|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
NEOPLASIA
From the Department of Pediatric Hematology and
Oncology, University Children's Hospital Muenster, Germany; and the
Department of Pediatric Hematology and Oncology, University Children's
Hospital Gießen, Germany.
One important question in stem cell biology of childhood acute
lymphoblastic leukemia (ALL) is whether immature
CD34+CD19 For a long time it has been assumed that the
leukemic transformation in childhood B-cell precursor acute
lymphoblastic leukemia (ALL) occurs at the level of a lymphoid
progenitor cell.1 Presence and stability of clonal
immunoglobulin and T-cell receptor gene rearrangements in ALL have been
regarded as strong evidence to support this hypothesis.
Contrasting this theory, molecular and functional analyses of
purified immature progenitor cell populations provide increasing evidence for the involvement of a more primitive cell in the leukemic process. Cells with a CD34+CD38 However, these investigations may not reflect the situation in more
common and prognostically favorable ALL subtypes, ie, in children with
an overall event-free survival close to 80% at 5 years.6
In the present study, we therefore focused on the childhood ALL
subgroup characterized by the translocation t(12;21)(p13;q22). This
chromosomal translocation leads to formation of the TEL/AML1 fusion
oncogene and is the most common genetic aberration in childhood B-cell
precursor ALL, occurring in approximately 20% to 25% of patients.7 Presence of t(12;21) is usually regarded as a
prognostically favorable marker8 and correlates with in
vitro sensitivity of the leukemic blasts to asparaginase,9
vincristine, dexamethasone, and serum deprivation.10 Due
to the high incidence of t(12;21) in relapse patients11
and a recent study in children with primary ALL showing no predictive
value of t(12;21) regarding outcome,12 the exact role of
t(12;21) as a prognostic marker needs, however, further prospective
evaluation.13
To address the question of involvement of the immature progenitor/stem
cell compartment in childhood ALL, flow cytometric analyses had been
initiated to identify and distinguish uncommitted and early B-lineage
progenitors. Expression of CD19 was found to be a good marker to
distinguish CD34+CD19+ leukemic from more
immature CD34+CD19 To investigate whether these immature cells belong to the leukemic
clone, CD34+CD19 Patients and cell lines
Patients.
Diagnostic bone marrow samples were obtained from 7 children with
TEL/AML1-positive and 8 children with
TEL/AML1-negative B-cell precursor ALL treated at the
Department of Pediatric Hematology and Oncology, University of
Muenster. Two additional TEL-AML1-positive patients
(nos. 008/B, 009/B) were provided by the ALL-BFM
(ALL-Berlin-Frankfurt-Muenster) study group (W.-D. Ludwig, Berlin,
Germany; and M. Schrappe, Hannover, Germany). Only diagnostic bone
marrow samples prior to starting chemotherapy were used for analysis.
The percentage of blasts in the 7 TEL/AML1-positive patients
in the bone marrow ranged from 30% to 96.5% (mean 84.4%, SD 24.1%).
In addition, bone marrow samples obtained from a patient with a solid
tumor (for exclusion of tumor cell metastasis to the bone marrow,
n = 1) or from leukemia patients during stable remission (n = 2)
were used as controls. The investigation was approved by the ethics
committee of the Medical Faculty, University of Muenster.
Cell lines.
The B-lineage precursor cell lines REH
(TEL/AML1-positive)19 and BLIN-1
(TEL/AML1-negative)20 were used as positive and negative controls. REH cells were cultured in Iscoves modified Dulbecco
medium (IMDM) (Biochrom, Berlin, Germany) and BLIN-1 cells in RPMI
(Biochrom) supplemented with 10% fetal calf serum (FCS), 2 mM
L-glutamine, 100 U/mL penicillin, and 100 µg/mL
streptomycin (LifeTechnologies, Karlsruhe, Germany) at 37°C and 5%
CO2 in a humidified atmosphere.
Processing of bone marrow samples
Cell sorting.
