|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
NEOPLASIA
From the Division of Pharmaceutics, The Ohio State
University, Columbus, and the Department of Biochemistry and Molecular
Biology, Medical College of Ohio, Toledo.
Up-regulation of folate receptor (FR) type- Acute myelogenous leukemia (AML) is the most common
type of acute leukemia in adults. Standard chemotherapy results in a
70% complete remission rate in AML patients.1 Treatment
with drugs such as anthracyclines, however, is associated with severe
side effects such as myelosuppression and dose-limiting cardiotoxicity and a high incidence of relapse.2 Relapsed disease
is frequently refractory to chemotherapy and exhibits multidrug
resistance (MDR).3
A potential means of treating AML is by targeted drug delivery through
liposomes. Liposomal delivery of drugs has been shown to extend their
systemic circulation time, reduce dose-limiting toxicity, and overcome
MDR.4-7 Liposomal anthracyclines have reached clinical use
for the treatment of Kaposi sarcoma5 and are in clinical
trial for solid tumors and leukemias.8-14 Liposomal delivery has also been shown to increase anthracycline cytotoxicity in
tumor cells exhibiting MDR.6,7,15-17 The efficacy of
liposomal drugs can potentially be further enhanced by selective
targeting to tumor cells through a cell surface molecule that is
differentially expressed on tumor cells.18,19
The folate receptor (FR) is a promising target because of its narrow
tissue specificity, its overexpression in malignant tissues, and its
ability to bind and internalize folic acid conjugates. Of the 3 human
folate receptor isoforms,20-22 2 (FR- Here we present additional data on the extent of FR- Cell lines
Antibodies and reagents
Flow cytometry analysis Leukocytes from normal peripheral blood were prepared by centrifugation of whole blood (10 mL) for 10 minutes at 400g and incubating the cells from the buffy coat with 11 mL lysis buffer (155 mM NH4Cl, 10 mM KHCO3, and 1 mM EDTA) at room temperature for 15 minutes. Leukocytes were sedimented by centrifugation at 400g for 10 minutes. Red blood cell debris was removed gently together with the supernatant fluid, and the leukocytes were washed twice with 10 mM sodium phosphate buffer (pH 7.5) and 150 mM NaCl (phosphate-buffered saline [PBS]).Mononuclear cells from normal bone marrow were separated by Ficoll-Hypaque gradient centrifugation (Pharmacia, Gaithersburg, MD). The cells, recovered from the interphase, were washed with PBS containing 1% normal goat serum and 0.1% sodium azide (buffer B) and finally were resuspended in the same buffer. Leukemic blasts were received frozen from the Pediatric Oncology Group tissue bank (St Jude's Children's Hospital, Memphis, TN). The cells were rapidly thawed under hot running water and were immediately resuspended at 37°C in RPMI 1640 media containing 30% FBS. Viability of the leukemic blasts was greater than 90% based on trypan blue exclusion. From CD45/side scatter data, more than 90% of the cells appeared to be leukemic blasts. For immunostaining, cells (1 × 106) first were incubated on ice with 20% human normal AB serum (Gel-Freeze, Milwaukee, WI) for 30 minutes. They then were washed once with buffer B, followed by incubation with either anti-FR antibody or normal rabbit immunoglobulin (negative control) in 120 µL buffer B for 60 minutes on ice with intermittent mixing. PE-conjugated anti-CD34 antibody, together with APC-conjugated anti-CD45 antibody, was added, and the incubation was continued for 30 minutes. Cells were washed twice with buffer B. FITC-goat anti-rabbit IgG (1:500 dilution) was added to the cells suspended in 0.5 mL buffer B and was incubated for 30 minutes on ice with intermittent gentle mixing. After 2 washes with buffer B, the cells were mixed with 300 µL 1% paraformaldehyde and stored at 4°C. Cells were examined on a flow cytometer within 24 hours. The threshold to determine a positive signal by flow cytometry was obtained with normal rabbit IgG isotype control. To measure the binding of FITC-folate to whole cells, the cells were first washed with low pH buffer (10 mM sodium acetate, pH 4, 150 mM NaCl, 7 mM glucose) at 4°C to remove endogenous bound folate, followed by 2 washes with PBS and incubation with the reagent (10 nM) in PBS at 4°C for 30 minutes. Cells were then washed with PBS and analyzed by flow cytometry. In parallel, the cells were preincubated for 10 minutes with folic acid (1 µM) before the addition of FITC-folate. Cell lysates and Western blots Cell lysates were prepared using Triton X-100 as described previously and subjected to Western blot analysis by probing with rabbit anti-FR- antibody, as previously described.40
Band intensities were estimated by using NIH Image software.
