|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
TRANSPLANTATION
From the Department of Research, University Hospital,
Basel, Switzerland; the Department of Pediatrics, Heme/Onc/BMT
Division, University of Minnesota Cancer Center, Minneapolis; Amgen
Inc, Thousand Oaks, CA; and the Division of Research Immunology/BMT,
Children's Hospital, Los Angeles, CA.
Thymus-dependent reconstitution of the peripheral T-cell
compartment is critical for the successful outcome of bone marrow transplantation. However, graft-versus-host disease (GVHD) affects thymic stromal function and thus prevents normal T-cell maturation and
selection. To determine whether cytoprotection of thymic epithelial cells (TECs) by keratinocyte growth factor (KGF) averts
GVHD-related injury to the thymus, a nonirradiated murine
parent Allogeneic bone marrow transplantation (BMT)
is the treatment of choice for a number of malignant and nonmalignant
disorders.1,2 The outcome of BMT is dependent on a
successful and comprehensive reconstitution of the immune system with a
broad T-cell receptor (TCR) repertoire, which, in turn, requires the de
novo generation of T cells in the thymus.3-9 In this
regard, effective development and normal repertoire selection of T
cells are critically dependent on the seeding of hematopoietic
precursor cells to a regularly structured thymic
microenvironment.10 T-cell precursors enter the thymus at
the cortico-medullary junction as cells with a
CD3 The thymic stromal compartment is mainly composed of a complex
3-dimensional network of epithelial cells with distinct
phenotypes.10 These cells effect discrete functions
including attraction of hematopoietic precursors to the thymus,
promotion of early thymocyte differentiation,13,14
selection of DP cells, and functional maturation of newly generated T
cells. Unique subtypes of cortical and medullary thymic epithelial
cells (TECs) have been distinguished by use of scanning electron
microscopy15 and immunohistology,16-18 suggesting that each cell type plays a distinct role in providing the
above functions. In the absence of a regularly structured and composed
thymic microenvironment, these essential functions are severely altered
and frequently preclude normal thymocyte development to
occur.19,20 Mesenchymal-epithelial cell interactions are
crucial for TEC morphogenesis with growth regulated in a paracrine fashion by keratinocyte growth factor (KGF, aka fibroblast growth factor 7 [FGF-7]), FGF-10, and possibly other
factors.21-32 Both KGF and FGF-10 regulate epithelial cell
proliferation and differentiation, the former frequently in synergy
with other growth factors.33 The biologic activities of
KGF and FGF-10 are mediated through the KGF receptor (KGFR), that is,
the FGFR2IIIb splice variant of the FGF-2 receptor.34,35
Direct involvement of the KGFR in thymic development was recently
demonstrated in KGFR-deficient mice and animals mutant for FGF-10, both
revealing a developmental arrest in thymic organogenesis at day 12.5 of
gestation.22
Graft-versus-host disease (GVHD) represents a major transplant-related
complication initiated by host-reactive donor T
cells.36,37 Morphologic and functional alterations have
been documented for the thymus that identify this organ as a specific
target of acute GVHD, with thymocytes, TECs, and bone marrow-derived
thymic stroma cells each being affected. In consequence, these severe
changes lead to dysplasia, thymic involution, disappearance of Hassall bodies, and a loss in the distinction of cortex and medulla, ultimately disturbing regular thymocyte development.38-44
Specifically, in the affected thymic microenvironment pro- and pre-T
cells fail to a large extent to enter the cell cycle, DP cells undergo
enhanced apoptosis, and aberrant repertoire selection results in the
persistence of T cells with a self-reactive
specificity.45-49 The molecular basis for the profound
effects on the thymic microenvironment remains to be determined. It is,
however, likely that the appropriate physiologic signals critical for
homing of hematopoietic precursors to the thymus and for subsequent
T-cell development cannot be sufficiently provided by TECs affected by GVHD.
Protecting thymic epithelium from a harmful alloimmune response
following BMT may ameliorate GVHD-associated deficits in transplant recipients. The purpose of this study was therefore to determine whether stimulation of KGFR with pharmacologic doses of KGF prevents the injury inflicted on the thymic microenvironment during the course
of acute GVHD. To this end, a nonconditioned murine parent Mice
Reagents
Graft-versus-host disease The transplantation model used has been previously described in detail.45,46,50,51,53 In brief, acute GVHD was induced by transplantation of nonirradiated B6D2F1 mice (Ly5.2+;H-2bxd) with 25 × 106 unseparated parental C57BL/6 splenocytes (Ly5.2+; H-2b), or with congenic B6.CD45.1 (Ly5.1+; H-2b) cells. Donor cells were administered in a volume of 400 µL Leibovitz-15 media (Invitrogen AG, Basel, Switzerland) via tail vein injection. Mice that received syngeneic transplants (B6D2F1 B6D2F1) served as non-GVHD controls
and received 25 × 106 donor splenocytes.
KGF treatment Mice were injected subcutaneously for a period from days 3 to
+3 after induction of GVHD (day 0) with Hanks balanced salt solution
(HBSS) or recombinant human KGF (rhKGF; solubilized in HBSS) at a dose
of 5 mg/kg per day. rhKGF was produced in Escherichia coli
and had a median effective dose (ED50) of 40.02 ng/mL (kindly provided
by Amgen, Thousand Oaks, CA). B6D2F1 control mice that received syngeneic transplants were treated either with HBSS or with
KGF. Significant differences between these 2 latter treatment groups
were not observed except where indicated in "Results."
Flow cytometric analysis Cells (0.5-1 × 106) were washed, resuspended in 1% fetal calf serum (FCS)/phosphate buffered saline (PBS)/sodium azide and incubated for 15 minutes at 4°C with unlabeled 2.4G2 moAb to prevent unspecific binding of the Fc receptors. For 3-color flow
cytometry, cells were first stained with fluorochrome- and
biotin-conjugated moAbs and were subsequently labeled with
streptavidin-Cy5 (Zymed Laboratories). Washed cells were immediately
analyzed using a 2-laser FACS calibur (Becton Dickinson, Mountain
View, CA).