Frozen mononuclear cells (1 × 107 to
7 × 107 cells) from diagnostic bone marrow samples were
thawed, washed with IMDM containing 10% FCS, and stained with
saturating amounts of anti-CD19-phycoerythrin (J4.119; Beckman
Coulter, Krefeld, Germany) and anti-CD34-fluorescein isothiocyanate
(581; Beckman Coulter) antibody conjugates in a total volume of 100 to
200 µL IMDM plus 10% FCS for 20 minutes at 4°C. Cells were
resuspended in IMDM with 10% FCS at a concentration of
107/1.5 mL. Analysis and cell sorting were performed on a
FACS Vantage (Becton Dickinson, Heidelberg, Germany). Sorting gates
were placed on CD34brightCD19
Sorting of cells for RT-PCR analysis and isolation of RNA.
A total of 1000 cells from each population
(CD34+CD19 Preparation of slides for FISH analysis.
From 600 to 2000 cells from each population were directly sorted into
20 µL drops of phosphate-buffered saline (PBS) that were placed on a
grease-free glass slide. The slides were incubated for 10 minutes in a
moist chamber to allow settling of the cells within the PBS drop and
adherence to the glass slide. Subsequently, excessive PBS was carefully
removed with a paper towel. The cells were fixed on the slide with
ice-cold methanol/glacial acid (3:1, vol/vol). Air-dried slides were
analyzed by FISH at the cytogenetic laboratory at the Department of
Pediatric Hematology and Oncology in Gießen (S.R. and J.H.).
Purification of cells for colony assays.
For colony assays, 1500 to 3000 CD34+CD19 Molecular and functional analysis of sorted cell
populations
RT-PCR for TEL-AML1 and GAPDH.
For RT-PCR amplification of the TEL/AML1 fusion messenger
RNA, a nested PCR was performed. RT-PCR amplification of
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) messenger RNA served
as a quality control for the RNA preparation. GAPDH
amplification and the first amplification round of TEL/AML1
were performed by utilizing the OneStep RT-PCR-kit (Qiagen). A total of
5 µL (for TEL/AML1 RT-PCR) or 3 µL (for GAPDH RT-PCR) total RNA was transcribed into complementary DNA. The RT
reaction and amplification were performed in a total volume of 50 µL
containing 0.2 µM of each primer (TEL/AML1, sense:
CTCTCATCGGGAAGACCTGG; antisense: AGCGGCAACGCCTCGCTCAT;
GAPDH, sense: GACTGTGGATGGCCCCTCCGG; antisense:
AGGTGGAGGAGTGGGTGTCGC), 400 µM of each deoxyribonucleoside triphosphate, 1 × OneStep RT-buffer, and OneStep RT-PCR enzyme mix. Reverse transcription and amplification conditions for
TEL/AML1 were 30 minutes at 50°C (RT reaction), 15 minutes
at 95°C, followed by 35 PCR cycles (30 seconds at 94°C, 30 seconds
at 64°C, 60 seconds at 72°C). For GAPDH, amplification
conditions were 30 minutes at 50°C (RT reaction), 15 minutes at
95°C, followed by 30 PCR cycles (30 seconds at 94°C, 45 seconds at
66°C, 60 seconds at 72°C). Both reactions were terminated by a
final extension step of 10 minutes at 72°C. A total of 20 µL of the
GAPDH amplification product was loaded onto a 0.8% agarose gel
containing 0.5 µg/mL ethidium bromide.