PI-PLC cleavage As described previously,43 cells were washed with PBS, sedimented at 1000g at 4°C, and resuspended in a digesting buffer (25 mM Tris-HCl, pH 7.5, 250 mM sucrose, 10 mM glucose, 1% BSA). Cells (106) were then treated with 0.3 U PI-PLC for 1 hour at 37°C and washed twice with cold PBS.Nitrous acid cleavage As described previously,43 crude membranes were suspended in 50 mM sodium acetate, pH 3.5, containing 0.165 M freshly dissolved NaNO2 and were incubated for 6 hours at room temperature and washed with PBS.[3H] Folic acid binding assay As described previously,43 cells (2 × 106 per mL) were washed successively at 4°C with pH 4 buffer (10 mM sodium acetate, 150 mM NaCl, 7 mM glucose) and PBS to remove endogenous folate. Cells (106) were then incubated with 1.2 pmol [3H] folic acid in 0.5 mL PBS at 37°C for 30 minutes, sedimented at 1000g, chilled to 4°C, and washed with cold PBS. Radioactivity in the pellet was measured by liquid scintillation counting.RT-PCR and cDNA sequence analysis Total RNA from cells was isolated by using the guanidinium thiocyanate-phenol-chloroform single-step extraction method (Stratagene). RNA was reverse transcribed and amplified by PCR, as described previously.22 Several combinations of oligonucleotide probes, corresponding to various sequences in the FR- cDNA, were used for the PCR amplification including (1)
GATCTATTGCCTACTTAGAGAGAGGC and ACAACTTTAACTGGGACCACTGC and (2)
GTGGTCCCAGTTAAAGTTGTACAGG and GGGTTAGGTGACTAATAGAAGCATGC. PCR products
were purified after electrophoresis from a 1% agarose gel using the
Geneclean kit (BIO101, La Jolla, CA). Purified PCR products (0.5 mg DNA
each) were subjected to DNA sequence analysis using PCR sequencing on a
Perkin Elmer GeneAmp PCR System 9600 (Shelton, CT).