Analysis of cell proliferation in vivo At 3 hours and one hour before they were killed, mice that had received transplants were injected intraperitoneally (ip) with 5'-bromo-2'-deoxyuridine (BrdU; 1 mg in 0.2 mL PBS; Sigma, Buchs, Switzerland). Thymi were isolated and DNA-synthesizing cells were detected by 4-color flow cytometry, as described previously.46,56 Briefly, thymocytes (1 × 106) were stained with a mixture of PE-conjugated anti-CD3,-CD8,-CD4 moAbs, CyChrome-conjugated anti-CD44 moAb, and biotinylated anti-CD25 moAb for 30 minutes on ice. Cells were then washed and incubated with streptavidin-Cy5 for 15 minutes. Cells were subsequently permeabilized with ice-cold 0.15M NaCl/95% ethanol for 30 minutes at 4°C and fixed for another 30 minutes at room temperature in 1% paraformaldehyde/PBS with 0.01% Tween. Cells were then treated with 50 U/mL DNAse I in a 0.15 M NaCl/4.2mM MgCl2 buffer for 10 minutes at room temperature. After washing, cells were stained with FITC-conjugated anti-BrdU moAb for 30 minutes at room temperature. Washed cells were analyzed using a FACScalibur (Becton Dickinson, Franklin Lakes, NJ).Detection of donor/host chimerism To discern donor-derived T cells (Ly5.1+) from host T cells (Ly5.2+), thymocytes and splenocytes were isolated from mice that received transplants and control mice and stained with biotin-conjugated anti-CD45.1 moAb and revealed with streptavidin-CyChrome.Cell separation Freshly isolated thymocytes were stained with the appropriate moAbs and then sorted into CD4 CD8, CD4+CD8+,
CD4+CD8, and
CD4CD8+ subpopulations with the use of a
FACSvantage cell sorter (Becton Dickinson, Franklin Lakes, NJ). Thymic
epithelial cells were isolated using a previously published
method.57 Briefly, thymi were digested with collagenase D
and thymocytes were removed thereafter from the cell suspension.
Adherent cells were stained with a combination of anti-Iab
(major histocompatibility [MHC] class II) and CD45 moAbs.
Ia+CD45 cells were sorted on a FACSvantage.
Histopathology and immunohistology For detection of KGFR and CD80 surface expression, thymi were isolated and embedded in cryoembedding media (Tissue-Tek, Sakura Finetec, Netherlands). Frozen samples were cut into 6-µm-thick sections, fixed with 4% paraformaldehyde/PBS, and stained with biotinylated anti-FGFR-2 or anti-CD80 antibodies for one hour. After washing, sections were incubated with streptavidin-conjugated horseradish peroxidase. Sections were then incubated with 3'-amino-9'-ethylcarbazole (AEC; Sigma) and counterstained with hemalaun. For analysis of thymic morphology, fixed paraffin sections were stained with hematoxylin and eosin.Panels of antibodies and lectins have previously been used to
characterize different TEC subsets.16-18 In brief, TEC
subsets were identified using combinations of anti-cytokeratin 18 moAb and UEA-1 lectin, polyclonal anti-cytokeratin 5 antibody, and the
epithelial cell-specific MTS-10 antibody. The particular staining protocol was adapted from Klug and coworkers18 and is
listed in more detail in Table 1. The 2- and 3-color immunoflourescent sections were analyzed using a confocal
microscope (Carl-Zeiss AG, Feldbach, Switzerland).
Polymerase chain reaction For end-point polymerase chain reaction (PCR) analysis of KGFR messenger RNA (mRNA) expression, total RNA was isolated from whole thymic tissue, freshly isolated thymic epithelial cells, established thymic epithelial cell lines, or thymocyte subpopulations (where indicated). After reverse transcription, the complementary DNA (cDNA) was amplified for 38 cycles.For quantitative PCR analysis, total RNA was isolated from unseparated
thymic tissue at day 13 after transplantation. RNA was reverse
transcribed and the resulting cDNA was amplified in a total volume of
25 µL buffer containing 20 ng cDNA, 1 x SYBR Green PCR Master
Mix (PE Biosystems, Rotkreuz, Switzerland), and 300 nM forward and
reverse primer each. Primers for real-time PCR were designed according
to published mouse RNA sequences. As an internal reference for thymic
epithelial cells, the gene for the epithelial V-like antigen
(EVA)58 was amplified, whereas glyceraldehyde phosphate
dehydrogenase (GAPDH) was used as an internal reference for all cells.
The cycle conditions were as follows: 50°C for 2 minutes followed by
95°C for 10 minutes, after which 40 cycles of amplification were
carried out (95°C for 15 seconds, 60°C for 1 minute). The PCR
reaction was performed in a GeneAmp 5700 SDS Real Time PCR machine (PE
Biosystems). Samples were analyzed in triplicates, and the result was
averaged. Primers used are as follows: EVA: sense GTGCCGCCTGCTCGTC,
antisense CCGAACATCTGTCCCGTTGA; GAPDH: sense ACCATGTAGTTGAGGTCAATGAAGG,
antisense GGTGAAGGTCGGTGTGAACG; Mip-1 Statistical analysis Groups were compared by one-way analysis of variance (ANOVA). Where ANOVA revealed a significant difference, the Bonferroni/Dunn post hoc test was performed. The overall statistical significance level was set to 5%. StatView from SAS Institute (Cary, NC) was used for statistical analysis.
Treatment of transplant recipients with KGF diminishes thymic GVHD To investigate a role for KGF in the prevention of thymic GVHD, a murine haploidentical transplantation model was investigated. The model was independent of total body irradiation or other cytotoxic preconditioning regimens that may adversely affect thymocytes and thymic epithelial cells. Severe acute GVHD was elicited in B6D2F1 mice by transfer of 25 × 106 unseparated splenocytes from C57BL/6 donors. In addition, the mice that received transplants (B6B6D2F1) were treated
subcutaneously from days 3 to day +3 of transplantation with either
HBSS or KGF (5 mg/kg per day). HBSS-treated B6D2F1
recipients of 25 × 106 syngeneic B6D2F1
splenocytes served as controls.