Dual-color FISH for t(12;21). FISH analyses were performed using the commercially available Vysis LSI TEL/AML1 extra signal dual-color probe (Vysis, Downers Grove, IL). The TEL probe directly labeled with SpectrumGreen covers approximately 350-kilobase telomeric sequences on chromosome 12 starting between exons 3 to 5 of TEL, whereas the 500-kilobase AML1 probe labeled with SpectrumOrange fluorophore spans the entire AML1 gene. The slides were rehydrated in an alcohol series of 100%, 70%, 50%, 30% ethanol for 1 minute each, passed through 0.1 × SSC, and incubated in 2 × SSC for 30 minutes at 70°C. After a second 0.1 × SSC step, chromosomal DNA was denatured in 0.07 N NaOH for 1 minute at room temperature and chilled in 0.1 × SSC and 2 × SSC for 1 minute each. The slides were dehydrated in 30%, 50%, 70%, and 100% ethanol and air-dried. Probes were denatured and hybridized according to manufacturer's instructions. Hybridization was executed in a moist chamber at 37°C overnight. Posthybridization washes were performed in 2 × SSC for 10 minutes at room temperature, 1 × SSC at 72°C for 5 minutes, and 2 × SSC/Triton X-100 for 5 minutes at room temperature. The slides were passed through PBS, dehydrated in an ascending alcohol series, and air-dried. Cells were counterstained with 4,6-diamidino-2-phenylindole and mounted with Vectashield (Vector Laboratories, Burlingame, CA). Analysis of FISH preparations was performed with a ZeissAxiophot epifluorescence microscope (Zeiss, Oberkochem, Germany) equipped with a 100 W mercury lamp and an appropriate filter combination. For evaluation of the FISH results, 150 to 200 nuclei were analyzed. A nucleus without the TEL/AML1 gene fusion is expected to yield 2 green (TEL) and 2 red (AML1) signals separated from each other. With the occurrence of the translocation t(12;21) the fusion of TEL and AML1 genes is detected as a yellow fusion signal on the derivative chromosome 21, whereas derivative chromosome 12 is marked with a small red signal (residual AML1). Furthermore, the nucleus usually contains one green signal (native TEL) and one large red signal (native AML1). In the case of loss of heterozygosity of TEL, which has been described for the cell line REH, the normal green signal is absent.Colony assays.
A total of 600 to 30 000 cells sorted into 300 µL IMDM was added to
2.7 mL MethoCult H4434 (StemCell Technologies/CellSystems, St
Katharinen, Germany), which supports colony formation of myeloid progenitor cells. Cells were plated in duplicate or triplicate, depending on the amount of cells that were recovered from the patient
samples. Colonies were counted and photographed 10 to 14 days after
plating. Expression analysis of TEL/AML1 fusion transcript
within colonies by RT-PCR was done by transferring individual colonies
into 350 µL RLT buffer plus 3.5 µL
RT-PCR for TEL/AML1 in immature cell populations Extensive flow cytometric studies of immature cell populations in childhood ALL had shown that expression of the B-cell antigen CD19 is a suitable marker to distinguish immature progenitor/stem cells from the bulk leukemic cell population.14,15 Based on these analyses, immature CD34+CD19 and leukemic
CD34+CD19+ cells (Figure 1A) were purified by
flow sorting in 9 patients with TEL/AML1-positive ALL.
In 8 patients, we were able to sort 1000 CD34+CD19
To quantify the amount of TEL/AML1-positive cells in the
CD34+CD19 However, there are several possibilities by which this RT-PCR-based
quantification may underestimate the level of
TEL/AML1-positive leukemic cells within the
CD34+CD19 FISH analysis for t(12;21) of sorted cell populations Therefore, to quantify the level of leukemic cells by a DNA-based method, FISH analysis for the presence of t(12;21) was performed on the different subpopulations sorted directly onto glass slides. Consistent with the RT-PCR results, only low levels of cells with a TEL/AML1 gene fusion could be detected within the CD34+CD19
population of 5 patients, while the CD34+CD19+
cells were predominantly leukemic (Table 1). The lower cutoff level for
FISH analysis in accordance with diagnostic standards was defined by
taking the mean background of sorted TEL/AML1-negative BLIN-1 cells and adding 3 SDs. By this definition, the cutoff level was
5.7%. Taking this cutoff level into account, on average 2.5% cells
carrying the translocation t(12;21) (range, 0%-6.3%) were detected
within the immature CD34+CD19 population
(Figure 3). If only the
background of 3.1% false positive signals was subtracted from the
individual values, only a slightly higher mean percentage of 4.5%
cells with a TEL/AML1 fusion signal (range, 0%-8.9%) was measured. In
1 patient (no. 1318/97) the percentage of leukemic cells in the
CD34+CD19 cell fraction was below the lowest
background value detected in the negative cell line BLIN-1 and in
another patient (no. 658/97) below the cutoff level of 5.7%. Thus,
FISH analysis confirms the RT-PCR results detecting only low levels of
cytogenetically abnormal cells within the immature prelymphatic cell
compartment.