Deglycosylation Detergent extracts of crude cell membranes were treated with N-glycanase (Boehringer-Mannheim) to deglycosylate FR-, as described previously.44
Liposome preparation Liposomes composed of DSPC/Chol/folate-PEG-DSPE (60:40:0.1, mol/mol) encapsulating 50 mM calcein were prepared by polycarbonate membrane extrusion, as described previously.32 Calcine and phospholipid concentrations were determined by absorption at 495 nm and a colorimetric assay,45 respectively. Liposomal entrapment efficiency was between 6% and 10%. For FR-targeted liposomes containing DOX (f-L-DOX), a composition of DSPE/Chol/mPEG-DSPE/folate-PEG-DSPE (60:36:4:0.1, mol/mol) was used. DOX was incorporated by remote loading, as described previously.46 DOX concentrations in the liposomal samples were measured by absorption at 480 nm. DOX loading efficiency was greater than 95%. Liposome size distribution was measured by light scattering on a Nicomp 370 submicron particle analyzer (Particle Sizing System, Santa Barbara, CA). Mean liposomal diameters were between 100 and 110 nm for all preparations. Liposome samples were stored at 4°C for up to 2 weeks and showed no significant (less than 1%) leakage of calcein or DOX during this period.Cellular uptake of f-L-calcein Approximately 106 cells were incubated in triplicate with f-L-calcein or L-calcein (20 µM calcein) in folate-free RPMI 1640 media (with or without 1 mM folic acid) for 1 hour at 37°C. Cells were then washed 3 times with cold PBS and examined by fluorescence microscopy or flow cytometry. Fluorescence microscopy was carried out on a Zeiss Axioshop Epifluorescence Microscope with an Optronics 3 chip low-light level color CCD camera attachment (Thornwood, NY). Digital images were analyzed using the NIH Image software. Flow cytometry was performed on a Beckman Coulter Elite Flow Cytometer, using at least 105 cells (Miami, FL). Cellular uptake was presented as the relative fluorescence index. For the AML KG-1 and KG-1a cells, cellular uptake was also determined with cells exposed for 5 days to 1 µM ATRA. For KG-1 cells, f-L-calcein uptake was also measured with cells pretreated with PI-PLC.Determination of the in vitro cytotoxicity of f-L-DOX to leukemia cells Cells were aliquoted into 24-well plates at a density of approximately 2 × 105 cells per well (in 300 µL). DOX dose range tested was 1 mM to 61 nM. Cells were incubated in quadruplicate with 1:4 serial dilutions of f-L-DOX, L-DOX, or free DOX for 2 hours at 37°C, washed 3 times with cold PBS, and cultured for an additional 72 hours in fresh media. For cell viability determination, 30 µL of 5 mg/mL MTT was added, followed by 2-hour incubation at 37°C. Cells were then sedimented by centrifugation at 1000g for 3 minutes, and the pellet was dissolved in 150 µL isopropanol containing 0.1 M HCl, which was then transferred to the wells of a 96-well plate. Absorption at 570 nm was read on a Dynatech MR-600 microplate reader. Concentrations of DOX required for 50% growth inhibition (IC50) were then obtained from the OD570 versus DOX concentration curves. For KG-1 and KG-1a cells, the MTT assay was also performed on cells that had been cultured for 5 days in media containing 1 µM ATRA. For receptor blocking studies, folic acid (1 mM) was added to media during drug exposure.Evaluation of the therapeutic efficacy of f-L-DOX in murine leukemia models Antileukemic activity of f-L-DOX was evaluated in 2 FR (+) murine leukemia ascites tumor models. The first model consists of DBA/2 mice (Charles River, Wilmington, MA) carrying ascites tumors from the murine FR (+) L1210JF cells, an FR (+) subline of murine lymphocytic leukemia cell line L1210. Male mice (18-22 g) were placed on a folate-deficient diet (AIN-90G; Dyets, Bethlehem, PA) on arrival and for at least 1 week before leukemia cell inoculation. Normal rodent chow was not used because it contains approximately 3.19 mg/kg folic acid, which leads to supraphysiological serum folate. Mice (in groups of 8) were injected intraperitoneally with 1 × 106 L1210JF cells on day 0 and then were given 3 intraperitoneal injections (in 50 µL) of various DOX formulations or saline control on days 1, 5, and 9. Animal survival was then monitored daily until day 80. The second model consists of severe combined immunodeficient (SCID) mice (Charles River, Wilmington, MA) carrying ascites tumor from KG-1 cells. Female CB.17 SCID (scid/scid, 18-22 g) mice were inoculated intraperitoneally with 106 cells on day 0. Without treatment, visible ascites fluid developed at approximately day 30. Peritoneal exudate cells were collected by peritoneal lavage with 5 mL Hanks balanced salt solution, pelleted, and resuspended in RPMI 1640 media. These cells exhibited a morphology similar to that of KG-1 cells maintained in vitro. Half the mice received daily intraperitoneal injections of 10 mg/kg ATRA from days 1 through 5. Mice (in groups of 8) then received intraperitoneal injections (in 50 µL) of the DOX formulations or saline control on days 1, 5, and 9. Animal survival was then monitored daily until day 100. Comparisons of animal survival data were carried out by a log-rank test.