The effect of KGF on thymic weight, cellularity, and function was
investigated on day 13 after transplantation. As demonstrated in Figure
1A-B, mice that had received allogeneic
transplants and had been injected with HBSS suffered a significant loss
in thymic weight and cellularity when compared with syngeneic controls. However, treatment with KGF fully inhibited this GVHD-induced thymic
injury. Thymocytes of mice that had received syngeneic transplants and
had been treated with KGF displayed normal thymocyte maturation
comparable to B6D2F1
Because the extent of thymic damage had been previously correlated with the presence of mature donor T cells entering the thymus,46 we next determined the frequencies and absolute numbers of infiltrating T cells of donor origin in these mice. Thymic single-cell suspensions of Ly5.2+ recipients were analyzed by flow cytometry for the in situ presence of mature Ly5.1+ cells. KGF treatment diminished the relative percentage of thymus-infiltrating T cells, and in particular that of mature CD8+ cells, when compared with HBSS-treated mice (Figure 1C). However, the absolute number of donor-derived T cells was several-fold higher in KGF-treated hosts when compared with control transplant recipients (ie, those injected with HBSS). Thus, the protective effect of KGF during GVHD on thymocyte development was not due to a decrease in thymus-infiltrating mature T cells. Thymocytes of mice that had received syngeneic and allogeneic
transplants and had been treated with either HBSS or KGF were further
analyzed for expression of CD3, CD4, and CD8. Comparing the 3 experimental groups, significant changes in the relative number
of TN thymocytes were not observed (Figure 1D). However, the DP
population was severely diminished whereas SP mature thymocytes were
greatly increased in B6 KGF treatment maintains normal cell cycle progression of resident
CD3
Because the loss of TN cells during GVHD is the consequence of impaired
cellular proliferation, we investigated whether KGF averted this
functional deficiency. BrdU incorporation was used to determine cell
cycle progression56 which normally occurs at all
phenotypic TN stages and in particular within stages II and IV for each
TN subpopulation. In B6 KGF treatment fails to modulate splenic GVHD Because the spleen serves as a typical target of acute GVHD, we next assessed the extent of splenic damage in B6B6D2F1
mice treated either with KGF or HBSS. KGF influenced neither
weights nor absolute cellularities of the spleens in mice that received allogeneic transplants when compared with mice injected with HBSS (Figure 3A-B). Moreover, treatment with
KGF had no effect on the degree of donor T-cell infiltration (Figure
3C). Phenotypic analysis by flow cytometry of splenocytes revealed for
both groups of recipients a loss in non-T cells (eg, B lymphocytes) in
lieu of CD4+CD8 and
CD4CD8+ T cells (Figure 3D). Thus, in vivo
administration of KGF did not affect the severity of splenic
GVHD.
The receptor for KGF is expressed on TECs but not on thymocytes The effect of KGF on thymic T-cell maturation may either be brought about directly by binding of KGF to its specific receptor on thymocytes or, alternatively, may be accomplished indirectly via an effect on thymic stromal cells. To define the thymic target cell(s) of KGF, thymocytes at all maturational stages and TECs were analyzed by end-point reverse transcription (RT)-PCR for the expression of KGFR. As demonstrated in Figure 4A, transcripts for KGFR were exclusively detected in freshly isolated thymic epithelial cells (CD45MHC II+), in an
established thymic medullary epithelial cell line (mTEC 2-3)55 and in unseparated thymic tissue. In contrast, none
of the purified thymocyte subpopulations displayed mRNA specific for
the KGFR. The selective expression of the receptor on TECs was further
ascertained by immunohistology using a polyclonal antibody directed
against FGFR-2. This antibody was raised against the YDINRVPEEQMTFKDLVS
sequence and specifically recognizes all splice variants of FGFR-2
including FGFR2IIIb (aka KGFR; Dr S. Werner, personal communication,
July 2001). Since KGFR is expressed exclusively on epithelial
cells,33 simultaneous staining with anti-cytokeratin
antibodies will unambiguously identify KGFR on TECs. Our data show that
KGFR was expressed exclusively on thymic epithelial cells of both
cortex and medulla (Figure 4B) as consecutive sections stained for
cytokeratins displayed an identical pattern and KGFR was not expressed
on thymocytes (data not shown), corroborating the PCR data shown in
Figure 4A. Therefore, the observed effects of KGF on intrathymic T-cell
development were likely accomplished via binding of this cytokine to
its specific receptor on TECs.
KGF treatment essentially preserves the thymic microenvironment despite GVHD The loss of normal thymic morphology is a typical feature of GVHD and has recently been linked to the alloimmune response directed against thymic stromal components (W.K. and G.A.H., in preparation, 2002). Because normal T-cell development was preserved by KGF despite acute GVHD (as judged by splenic alterations) and since KGF receptor expression was detected exclusively on TECs, the cellular stromal composition and architecture of the thymic microenvironment was investigated in B6B6D2F1 recipients. Figure 5A shows that the clear separation
between cortex and medulla was lost in acute GVHD in mice treated with
HBSS but was clearly maintained in recipients injected with KGF.
Immunohistology using UAE-1 lectin, MTS-10, and antibodies to
cytokeratin (K) 5 and K18 distinguished TECs into 4 distinct
subpopulations: the major cortical
(K18+K5UEA-1MTS10),
the minor cortical (K18+K5+), the major
medullary (K5+MTS10+), and the minor medullary
epithelial cells (K18+UEA-1+)18
(see Table 1). In HBSS-treated B6B6D2F1 mice, the major cortical epithelial cells were severely diminished in cell number in
response to acute GVHD, contributing to a smaller cortex (Figure 5Bii).
In contrast, treatment with KGF preserved the cellularity of this
subpopulation to a degree indistinguishable to that of syngeneic
transplantation controls (Figure 5Bi,iii). The frequencies of minor
cortical and major medullary epithelial cells also remained unchanged
in mice injected with KGF when compared with syngeneic transplantation
controls, whereas recipients injected with HBSS sustained a substantial
loss of both of these subpopulations (Figure 5Biv-ix). Only minor
medullary epithelial cells appeared to be unaffected by KGF treatment
because both treatment groups of B6B6D2F1 recipients
were shown to display an almost complete loss of this subpopulation
(Figure 5Bx-xii). However, this subpopulation of epithelial cells did
express the KGFR in naïve thymi (data not shown).
KGF affects TEC function The effect of KGF on thymic epithelial cells may include alterations in gene expression that result in enhanced biologic functions, thus maintaining normal thymocyte maturation despite the presence of allogeneic T cells. In normal thymic development, epithelial cells produce necessary chemotactic and activating stimuli to lymphoid precursors, (eg, thymic epithelial chemokine; TECK,59 and macrophage inflammatory protein-1 [Mip-1]60). Moreover, these cells provide crucial survival and proliferation signals for TN cells (eg, IL-7),61 and unique molecules necessary for repertoire selection of DP thymocytes (eg, autoimmune regulator [Aire]).62,63 To investigate whether KGF affected expression of these molecules during acute GVHD, quantitative RT-PCR analysis was performed on thymic tissues. TEC-specific transcripts were normalized to the expression of the EVA.58 Expression of the chemokine TECK was significantly diminished in epithelial cells during GVHD but was partially restored by KGF treatment (Figure 6A). In contrast, IL-7 expression was increased among thymic epithelial cells during GVHD albeit not to a statistically significant degree. KGF treatment had no further effect. Analysis for the expression of the transcription factor Aire, which is usually expressed in minor medullary epithelial cells,62 revealed a decrease of specific mRNA following GVHD. KGF treatment did not restore Aire expression, which is in agreement with a lack of minor medullary epithelial cells in KGF-treated mice with GVHD (Figure 5B).