Colony assays with sorted cell populations To investigate if the CD34+CD19 cells
not only lack the cytogenetic aberration of the leukemic cell clone but
also display the differentiation pattern of normal progenitor cells,
CD34+CD19 cells were isolated and seeded into
methylcellulose cultures. These conditions supported the growth of
myeloid progenitors of all lineages.
The clonogenicity of thawed and subsequently flow-sorted
CD34+CD19
In 3 TEL/AML1-positive patients (nos. 589/97, 807/99,
1523/00), enough cells were available for colony assays. From 600 to 3000 CD34+CD19
To demonstrate that these progenitors not only exhibited a normal
proliferation and differentiation pattern but also lack expression of
TEL/AML1, single colonies were isolated and subjected to
RT-PCR. None of 92 colonies isolated from methylcellulose cultures with
purified CD34+CD19 Purity of flow sorting Diagnostic bone marrow samples were chosen for analysis, though the probability of sorter errors due to the high percentage of leukemic cells was expected to be high.2 However, our own flow cytometric analyses of immature cells in good-prognosis childhood ALL had suggested that normal progenitor/stem cells may be predominant within this compartment.14,15 Moreover, immature leukemic (stem) cells similar to acute myeloid leukemias21,22may
be rare. Consequently, remission bone marrow samples in children with a rapid response to chemotherapy and a low relapse rate were expected to
contain few if any putative CD19 immature leukemic
(stem) cells.
Direct quantification of the expected sorter errors except in patient
no. 1523/00 was impossible because the number of sorted CD34+CD19 Considering the rarity of the CD34+CD19
Previous flow cytometric studies of immature
CD34+CD19 Childhood ALL, however, is a heterogeneous disease. On one hand, there are patients with Philadelphia chromosome-positive ALL/t(9;22) with a dismal prognosis, particularly if unresponsive to steroids.27,28 On the other hand, there is the vast majority of children with a favorable outcome and cure rates close to 80%.6 Accordingly, there may also be heterogeneity in stem cell involvement in ALL, as has recently been suggested by several studies,2-5 necessitating analyses of the progenitor/stem cell compartment in well-defined ALL subgroups. Here, we analyzed the CD34+CD19 When rare leukemic cells carrying clonal chromosomal translocations are
quantified by FISH analysis of interphase nuclei, one has to take into
account that by chance 2 fluorescent probes lie closely together,
forming a false positive fusion signal. Therefore, in accordance with
diagnostic standards, the lower cutoff for this method was defined by
the mean percentage of false-positive signals in control tissue that is
negative for the respective translocation (here, sorted BLIN-1 cells)
plus 3 SDs. Applying this definition, an average percentage of 2.5%
leukemic cells carrying the translocation was detected in the sorted
CD34+CD19 Functional analysis of the CD34+CD19 The purity of flow-sorted cell populations largely depends on the
frequency of the target population in the processed sample. Thus,
isolation of rare CD34+CD19 An additional technical limitation of flow sorting of rare events is a
consequence of the log-normal distribution of antigen expression
leading to overlap of different populations.29 In particular, when rare events (in our analysis,
CD34+CD19 These results are consistent with the hypothesis that the leukemia in
childhood TEL/AML1-positive B-cell precursor ALL originates from a CD19+ lymphoid progenitor cell. This does not
contradict recent studies showing involvement of a more primitive
progenitor/stem cell compartment, particularly in high-risk
patients.2-5 In large clinical trials, response to
prednisone has shown to be the single most important prognostic marker
predicting response to therapy and outcome.6,30 It can
thus be speculated that in good-prognosis ALL, such as TEL/AML1-positive ALL, the leukemia originates in a
lymphoid, steroid receptor-positive progenitor cell that is prone to