Ligand binding by FR- in normal
hematopoiesis, it was of interest to examine its ligand-binding property in those cells. Western blots of membrane preparations from
normal peripheral blood granulocytes probed with antibody to FR-
gave a diffuse band with an apparent molecular weight slightly higher
than that of FR- from recombinant CHO-FR- cells (Figure
1A). From a semiquantitative analysis of
the Western blot in Figure 1, the level of FR- expressed in
granulocytes is comparable to that of the recombinant CHO-FR-
cells. In contrast to FR- in CHO-FR- cells, the receptor in the
granulocytes could not be released from the cell surface with PI-PLC, a
diagnostic test for the GPI membrane anchor (Figure 1B). Several
tissues are known to confer modification on the inositol ring of the
GPI anchor, causing resistance to PI-PLC.43 In such
instances, the anchor may be cleaved by nitrous acid.43
When membranes prepared from granulocytes were treated with nitrous
acid, FR- was released, suggesting the presence of a modified GPI
anchor for FR- in these cells (Figure 1B). FR expressed in
granulocytes, however, was unable to bind FITC-folate, unlike that in
CHO-FR- cells (Figure 1C).
To test for possible primary sequence variation in the FR expressed in
neutrophils, total mRNA from these cells was reverse transcribed, and
the cDNA was amplified by PCR using combinations of primers
corresponding to the sequence of FR- Frequency of FR- has been shown to be
differentially expressed in myeloid leukemia.35 FR-
expression in AML can be further induced by retinoids.40
In this study, we analyzed 78 AML samples for FR- expression. Table
1 is a summary of FR- expression in
AML cells obtained from patient marrow examined by flow cytometry. CD34
expression in the leukemia samples is also noted (Table 1). The data
show that most (68%) of the AML samples tested were positive for
FR-. Furthermore, in most (38 of 53) of the FR- (+) AML bone
marrow samples, 100% of the cells expressed FR-. In addition, 66%
of the FR- (+) samples were also CD34+ (Table
1).
Uptake of f-L-calcein by FR-  ), and CHO-FR- cells and in FR ( ) KG-1a, L1210, and CHO-K1 cells.
L-calcein was used as a nontargeted control. Uptake of the liposomes in KG-1 cells was also examined by fluorescence microscopy (Figure 2). Overall fluorescence was much greater
in cells treated with f-L-calcein than in those treated with L-calcein.
Intracellular distribution of the fluorescence displayed a punctate
pattern in the former (Figure 2). This observation suggests
internalization of f-L-calcein through FR--mediated endocytosis and
sequestration of the liposomal calcein in intracellular endosomal
compartments, a pattern similar to the one reported for
FR--expressing KB human oral cancer cells treated with
f-L-calcein,31 suggesting a similar intracellular
trafficking pattern for the 2 receptor subtypes.
KG-1 cells have previously been reported to up-regulate FR-
In vitro cytotoxicity of f-L-DOX to cultured leukemia cells FR-targeted liposomal doxorubicin (f-L-DOX) was evaluated for in vitro cytotoxicity in FR (+) and FR () leukemia cells by MTT assay.
IC50 values (Tables
3-4) show
that F-L-DOX is 25 times more cytotoxic than L-DOX to the FR- (+)
KG-1 cells in the absence of ATRA and 63 times more cytotoxic with ATRA
pretreatment (Tables 3-4). In contrast, no therapeutic advantage or an
ATRA-induction effect on cytotoxicity is observed with f-L-DOX in the
KG-1a cell line, which is FR- () (Tables 3-4). Superior
cytotoxicity of f-L-DOX over L-DOX was also observed in the FR (+)
L1210JF cell line, but not in the FR () L1210 cells (Tables 3-4).