Because donor T cells mediate a strong inflammatory response and TEC
dysfunction in this nonirradiation model of GVHD, we examined whether
KGF altered the thymic microenvironment and resulted in decreased
inflammation. The mRNA species for granzyme B, Mip-1 KGF reduces CD80 expression in thymic GVHD CD80 (B7.1) is a critical costimulatory molecule for thymocyte development and mature T-cell function.65,66 We therefore determined CD80 expression in thymic tissue sections of mice that received syngeneic and allogeneic transplants. To this end, consecutive thymic tissue sections were analyzed for the expression of CD80 and cytokeratin 18 (CK18), respectively. The comparison of the staining revealed a pattern compatible with CD80 expression on thymic epithelial cells (data not shown). We found that CD80 expression was up-regulated in the thymus in the presence of acute GVHD (Figure 7A). Treatment with KGF diminished this expression in both the cortical and medullary compartment to a degree comparable to syngeneic transplant recipients despite an increase in the absolute number of mature donor-derived T cells. These immunohistologic findings were further corroborated by quantitative PCR analysis (Figure 7B). Thus, KGF treatment reduces the cell surface expression of the costimulatory molecule CD80 on stromal cells (and possibly other cells, including activated T cells) and may thus hamper their allogeneicity.
KGF preserved normal thymic development as revealed by typical
cellularity, frequency, and cellular proliferation of the different immature and mature thymocyte subsets despite the systemic presence of
acute GVHD (Figures 1-3). The structure of the thymic microenvironment following exposure to KGF was almost normal, as assessed by the regular
cellular compositions of several TEC compartments (Figure 5). We
hypothesize that this effect was a direct consequence of KGF on thymic
epithelial cells as TECs but not thymocytes or other stromal elements
specifically express the KGF receptor (Figure 4). Treatment with KGF
also reduced CD80 expression, possibly rendering TECs less likely
targets to allogeneic T-cell recognition (Figure 7). Interestingly, the
absolute cell number of mature donor T cells in B6 Recent investigations concerning issues of the mesenchymal-epithelial
cell interactions, the morphogenesis of epithelium, and the mechanisms
operational in cutaneous wound repair have identified KGF as a highly
specific and potent mitogen.21,25-27 Although KGF
transcripts appear to be restricted to cells of mesenchymal origin,
factor-responsive cells are exclusively of epithelial cell type. The
mitogenic activity of KGF is mediated through the KGF receptor, a
splice variant of FGF-2 receptor.34,35 Thymic epithelial
cells have been reported to bear cell surface markers common with
epithelia of other organs, in particular the epidermal keratinocytes in
the skin.67 Despite these phenotypic similarities it is
important to recognize that the capacity to efficiently support
development and selection of T cells is a unique feature of
TECs.68 We now demonstrate that KGFR is expressed in
freshly isolated thymic epithelial cells (ie, MHCII+,
CD45 Cytoprotection constitutes a promising approach to ameliorate epithelial injury inflicted by GVHD. KGF has recently been recognized as an agent for epithelial cell repair in different GVHD target organs. Administered to mice before extensive conditioning and bone marrow transplantation, KGF ameliorated both survival and GVHD related pathologies in liver, lung, and skin but not in spleen, colon, and ileum.69 Similarly, in our experiments, splenic GVHD was not alleviated (Figure 3). In other experimental systems, an increased survival of transplant recipients was also observed when KGF was administered prior to total body irradiation, either alone or in combination with chemotherapy.70,71 Here, KGF treatment protected the gastrointestinal epithelium from radiation- and immune-mediated injury, reflecting variations in the clinical outcome depending on the choice of the experimental model used and the duration of KGF administered. Despite these differences, the central biologic response to pharmacologic doses of KGF was due to a potent trophic effect that may very well be specific for individual tissues. For example, the KGF effect on intestinal epithelium72 included the survival of crypt stem cells,73 improved DNA repair,74 and an enhanced thickness of the entire mucosa71 with an increased formation of goblet cells75 and their secretory products.76,77 Conversely, the decreased pulmonary damage observed after KGF treatment was secondary to enhanced epithelialization and the attenuation of immune-mediated injury.78 Thus, the pharmacologic effects of KGF treatment are documented for tissues where KGF receptor expression has been convincingly demonstrated, such as the intestinal epithelium, hepatocytes, skin keratinocytes, and alveolar type II cells.72,79,80 Although the molecular mechanisms of KGF-mediated protection remain to
be defined, the beneficial effects of KGF on TECs KGF treatment did not prevent damage to all thymic epithelial cell subpopulations (Figure 5B). Although KGFR could be detected on minor medullary epithelial cells by immunohistology, we failed to detect these cells in allogeneic transplant recipients despite KGF treatment. A loss of these cells correlated with a severe decrease of mRNA specific for the transcription factor autoimmune regulator, Aire. This molecule is typically (but not exclusively) expressed in minor medullary epithelial cells.62 A homozygous deficiency for Aire is the etiologic cause of the autoimmune-polyendocrinopathy-candidiasis ectodermal dystrophy (APECED), an autosomal recessive disease without known human leukocyte antigen (HLA) association. The almost complete loss of aire transcripts in allogeneic transplant recipients treated with either HBSS or KGF may therefore have a functional bearing on thymic repertoire selection of T cells despite the normal thymocyte development as judged by cell numbers and phenotype. Experiments are presently underway to address this issue. With its defined role as a cytoprotective agent for epithelial cells, enhanced production of endogenous KGF may thus constitute an adjunct strategy for GVHD treatment following allogeneic BMT. For example, expression of KGF is subject to negative regulation such as glucocorticoids, a standard component of GVHD therapy that decreases KGF mRNA in a time- and concentration-dependent manner.84 In consequence, it may be of clinical benefit to administer exogenous KGF in a pharmacologic dose prior to conditioning and in the presence of thymic GVHD.
The authors thank V. Wyss for excellent technical help and Drs L. Piali and M. Keller for helpful discussions.
Submitted October 24, 2001; accepted March 14, 2002.
Supported by the Swiss National Science Foundation grants 31-555820.98 (G.A.H.) and 0031-61782.00 (W.K.), and National Institutes of Health (NIH) grants RO1 HL54729 and RO1 HL54850 (K.I.W.), and NIH grants RO1 AI34459, RO1 CA72669, RO1 HL55209, and RO1 HL63452 (B.R.B.).