undergo apoptosis. On the other hand, in patients with prognostically unfavorable subtypes, the leukemia It will be important to determine if the involvement/noninvolvement of the more primitive progenitor/stem cell compartment is specific for certain chromosomal translocations (eg, frequent involvement in ALL/t(9;22) versus noninvolvement in ALL/t(12;21)) or independent of the chromosomal translocations leading to heterogeneity within molecularly defined ALL subtypes. As has recently been shown, even in TEL/AML1-positive ALL there appears to be heterogeneity in the stage of immunoglobulin heavy chain rearrangement and thus the level of differentiation of the lymphoid progenitor in which the translocation occurs.32 Additional studies in larger numbers of patients and different ALL subtypes within prospective clinical trials are therefore necessary to define the frequency and clinical relevance of involvement of the immature prelymphatic progenitor/stem cell compartment in childhood ALL. In addition to gaining a better understanding of the stem cell biology of ALL, this has many therapeutic implications. In some children with prognostically unfavorable ALL subtypes or with relapse, autologous stem cell transplantation is regarded as one possible treatment option if no allogeneic donor is available. Transplantation protocols often include purging of the autologous stem cell products to minimize the potential risk of reinfusing leukemic cells.33,34 However, purging strategies based on the expression of lymphoid markers will only be effective if all leukemic cells, including putative immature ALL stem cells, express the respective marker. Detection of minimal residual disease in childhood ALL has been correlated with a high risk of relapse.35,36 Immunologic methods based on leukemia-associated immunophenotypes may, however, lack sensitivity if the most primitive leukemic progenitors have a phenotype distinct from the bulk leukemic population. Most importantly, exact definition of the leukemic phenotype is a
prerequisite for the development of effective immunotherapy. CD19 is
considered a promising candidate target antigen because its expression
is highly B-lineage specific. CD19 is under the control of the B-cell
transcription factors Pax537 and human early B-cell
factor-like protein,38 and CD19 knock-out mice show no
abnormalities except for the defects in B-cell function.39 However, if the leukemia originates in a CD19 In conclusion, this investigation provides molecular and functional evidence that in TEL/AML1-positive childhood ALL, immature CD34+ cells that lack expression of B-cell markers are not part of the leukemic cell clone. Our data support the hypothesis that the leukemia in typical childhood ALL originates in a CD19+ lymphoid progenitor.1 This has many implications for understanding the biology of TEL/AML1-positive B-cell precursor ALL and for targeting therapy against the leukemic cell clone.
We gratefully thank Dr B. Bürger, Prof Dr J. Kienast, Dr T. Lapidot, and Dr C. Rössig for critically reviewing the manuscript and Prof Dr W.-D. Ludwig and Prof Dr M. Schrappe from the ALL-BFM study group for providing 2 additional patient samples. We acknowledge Christina Böth-Sauerwein, Sabine Gräf-Höchst, Thomas Jung, and Tanja Möllers for technical help.
Submitted August 15, 2001; accepted March 13, 2002.
Supported by DFG grant Vo 476/3-3 (J.V.).
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Josef Vormoor, Klinik und Poliklinik für Kinderheilkunde, Pädiatrische Hämatologie/Onkologie, Universitätsklinikum Münster, Albert-Schweitzer-Str 33, 48129 Münster, Germany; e-mail: vormoor{at}uni-muenster.de.
1. Greaves MF. Stem cell origins of leukaemia and curability. Br J Cancer. 1993;67:413-423[Medline] [Order article via Infotrieve].
2.
George AA, Franklin J, Kerkof K, et al.
Detection of leukemic cells in the CD34+CD38
3.
Cobaleda C, Gutierrez-Cianca N, Perez-Losada J, et al.
A primitive hematopoietic cell is the target for the leukemic transformation in human Philadelphia-positive acute lymphoblastic leukemia.
Blood.
2000;95:1007-1013 4. Quijano CA, Moore D, Arthur D, Feusner J, Winter SS, Pallavicini MG. Cytogenetically aberrant cells are present in the CD34+CD33-CD38-CD19- marrow compartment in children with acute lymphoblastic leukemia. Leukemia. 1997;11:1508-1515[CrossRef][Medline] [Order article via Infotrieve]. 5. Stankovic T, Weston V, McConville CM, et al. Clonal diversity of Ig and T-cell receptor gene rearrangements in childhood B-precursor acute lymphoblastic leukemia. Leuk Lymphoma. 2000;36:213-224[Medline] [Order article via Infotrieve].