Data in Tables 3 and 4 further show that free folic (1 mM)
increased the IC50 of folate-L-DOX in KG-1 cells (ATRA
treated and untreated) and L1210JF cells by approximately one order of
magnitude. These are in agreement with the observed inhibition of
binding of folate-L-DOX to the same cells (Table 2).
Therapeutic efficacy of f-L-DOX in murine leukemia models The antileukemic therapeutic efficacy of f-L-DOX was evaluated in 2 FR (+) murine leukemia ascites models. The first model consists of DBA/2 mice with ascites tumors from the FR (+) L1210JF murine leukemia cells. Animals were treated with one of the following by intraperitoneal injection: saline (0.9% NaCl, USP), free DOX (3 mg/kg), L-DOX (5 mg/kg DOX), or f-L-DOX (5 mg/kg DOX). The free DOX dose (3 mg/kg) was chosen to correspond to a value below (at approximately 10% of) its previously reported LD50 value47 of approximately 26 mg/kg. The L-DOX or f-L-DOX dose (5 mg/kg) used was equitoxic to 3 mg/kg free DOX, based on previous findings showing that the LD50 of L-DOX was between 1.5 and 2 times higher than that of free DOX in mice.47,48 Median survival time for the 4 groups of mice were 25.5, 28.5, 35, and more than 80 days, respectively (Figure 4). The data clearly indicated that L-DOX was more effective than free DOX in prolonging animal survival (P = .0159; log-rank test), presumably because of the prolonged systemic circulation time of L-DOX compared to free DOX. Meanwhile, f-L-DOX was even more efficacious than L-DOX (P = .0259; log-rank test), extending the long-term survival rate to 75%, presumably because of more effective DOX delivery through FR-mediated tumor cell targeting.
We further evaluated the therapeutic efficacy of f-L-DOX in an ascites
tumor xenograft model consisting of CB.17 SCID mice inoculated
intraperitoneally with the human KG-1 AML cells. Half the animals
received daily intraperitoneal injections of 10 mg/kg ATRA on days 1 through 5. The following formulations were administered by
intraperitoneal injection on days 1, 5, and 9: (1) saline; (2)
free DOX (3 mg/kg); (3) L-DOX (5 mg/kg); (4) f-L-DOX (5 mg/kg); (5) saline + ATRA; (6) free DOX + ATRA; (7) L-DOX + ATRA; and (8) f-L-DOX + ATRA. Data on animal survival (Figure
5) indicate that L-DOX is more effective
than free DOX (P = .0001; log-rank test) but does not
yield long-term survival (Figure 5). F-L-DOX is more effective than
L-DOX (P = .0061; log-rank test), resulting in long-term
survival. ATRA cotreatment further improves the long-term survival rate
of the f-L-DOX-treated animals from 12.5% to 60% (P = .0190; log-rank test). The pronounced
improvement in therapeutic efficacy with ATRA is most likely the result
of up-regulation of FR-
There are a number of instances in which cell surface antigens
have been effectively targeted in the treatment of leukemia. For
example, Gemtuzumab ozogamicin (CMA-676), which consists of a cytotoxic
drug, calicheamicin, linked to a human monoclonal antibody
specific for the myelocyte marker CD33, has recently been approved by
the Food and Drug Administration for clinical use.49
Rituximab, an antibody against the B-cell-specific antigen CD20, is
widely used in the clinic to treat low-grade B-cell
lymphoma.50 There has also been progress in the
preclinical and clinical development of immunotoxins and of cytokine
fusion toxins for the treatment of leukemia.51 In a recent
clinical trial, effective therapy of hairy cell leukemia has been
reported using a recombinant immunotoxin containing an anti-CD22
variable domain.52 Although a large number of preclinical
and clinical studies exploring the folate receptor as a potential
therapeutic target have focused primarily on FR type- It has been reported that CD34+ bone marrow cells that
express relatively low levels of a protein immunoreactive with anti-FR antiserum did not show detectable binding of folic acid.39
However, activated synovial macrophages in rheumatoid