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Georg A. Holländer, Pediatric Immunology, Lab #406, Department of Research, Kantonsspital, Hebelstrasse 20, CH-4031 Basel, Switzerland; e-mail: georg-a.hollaender{at}unibas.ch.
1. Goldman JM, Schmitz N, Niethammer D, Gratwohl A. Allogeneic and autologous transplantation for haematological diseases, solid tumors and immune disorders: current practice in Europe in 1998. Bone Marrow Transpl. 1998;21:1-7[CrossRef][Medline] [Order article via Infotrieve]. 2. Dupont B. Immunology of hematopoietic stem cell transplantation: a brief review of its history. Immunol Rev. 1997;157:5-12[CrossRef][Medline] [Order article via Infotrieve].
3.
Roux E, Dumont-Girard F, Starobinski M, et al.
Recovery of immune reactivity after T-cell-depleted bone marrow transplantation depends on thymic activity.
Blood.
2000;96:2299-2303
4.
Dumont-Girard F, Roux E, van Lier RA, et al.
Reconstitution of the T-cell compartment after bone marrow transplantation: restoration of the repertoire by thymic emigrants.
Blood.
1998;92:4464-4471 5. Douek DC, Vescio RA, Betts MR, et al. Assessment of thymic output in adults after hematopoietic stem cell transplantation and prediction of T-cell reconstitution. Lancet. 2000;355:1875-1881[CrossRef][Medline] [Order article via Infotrieve]. 6. Haynes BF, Markert ML, Sempowski GD, Patel DD, Hale LP. The role of the thymus in immune reconstitution in aging, bone marrow transplantation, and HIV-1 infection. Annu Rev Immunol. 2000;18:529-560[CrossRef][Medline] [Order article via Infotrieve].
7.
Weinberg K, Blazar BR, Wagner JE, et al.
Factors affecting thymic function after allogeneic hematopoietic stem cell transplantation.
Blood.
2001;97:1458-1466 8. Mackall CL, Gress RE. Pathways of T-cell regeneration in mice and humans: implications for bone marrow transplantation and immunotherapy. Immunol Rev. 1997;157:61-72[CrossRef][Medline] [Order article via Infotrieve].
9.
Patel DD, Gooding ME, Parrott RE, Curtis KM, Haynes BF, Buckley RH.
Thymic function after hematopoietic stem cell transplantation for the treatment of severe combined immunodeficiency.
N Engl J Med.
2000;342:1325-1332 10. van Ewijk W, Wang B, Holländer GA, et al. Thymic microenvironments, 3-D versus 2-D? Semin Immunol. 1999;11:57-64[CrossRef][Medline] [Order article via Infotrieve]. 11. Godfrey DI, Kennedy J, Suda T, Zlotnik A. A developmental pathway involving four phenotypically and functionally distinct substes of CD3-CD4-CD8- triple-negative adult mouse thymocytes defined by CD44 and CD25 expression. J Immunol. 1993;150:4244-4252[Abstract]. 12. Holländer GA. Thymic T-cell development. In: Burakoff SJ,Deeg HJ,Ferrara J,Burakoff SJ, eds. Graft-Versus-Host Disease 2nd ed. New York: Marcel Dekker; 1997:1-40.
13.
Petrie HT, Hugo P, Scollay R, Shortman K.
Lineage relationships and developmental kinetics of immature thymocytes: CD3, CD4, and CD8 acquisition in vivo and in vitro.
J Exp Med.
1990;172:1583-1588
14.
Lind EF, Prockop SE, Porritt HE, Petrie HT.
Mapping precursor movement through the postnatal thymus reveals specific microenvironments supporting defined stages of early lymphoid development.
J Exp Med.
2001;194:127-134 15. van Ewijk W, Brekelmans PJ, Jacobs R, Wisse E. Lymphoid microenvironments in the thymus and lymph node. Scanning Microsc. 1988;2:2129-2140[Medline] [Order article via Infotrieve]. 16. Boyd RL, Tucek CL, Godfrey DI, et al. The thymic microenvironment. Immunol Today. 1993;14:445-459[CrossRef][Medline] [Order article via Infotrieve]. 17. Kampinga J, Berges S, Boyd RL, et al. Thymic epithelial antibodies: immunohistological analysis and introduction of nomenclature. Thymus. 1989;13:165-173[Medline] [Order article via Infotrieve].
18.
Klug DB, Carter C, Crouch E, Roop D, Conti CJ, Richie ER.
Interdependence of cortical thymic epithelial cell differentiation and T-lineage commitment.
Proc Natl Acad Sci U S A.
1998;95:11822-11827 19. Holländer GA, Wang B, Nichogiannopoulou A, et al. Developmental control point in induction of thymic cortex regulated by a subpopulation of prothymocytes. Nature. 1995;373:350-353[CrossRef][Medline] [Order article via Infotrieve]. 20. Holländer GA, Simpson SJ, Mizoguchi E, et al. Severe colitis in mice with aberrant thymic selection. Immunity. 1995;3:27-38[CrossRef][Medline] [Order article via Infotrieve]. 21. Mason IJ, Fuller-Pace F, Smith R, Dickson C. FGF-7 (keratinocyte growth factor) expression during mouse development suggests roles in myogenesis, forebrain regionalization and epithelial- mesenchymal interactions. Mech Dev. 1994;45:15-30[CrossRef][Medline] [Order article via Infotrieve].
22.
Revest JM, Suniara RK, Kerr K, Owen JJ, Dickson C.
Development of the thymus requires signaling through the fibroblast growth factor receptor r2-iiib.
J Immunol.
2001;167:1954-1961 23. Revest JM, Spencer-Dene B, Kerr K, De Moerlooze L, Rosewell I, Dickson C. Fibroblast growth factor receptor 2-IIIb acts upstream of Shh and Fgf4 and is required for limb bud maintenance but not for the induction of Fgf8, Fgf10, Msx1, or Bmp4. Dev Biol. 2001;231:47-62[CrossRef][Medline] [Order article via Infotrieve]. 24. Ohuchi H, Hori Y, Yamasaki M, et al. FGF10 acts as a major ligand for FGF receptor 2 IIIb in mouse multi-organ development. Biochem Biophys Res Commun. 2000;277:643-649[CrossRef][Medline] [Order article via Infotrieve]. 25. Werner S. Keratinocyte growth factor: a unique player in epithelial repair processes. Cytokine Growth Factor Rev. 1998;9:153-165[CrossRef][Medline] [Order article via Infotrieve].