6.
Schrappe M, Reiter A, Ludwig WD, et al.
Improved outcome in childhood acute lymphoblastic leukemia despite reduced use of anthracyclines and cranial radiotherapy: results of trial ALL-BFM 90.
Blood.
2000;95:3310-3322
7.
Borkhardt A, Cazzaniga G, Viehmann S, et al.
Incidence and clinical relevance of TEL/AML1 fusion genes in children with acute lymphoblastic leukemia enrolled in the German and Italian multicenter therapy trials.
Blood.
1997;90:571-577
8.
Friedmann AM, Weinstein HJ.
The role of prognostic features in the treatment of childhood acute lymphoblastic leukemia.
Oncologist.
2000;5:321-328
9.
Ramakers van Woerden NL, Pieters R, Loonen AH, et al.
TEL/AML1 gene fusion is related to in vitro drug sensitivity for L-asparaginase in childhood acute lymphoblastic leukemia.
Blood.
2000;96:1094-1099 10. Krishna-Narla R, Navara C, Sarquis M, Uckun FM. Chemosensitivity of TEL-AML1 fusion transcript positive acute lymphoblastic leukemia cells. Leuk Lymphoma. 2001;41:615-623[Medline] [Order article via Infotrieve].
11.
Seeger K, Adams H-P, Buchwald D, et al.
TEL-AML1 fusion transcripts in relapsed childhood acute lymphoblastic leukemia.
Blood.
1998;91:1716-1722 12. Hann I, Vora A, Harrison G, et al. Determinants of outcome after intensified therapy of childhood lymphoblastic leukaemia: results from Medical Research Council United Kingdom acute lymphoblastic leukaemia XI protocol. Br J Haematol. 2001;113:103-114[CrossRef][Medline] [Order article via Infotrieve]. 13. Seeger K, Buchwald D, Peter A, et al. TEL-AML1 fusion in relapsed childhood acute lymphoblastic leukemia. Blood. 1999;92:4792-4797. 14. Vormoor J, Baersch G, Baumann M, Ritter J, Jürgens H. Flow cytometric identification of candidate normal stem cell populations in CD45-negative B-cell precursor acute lymphoblastic leukaemia (ALL). Br J Haematol. 1998;100:501-508[CrossRef][Medline] [Order article via Infotrieve]. 15. Baersch G, Baumann M, Ritter J, Jürgens H, Vormoor J. Expression of AC133 and CD117 on candidate normal stem cell populations in childhood B-cell precursor acute lymphoblastic leukaemia. Br J Haematol. 1999;107:572-580[CrossRef][Medline] [Order article via Infotrieve]. 16. Fearon DT, Carroll MC. Regulation of B lymphocyte responses to foreign and self-antigens by the CD19/CD21 complex. Annu Rev Immunol. 2000;18:393-422[CrossRef][Medline] [Order article via Infotrieve].
17.
Loken MR, Shah VO, Dattilio KL, Civin CI.
Flow cytometric analysis of human bone marrow, II: normal B lymphocyte development.
Blood.
1987;70:1316-1324
18.
LeBien TW.
Fates of human B-cell precursors.
Blood.
2000;96:9-23 19. Rosenfeld C, Goutner A, Venuat AM, et al. An effect human leukaemic cell line: Reh. Eur J Cancer. 1977;13:377-379[Medline] [Order article via Infotrieve]. 20. Wörmann B, Anderson JM, Liberty JA, et al. Establishment of a leukemic cell model for studying human pre-B to B cell differentiation. J Immunol. 1989;142:110-117[Abstract]. 21. Bonnet D, Dick JE. Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell. Nat Med. 1997;3:730-737[CrossRef][Medline] [Order article via Infotrieve]. 22. Lapidot T, Sirard C, Vormoor J, et al. A cell initiating human acute myeloid leukaemia after transplantation into SCID mice. Nature. 1994;367:645-648[CrossRef][Medline] [Order article via Infotrieve].