arthritis36 and membranes from CML and AML
spleens22,37,38 have the ability to bind the ligand. The
results of this study clearly demonstrate the inability of FR- AML is characterized by the accumulation of poorly differentiated blast
cells with limited proliferative capacity. Maintenance of this disease,
therefore, appears to be dependent on a smaller population of leukemic
stem cells that have extensive proliferative capacity. Divergent
theories have been put forth to explain the nature of these
proliferative cells and the process of
leukemogenesis.53,54 Establishing unifying principles in
AML leukemogenesis may be further complicated because of the phenotypic
heterogeneity in AMLs. Therefore, it may not be possible to predict
whether targeting a particular cell surface protein in AML cells will
effectively wipe out the leukemic stem cells. It is encouraging, as the
results of this study show, that FR- Data on in vitro cellular uptake of f-L-calcein and cytotoxicity of
f-L-DOX in cultured FR- F-L-DOX cytotoxicity in cultured leukemic cells was superior to that of
L-DOX, showed a strong dependence on FR expression, and was increased
in KG-1 cells with ATRA-induction of FR- Data from in vivo survival analyses using 2 murine leukemia models show
a significant therapeutic advantage of f-L-DOX over L-DOX and free DOX.
In SCID mice carrying KG-1 ascites tumor, the therapeutic efficacy of
f-L-DOX is further enhanced by administering ATRA, showing the
potential advantage of combining FR- Lee et al57 recently reported that indium-111-labeled FR-targeted and nontargeted control liposomes injected intravenously showed indistinguishable patterns of biodistribution in mice. Recent studies by the same group have shown similar results with FR-targeted and nontargeted liposomes loaded with boron.58 These data suggested that the targeted liposomes were likely to have similar bioavailability in the bone marrow compared with nontargeted liposomes, which are known to be highly bioavailable in the bone marrow. Current chemotherapy for AML has replaced DOX with the anthracycline drugs idarubicin and daunorubicin.59 Even though DOX is a potent cytotoxic, in its free form, the drug is more toxic than idarubicin and daunorubicin. Delivery of DOX in liposomal formulations alleviates the toxicity concerns while retaining its potency in killing malignant cells with the added advantage of bypassing multidrug resistance. The principles initially elucidated using DOX in this study may be expected to be applicable to other cytotoxic drugs that are effective against leukemic cells. Because ATRA differentiation therapy is a routine treatment modality for the APL subtype of AML60 and liposomal DOX delivery is already used for the treatment of solid tumors, combining ATRA treatment with FR-targeted liposomal DOX should not meet with significant toxicity concerns in future clinical trials. This combined report from our 2 laboratories offers proof of principle of this concept and warrants further studies using additional murine leukemia models and extension to clinical settings.
We thank Dr Frederick G. Behm for supplying the bone marrow samples from the POG Tissue Bank and Thomas Sawyer in the Pathology Department at the Medical College of Ohio for his assistance in the flow cytometry studies.
Submitted August 20, 2001; accepted March 5, 2002.
Supported by American Cancer Society grant RPG-99-097-01-MGO, Leukemia and Lymphoma Society grant 6113-02 (R.J.L.), and National Institutes of Health R01 grants CA80183 and CA70873 (M.R.).
X.Q.P., X.Z., M.R., and R.J. L. contributed equally to this work.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Robert J. Lee, Division of Pharmaceutics, The Ohio State University, 500 W 12th Ave, Columbus, OH 43210; e-mail: lee.1339{at}osu.edu.
|
-targeted liposomal doxorubicin combined with
receptor induction using all-trans retinoic
acid
Top
Abstract
Introduction
) is
constitutively secreted.