26.
Werner S, Smola H, Liao X, et al.
The function of KGF in morphogenesis of epithelium and reepithelialization of wounds.
Science.
1994;266:819-822 27. Finch PW, Cunha GR, Rubin JS, Wong J, Ron D. Pattern of keratinocyte growth factor and keratinocyte growth factor receptor expression during mouse fetal development suggests a role in mediating morphogenetic mesenchymal-epithelial interactions. Dev Dynamics. 1995;203:223-240[Medline] [Order article via Infotrieve]. 28. Auerbach R. Morphogenetic interactions in the development of the mouse thymus. Dev Biol. 1960;2:271[CrossRef][Medline] [Order article via Infotrieve]. 29. Shinohara T, Honjo T. Epidermal growth factor can replace thymic mesenchyme in induction of embryonic thymus morphogenesis in vitro. Eur J Immunol. 1996;26:747-752[Medline] [Order article via Infotrieve]. 30. Shinohara T, Honjo T. Studies in vitro on the mechanism of the epithelial/mesenchymal interaction in the early fetal thymus. Eur J Immunol. 1997;27:522-529[Medline] [Order article via Infotrieve]. 31. Itoi M, Amagai T. Inductive role of fibroblastic cell lines in development of the mouse thymus anlage in organ culture. Cell Immunol. 1998;183:32-41[CrossRef][Medline] [Order article via Infotrieve]. 32. Amagai T, Itoi M, Kondo Y. Limited development capacity of the earliest embryonic murine thymus. Eur J Immunol. 1995;25:757-762[Medline] [Order article via Infotrieve]. 33. Rubin JS, Bottaro DP, Chedid M, et al. Keratinocyte growth factor. Cell Biol Int. 1995;19:399-411[CrossRef][Medline] [Order article via Infotrieve].
34.
Miki T, Fleming TP, Bottaro DP, Rubin JS, Ron D, Aaronson SA.
Expression cDNA cloning of the KGF receptor by creation of a transforming autocrine loop.
Science.
1991;251:72-75
35.
Miki T, Bottaro DP, Fleming TP, et al.
Determination of ligand-binding specificity by alternative splicing: two distinct growth factor receptors encoded by a single gene.
Proc Natl Acad Sci U S A.
1992;89:246-250 36. Blazar BR, Korngold R, Vallera D. Recent advances in graft-versus-host disease (GVHD) prevention. Immunol Rev. 1997;157:79-109[CrossRef][Medline] [Order article via Infotrieve]. 37. Krenger W, Hill GR, Ferrara JLM. Cytokine cascades in acute graft-versus-host disease. Transplantation. 1997;64:553-558[CrossRef][Medline] [Order article via Infotrieve]. 38. Hakim FT, Mackall CL. The immune system: effector and target of graft-versus-host disease. In: Ferrara JLM,Deeg HJ,Burakoff SJ, eds. Graft-Versus-Host Disease 2nd ed. New York: Marcel Dekker; 1997:257-289. 39. Lapp WS, Ghayur T, Mendez M, Seddik M, Seemeyer TA. The functional and histological basis for graft-versus-host-induced immunosuppression. Immunol Rev. 1985;88:107[CrossRef][Medline] [Order article via Infotrieve]. 40. Seddik M, Seemayer TA, Lapp WS. T cell functional defect associated with thymic epithelial cell injury induced by a graft-versus-host reaction. Transplantation. 1980;29:61-66[Medline] [Order article via Infotrieve]. 41. Ghayur T, Seemayer T, Lapp WS, et al. Histologic correlates of immune functional deficits in graft-vs-host disease. In: Burakoff SJ,Deeg HJ,Ferrara J,Atkinson K, eds. Graft-Versus-Host Disease: Immunology, Pathophysiology, and Treatment. New York: Marcel Dekker; 1990:109-132. 42. Ghayur T, Seemayer TA, Xenocostas A, Lapp WS. Complete sequential regeneration of graft-vs-host-induced severely dysplastic thymuses. Implications for the pathogenesis of chronic graft-vs-host disease. Am J Pathol. 1988;133:39-46[Abstract]. 43. Seddik M, Seemayer TA, Lapp WS. The graft-versus-host reaction and immune function. I. T helper cell immunodeficiency associated with graft-versus-host-induced thymic epithelial cell damage. Transplantation. 1984;37:281-286[Medline] [Order article via Infotrieve]. 44. Fukuzawa M, Via CS, Shearer GM. Defective thymic education of L3T4+ T helper cell function in graft-vs-host mice. J Immunol. 1988;141:430-439[Abstract]. 45. Krenger W, Rossi S, Holländer GA. Apoptosis of thymocytes during acute graft-versus-host disease is independent of glucocorticoids. Transplantation. 2000;69:2190-2193[CrossRef][Medline] [Order article via Infotrieve].
46.
Krenger W, Rossi S, Piali L, Holländer GA.
Thymic atrophy in murine acute graft-versus-host disease is effected by impaired cell cycle progression of host pro- and pre-T cells.
Blood.
2000;96:347-354 47. Holländer GA, Widmer B, Burakoff SJ. Loss of normal thymic repertoire selection and persistence of autoreactive T cells in graft vs host disease. J Immunol. 1994;152:1609-1617[Abstract]. 48. van den Brink MR, Moore E, Ferrara JL, Burakoff SJ. Graft-versus-host-disease-associated thymic damage results in the appearance of T cell clones with anti-host reactivity. Transplantation. 2000;69:446-449[CrossRef][Medline] [Order article via Infotrieve].
49.
Fukushi N, Arase H, Wang B, et al.
Thymus: a direct target tissue in graft-versus-host reaction after allogeneic bone marrow transplantation that results in abrogation of induction of self-tolerance.
Proc Natl Acad Sci U S A.
1990;87:6301-6305 50. Murphy WJ, Blazar BR. New strategies for preventing graft-versus-host disease. Curr Opin Immunol. 1999;11:509-515[CrossRef][Medline] [Order article via Infotrieve]. 51. Gleichmann E, Pals ST, Rolink AG, Radaskiewicz T, Gleichmann H. Graft-versus-host reactions: clues to the etiopathology of a spectrum of immunological diseases. Immunol Today. 1984;5:324-327[CrossRef]. 52. Rus V, Svetic A, Nguyen P, Gause WC, Via CS. Kinetics of Th1 and Th2 cytokine production during the early course of acute and chronic murine graft-versus-host disease. J Immunol. 1995;155:2396-2406[Abstract]. 53. Via CS, Sharrow SO, Shearer GM. Role of cytotoxic T lymphocytes in the prevention of lupus-like disease occurring in a murine model of graft-versus-host disease. J Immunol. 1987;139:1840-1849[Abstract].
