang, T. Gridley, R. A. Conlon, A. M. Cheng, R. Kopan, and G. D. Longmore
A requirement for Notch1 distinguishes 2 phases of definitive hematopoiesis during development
Blood, November 15, 2004; 104(10): 3097 - 3105.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
D. L. Ramirez-Bergeron, A. Runge, K. D. C. Dahl, H. J. Fehling, G. Keller, and M. C. Simon
Hypoxia affects mesoderm and enhances hemangioblast specification during early development
Development, September 15, 2004; 131(18): 4623 - 4634.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. K. Anderson, R. Pant, A. L. Miracle, X. Sun, C. A. Luer, C. J. Walsh, J. C. Telfer, G. W. Litman, and E. V. Rothenberg
Evolutionary Origins of Lymphocytes: Ensembles of T Cell and B Cell Transcriptional Regulators in a Cartilaginous Fish
J. Immunol., May 15, 2004; 172(10): 5851 - 5860.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
A. M. Bowcock and W. O.C.M. Cookson
The genetics of psoriasis, psoriatic arthritis and atopic dermatitis
Hum. Mol. Genet., April 1, 2004; 13(90001): R43 - 55.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. C. Telfer, E. E. Hedblom, M. K. Anderson, M. N. Laurent, and E. V. Rothenberg
Localization of the Domains in Runx Transcription Factors Required for the Repression of CD4 in Thymocytes
J. Immunol., April 1, 2004; 172(7): 4359 - 4370.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. S. Kaufman, R. L. Lewis, E. T. Hanson, R. Auerbach, J. Plendl, and J. A. Thomson
Functional endothelial cells derived from rhesus monkey embryonic stem cells
Blood, February 15, 2004; 103(4): 1325 - 1332.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
G. Lacaud, V. Kouskoff, A. Trumble, S. Schwantz, and G. Keller
Haploinsufficiency of Runx1 results in the acceleration of mesodermal development and hemangioblast specification upon in vitro differentiation of ES cells
Blood, February 1, 2004; 103(3): 886 - 889.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
I. Nobuhisa, M. Takizawa, S. Takaki, H. Inoue, K. Okita, M. Ueno, K. Takatsu, and T. Taga
Regulation of Hematopoietic Development in the Aorta-Gonad-Mesonephros Region Mediated by Lnk Adaptor Protein
Mol. Cell. Biol., December 1, 2003; 23(23): 8486 - 8494.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
M. Alvarez-Silva, P. Belo-Diabangouaya, J. Salaun, and F. Dieterlen-Lievre
Mouse placenta is a major hematopoietic organ
Development, November 15, 2003; 130(22): 5437 - 5444.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. Palis
Putting a Hex on blood and endothelium
Blood, October 1, 2003; 102(7): 2315 - 2316.
[Full Text] [PDF]


Home page
BloodHome page
Y. Guo, R. Chan, H. Ramsey, W. Li, X. Xie, W. C. Shelley, J. P. Martinez-Barbera, B. Bort, K. Zaret, M. Yoder, et al.
The homeoprotein Hex is required for hemangioblast differentiation
Blood, October 1, 2003; 102(7): 2428 - 2435.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
M. J. Ferkowicz, M. Starr, X. Xie, W. Li, S. A. Johnson, W. C. Shelley, P. R. Morrison, and M. C. Yoder
CD41 expression defines the onset of primitive and definitive hematopoiesis in the murine embryo
Development, September 15, 2003; 130(18): 4393 - 4403.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. J. Chan, S. A. Johnson, Y. Li, M. C. Yoder, and G.-S. Feng
A definitive role of Shp-2 tyrosine phosphatase in mediating embryonic stem cell differentiation and hematopoiesis
Blood, September 15, 2003; 102(6): 2074 - 2080.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
H. J. Fehling, G. Lacaud, A. Kubo, M. Kennedy, S. Robertson, G. Keller, and V. Kouskoff
Tracking mesoderm induction and its specification to the hemangioblast during embryonic stem cell differentiation
Development, September 1, 2003; 130(17): 4217 - 4227.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. Chadwick, L. Wang, L. Li, P. Menendez, B. Murdoch, A. Rouleau, and M. Bhatia
Cytokines and BMP-4 promote hematopoietic differentiation of human embryonic stem cells
Blood, August 1, 2003; 102(3): 906 - 915.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
H. Kubo and K. Alitalo
The bloody fate of endothelial stem cells
Genes & Dev., February 1, 2003; 17(3): 322 - 329.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2001-12-0321v1
100/2/458    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lacaud, G.
Right arrow Articles by Keller, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lacaud, G.
Right arrow Articles by Keller, G.
Related Collections
Right arrow Hematopoiesis and Stem Cells
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2002 by American Society of Hematology         Online ISSN: 1528-0020