23.
Behm FG, Raimondi SC, Schell MJ, Look AT, Rivera GK, Pui C-H.
Lack of CD45 antigen on blast cells in childhood acute lymphoblastic leukemia is associated with chromosomal hyperdiploidy and other favorable prognostic features.
Blood.
1992;79:1011-1016
24.
Borowitz MJ, Shuster J, Carroll AJ, et al.
Prognostic significance of fluorescence intensity of surface marker expression in childhood B-precursor acute lymphoblastic leukemia. A Pediatric Oncology Group Study.
Blood.
1997;89:3960-3966
25.
Sperling C, Schwartz S, Büchner T, Thiel E, Ludwig WD.
Expression of the stem cell factor receptor C-KIT (CD117) in acute leukemias.
Haematologica.
1997;82:617-621
26.
Bene MC, Bernier M, Casasnovas RO, et al.
The reliability and specificity of c-kit for the diagnosis of acute myeloid leukemias and undifferentiated leukemias. The European Group for the Immunological Classification of Leukemias (EGIL).
Blood.
1998;92:596-599
27.
Arico M, Valsecchi MG, Camitta B, et al.
Outcome of treatment in children with Philadelphia chromosome-positive acute lymphoblastic leukemia.
N Engl J Med.
2000;342:998-1006
28.
Schrappe M, Arico M, Harbott J, et al.
Philadelphia chromosome-positive (Ph+) childhood acute lymphoblastic leukemia: good initial steroid response allows early prediction of a favorable treatment outcome.
Blood.
1998;92:2730-2741 29. Shapiro HM. Practical Flow Cytometry. New York, NY: Wiley-Liss; 1995.
30.
Dordelmann M, Reiter A, Borkhardt A, et al.
Prednisone response is the strongest predictor of treatment outcome in infant acute lymphoblastic leukemia.
Blood.
1999;94:1209-1217
31.
Lapidot T, Grunberger T, Vormoor J, et al.
Identification of human juvenile chronic myelogenous leukemia cells capable of initiating the disease in primary and secondary SCID mice.
Blood.
1996;88:2655-2664
32.
Weston VJ, McConville CM, Mann JR, et al.
Molecular analysis of single colonies reveals a diverse origin of initial clonal proliferation in B-precursor acute lymphoblastic leukemia that can precede the t(12;21) translocation.
Cancer Res.
2001;61:8547-8553 33. Balduzzi A, Gaipa G, Bonanomi S, et al. Purified autologous grafting in childhood acute lymphoblastic leukemia in second remission: evidence for long-term clinical and molecular remissions. Leukemia. 2001;15:50-56[CrossRef][Medline] [Order article via Infotrieve]. 34. Houtenbos I, Bracho F, Davenport V, et al. Autologous bone marrow transplantation for childhood acute lymphoblastic leukemia: a novel combined approach consisting of ex vivo marrow purging, modulation of multi-drug resistance, induction of autograft vs leukemia effect, and post-transplant immuno- and chemotherapy (PTIC). Bone Marrow Transplant. 2001;27:145-153[CrossRef][Medline] [Order article via Infotrieve].
35.
Coustan-Smith E, Sancho J, Hancock ML, et al.
Clinical importance of minimal residual disease in childhood acute lymphoblastic leukemia.
Blood.
2000;96:2691-2696 36. van Dongen JJ, Seriu T, Panzer-Grümayer ER, et al. Prognostic value of minimal residual disease in acute lymphoblastic leukaemia in childhood. Lancet. 1998;352:1731-1738[CrossRef][Medline] [Order article via Infotrieve]. 37. Nutt SL, Morrison AM, Dörfler P, Rolink A, Busslinger M. Identification of BSAP (Pax-5) target genes in early B-cell development by loss- and gain-of-function experiments. EMBO J. 1998;17:2319-2333[CrossRef][Medline] [Order article via Infotrieve]. 38. Gisler R, Akerblad P, Sigvardsson M. A human early B-cell factor-like protein participates in the regulation of the human CD19 promoter. Mol Immunol. 1999;36:1067-1077[CrossRef][Medline] [Order article via Infotrieve]. 39. Engel P, Zhou LJ, Ord DC, Sato S, Koller B, Tedder RF. Abnormal lymphocyte development, activation, and differentiation in mice that lack or overexpress the CD19 signal transduction molecule. Immunity. 1995;3:39-50[CrossRef][Medline] [Order article via Infotrieve].