54.
Via CS, Finkelman FD.
Critical role of interleukin-2 in the development of acute graft-versus-host disease.
Int Immunol.
1993;5:565-572 55. Kasai M, Hirokawa K, Kajino K, et al. Difference in antigen presentation pathways between cortical and medullary thymic epithelial cells. Eur J Immunol. 1996;26:2101-2107[Medline] [Order article via Infotrieve]. 56. Penit C, Vasseur F. Expansion of mature thymocyte subsets before emigration to the periphery. J Immunol. 1997;159:4848-4856[Abstract]. 57. Chidgey AP, Pircher H, MacDonald HR, Boyd RL. An adult thymic stromal-cell suspension model for in vitro positive selection. Dev Immunol. 1998;6:157-170[Medline] [Order article via Infotrieve].
58.
Guttinger M, Sutti F, Panigada M, et al.
Epithelial V-like antigen (EVA), a novel member of the immunoglobulin superfamily, expressed in embryonic epithelia with a potential role as homotypic adhesion molecule in thymus histogenesis.
J Cell Biol.
1998;141:1061-1071
59.
Wilkinson B, Owen JJ, Jenkinson EJ.
Factors regulating stem cell recruitment to the fetal thymus.
J Immunol.
1999;162:3873-3881
60.
Dairaghi DJ, Franz-Bacon K, Callas E, et al.
Macrophage inflammatory protein-1beta induces migration and activation of human thymocytes.
Blood.
1998;91:2905-2913
61.
Malek TR, Porter BO, He YW.
Mutiple
62.
Zuklys S, Balciunaite G, Agarwal A, Fasler-Kan E, Palmer E, Holländer GA.
Normal thymic architecture and negative selection are associated with Aire expression, the gene defective in the autoimmune-polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED).
J Immunol.
2000;165:1976-1983 63. Wang CY, Shi JD, Davoodi-Semiromi A, She JX. Cloning of Aire, the mouse homologue of the autoimmune regulator (AIRE) gene responsible for autoimmune polyglandular syndrome type 1 (ASP1). Genomics. 1999;55:322-326[CrossRef][Medline] [Order article via Infotrieve].
64.
Baggiolini M, Dewald B, Moser B.
Interleukin-8 and related chemotactic cytokines 65. Burns RP Jr, Nasir A, Haake AR, Barth RK, Gaspari AA. B7-1 overexpression by thymic epithelial cells results in transient and long-lasting effects on thymocytes and peripheral T helper cells but does not result in immunodeficiency. Cell Immunol. 1999;194:162-177[CrossRef][Medline] [Order article via Infotrieve]. 66. Lenschow DJ, Walunas TL, Bluestone JA. CD28/B7 system of T cell costimulation. Annu Rev Immunol. 1996;14:233-258[CrossRef][Medline] [Order article via Infotrieve]. 67. Patel DD, Whichard LP, Radcliff G, Denning SM, Haynes BF. Characterization of human thymic epithelial cell surface antigens: phenotypic similarity of thymic epithelial cells to epidermal keratinocytes. J Clin Immunol. 1995;15:80-92[CrossRef][Medline] [Order article via Infotrieve]. 68. Anderson G, Moore NC, Owen JJ, Jenkinson EJ. Cellular interactions in thymocyte development. Annu Rev Immunol. 1996;14:73-99[CrossRef][Medline] [Order article via Infotrieve].
69.
Panoskaltsis-Mortari A, Lacey DL, Vallera DA, Blazar BR.
Keratinocyte growth factor administered before conditioning ameliorates graft-versus-host disease after allogeneic bone marrow transplantation in mice.
Blood.
1998;92:3960-3967
70.
Krijanovski OI, Hill GR, Cooke KR, et al.
Keratinocyte growth factor separates graft-versus-leukemia effects from graft-versus-host disease.
Blood.
1999;94:825-831
71.
Farrell CL, Bready JV, Rex KL, et al.
Keratinocyte growth factor protects mice from chemotherapy and radiation-induced gastrointestinal injury and mortality.
Cancer Res.
1998;58:933-939 72. Housley RM, Morris CF, Boyle W, et al. Keratinocyte growth factor induces proliferation of hepatocytes and epithelial cells throughout the rat gastrointestinal tract. J Clin Invest. 1994;94:1764-1777[Medline] [Order article via Infotrieve]. 73. Khan WB, Shui C, Ning S, Knox SJ. Enhancement of murine intestinal stem cell survival after irradiation by keratinocyte growth factor. Radiat Res. 1997;148:248-253[Medline] [Order article via Infotrieve]. 74. Takeoka M, Ward WF, Pollack H, Kamp DW, Panos RJ. KGF facilitates repair of radiation-induced DNA damage in alveolar epithelial cells. Am J Physiol. 1997;272:L1174-L1180[Medline] [Order article via Infotrieve]. 75. Podolsky DK. Healing the epithelium: solving the problem from two sides. J Gastroenterol. 1997;32:122-126[CrossRef][Medline] [Order article via Infotrieve]. 76. Poulsom R, Wright NA. Trefoil peptides: a newly recognized family of epithelial mucin- associated molecules. Am J Physiol. 1993;265:G205-G213[Medline] [Order article via Infotrieve].
77.
Mashimo H, Wu DC, Podolsky DK, Fishman MC.
Impaired defense of intestinal mucosa in mice lacking intestinal trefoil factor.
Science.
1996;274:262-265
78.
Panoskaltsis-Mortari A, Ingbar DH, Jung P, et al.
KGF pretreatment decreases B7 and granzyme B expression and hastens repair in lungs of mice after allogeneic BMT.
Am J Physiol Lung Cell Mol Physiol.
2000;278:L988-999
79.
Pierce GF, Yanagihara D, Klopchin K, et al.
Stimulation of all epithelial elements during skin regeneration by keratinocyte growth factor.
J Exp Med.
1994;179:831-840 80. Panos RJ, Rubin JS, Csaky KG, Aaronson SA, Mason RJ. Keratinocyte growth factor and hepatocyte growth factor/scatter factor are heparin-binding growth factors for alveolar type II cells in fibroblast-conditioned medium. J Clin Invest. 1993;92:969-977[Medline] [Order article via Infotrieve].
81.