© 2002 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  D. Hong, R. Gupta, P. Ancliff, A. Atzberger, J. Brown, S. Soneji, J. Green, S. Colman, W. Piacibello, V. Buckle, et al. Initiating and Cancer-Propagating Cells in TEL-AML1-Associated Childhood Leukemia Science, January 18, 2008; 319(5861): 336 - 339. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Landmeier, B. Altvater, S. Pscherer, B. R. Eing, J. Kuehn, C. M. Rooney, H. Juergens, and C. Rossig Gene-Engineered Varicella-Zoster Virus Reactive CD4+ Cytotoxic T Cells Exert Tumor-Specific Effector Function Cancer Res., September 1, 2007; 67(17): 8335 - 8343. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. E. Sabaawy, M. Azuma, L. J. Embree, H.-J. Tsai, M. F. Starost, and D. D. Hickstein TEL-AML1 transgenic zebrafish model of precursor B cell acute lymphoblastic leukemia PNAS, October 10, 2006; 103(41): 15166 - 15171. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. M. Serrano, T. Pfeiffer, S. Olivares, T. Numbenjapon, J. Bennitt, D. Kim, D. Smith, G. McNamara, Z. Al-Kadhimi, J. Rosenthal, et al. Differentiation of naive cord-blood T cells into CD19-specific cytolytic effectors for posttransplantation adoptive immunotherapy Blood, April 1, 2006; 107(7): 2643 - 2652. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. R. Panzer-Grumayer, G. Cazzaniga, V. H.J. van der Velden, L. del Giudice, M. Peham, G. Mann, C. Eckert, A. Schrauder, G. Germano, J. Harbott, et al. Immunogenotype Changes Prevail in Relapses of Young Children with TEL-AML1-Positive Acute Lymphoblastic Leukemia and Derive Mainly from Clonal Selection Clin. Cancer Res., November 1, 2005; 11(21): 7720 - 7727. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Campana, S. Iwamoto, L. Bendall, and K. Bradstock Growth requirements and immunophenotype of acute lymphoblastic leukemia progenitors Blood, May 15, 2005; 105(10): 4150 - 4150. [Full Text] [PDF]
|
|
|
|
|
|
M. Hotfilder, S. Rottgers, A. Rosemann, A. Schrauder, M. Schrappe, R. Pieters, H. Jurgens, J. Harbott, and J. Vormoor Leukemic Stem Cells in Childhood High-Risk ALL/t(9;22) and t(4;11) Are Present in Primitive Lymphoid-Restricted CD34+CD19- Cells Cancer Res., February 15, 2005; 65(4): 1442 - 1449. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. V. Cox, R. S. Evely, A. Oakhill, D. H. Pamphilon, N. J. Goulden, and A. Blair Characterization of acute lymphoblastic leukemia progenitor cells Blood, November 1, 2004; 104(9): 2919 - 2925. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Tsuzuki, M. Seto, M. Greaves, and T. Enver Modeling first-hit functions of the t(12;21) TEL-AML1 translocation in mice PNAS, June 1, 2004; 101(22): 8443 - 8448. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2002 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
progenitor/stem
cells in TEL/AML1-positive acute lymphoblastic leukemia are
genetically and functionally normal
Top
Abstract
Introduction
2-D
-mercaptoethanol were added, and the samples were passed
through Qiashredder columns (Qiagen) according to the manufacturer's
protocol. The lysate was frozen and stored at 
80°C. Total
RNA was extracted from the frozen lysates according to the
RNeasy-Mini-Kit (Qiagen) protocol. RNA was finally eluted with 30 µL
ribonuclease-free water and stored at 
, RT-PCR; 
, FISH analysis; 
, sorter errors)
indicate individual values. The error bars show the SD.