Prince LS, Karp PH, Moninger TO, Welsh MJ.
KGF alters gene expression in human airway epithelia: potential regulation of the inflammatory response.
Physiol Genomics.
2001;6:81-89 82. Wurbel MA, Philippe JM, Nguyen C, et al. The chemokine TECK is expressed by thymic and intestinal epithelial cells and attracts double- and single-positive thymocytes expressing the TECK receptor CCR9. Eur J Immunol. 2000;30:262-271[CrossRef][Medline] [Order article via Infotrieve].
83.
Norment AM, Bogatzki LY, Gantner BN, Bevan MJ.
Murine CCR9, a chemokine receptor for thymus-expressed chemokine that is up-regulated following pre-TCR signaling.
J Immunol.
2000;164:639-648 84. Brauchle M, Fassler R, Werner S. Suppression of keratinocyte growth factor expression by glucocorticoids in vitro and during wound healing. J Invest Dermatol. 1995;105:579-584[CrossRef][Medline] [Order article via Infotrieve]. 85. Godfrey DI, Izon DJ, Tucek CL, Wilson TJ, Boyd RL. The phenotypic heterogeneity of mouse thymic stromal cells. Immunology. 1990;70:66-74[Medline] [Order article via Infotrieve].
© 2002 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  D. A. Sultana, S. Tomita, M. Hamada, Y. Iwanaga, Y. Kitahama, N. Van Khang, S. Hirai, I. Ohigashi, S. Nitta, T. Amagai, et al. Gene expression profile of the third pharyngeal pouch reveals role of mesenchymal MafB in embryonic thymus development Blood, March 26, 2009; 113(13): 2976 - 2987. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y.-H. Youm, H. Yang, Y. Sun, R. G. Smith, N. R. Manley, B. Vandanmagsar, and V. D. Dixit Deficient Ghrelin Receptor-mediated Signaling Compromises Thymic Stromal Cell Microenvironment by Accelerating Thymic Adiposity J. Biol. Chem., March 13, 2009; 284(11): 7068 - 7077. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Zuklys, J. Gill, M. P. Keller, M. Hauri-Hohl, S. Zhanybekova, G. Balciunaite, K.-J. Na, L. T. Jeker, K. Hafen, N. Tsukamoto, et al. Stabilized {beta}-Catenin in Thymic Epithelial Cells Blocks Thymus Development and Function J. Immunol., March 1, 2009; 182(5): 2997 - 3007. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. R. Jenq, C. G. King, C. Volk, D. Suh, O. M. Smith, U. K. Rao, N. L. Yim, A. M. Holland, S. X. Lu, J. L. Zakrzewski, et al. Keratinocyte growth factor enhances DNA plasmid tumor vaccine responses after murine allogeneic bone marrow transplantation Blood, February 12, 2009; 113(7): 1574 - 1580. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Demoulins, A. Abdallah, N. Kettaf, M.-L. Baron, C. Gerarduzzi, D. Gauchat, S. Gratton, and R.-P. Sekaly Reversible Blockade of Thymic Output: An Inherent Part of TLR Ligand-Mediated Immune Response J. Immunol., November 15, 2008; 181(10): 6757 - 6769. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Jin, B. N. Desai, B. Navarro, A. Donovan, N. C. Andrews, and D. E. Clapham Deletion of Trpm7 Disrupts Embryonic Development and Thymopoiesis Without Altering Mg2+ Homeostasis Science, October 31, 2008; 322(5902): 756 - 760. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. M. Kelly, S. L. Highfill, A. Panoskaltsis-Mortari, P. A. Taylor, R. L. Boyd, G. A. Hollander, and B. R. Blazar Keratinocyte growth factor and androgen blockade work in concert to protect against conditioning regimen-induced thymic epithelial damage and enhance T-cell reconstitution after murine bone marrow transplantation Blood, June 15, 2008; 111(12): 5734 - 5744. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. V. Komanduri, L. S. St. John, M. de Lima, J. McMannis, S. Rosinski, I. McNiece, S. G. Bryan, I. Kaur, S. Martin, E. D. Wieder, et al. Delayed immune reconstitution after cord blood transplantation is characterized by impaired thymopoiesis and late memory T-cell skewing Blood, December 15, 2007; 110(13): 4543 - 4551. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Bruinsma, P. L. van Soest, P. J. M. Leenen, B. N. Lambrecht, T. Cupedo, B. Lowenberg, J. J. Cornelissen, and E. Braakman Keratinocyte Growth Factor Induces Expansion of Murine Peripheral CD4+Foxp3+ Regulatory T Cells and Increases Their Thymic Output J. Immunol., December 1, 2007; 179(11): 7424 - 7430. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Zhang, E. Hexner, D. Frank, and S. G. Emerson CD4+ T Cells Generated De Novo from Donor Hemopoietic Stem Cells Mediate the Evolution from Acute to Chronic Graft-versus-Host Disease J. Immunol., September 1, 2007; 179(5): 3305 - 3314. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Seggewiss, K. Lore, F. J. Guenaga, S. Pittaluga, J. Mattapallil, C. K. Chow, R. A. Koup, K. Camphausen, M. C. Nason, M. Meier-Schellersheim, et al. Keratinocyte growth factor augments immune reconstitution after autologous hematopoietic progenitor cell transplantation in rhesus macaques. Blood, July 1, 2007; 110(1): 441 - 449. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N Blijlevens and S Sonis Palifermin (recombinant keratinocyte growth factor-1): a pleiotropic growth factor with multiple biological activities in preventing chemotherapy- and radiotherapy-induced mucositis Ann. Onc., May 1, 2007; 18(5): 817 - 826. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y.-W. Chu and F. T. Hakim KGF boosts thymic archiTECture Blood, May 1, 2007; 109(9): 3613 - 3614. [Full Text] [PDF]
|
|
|
|
|
|
K. I. Weinberg ProTECtion from posttransplantation immune deficiency? Blood, May 1, 2007; 109(9): 3617 - 3618. [Full Text] [PDF]
|
|
|
|
|
|
M. M. Hauri-Hohl, M. P. Keller, J. Gill, K. Hafen, E. Pachlatko, T. Boulay, A. Peter, G. A. Hollander, and W. Krenger Donor T-cell alloreactivity against host thymic epithelium limits T-cell development after bone marrow transplantation Blood, May 1, 2007; 109(9): 4080 - 4088. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. W. Rossi, L. T. Jeker, T. Ueno, S. Kuse, M. P. Keller, S. Zuklys, A. V. Gudkov, Y. Takahama, W. Krenger, B. R. Blazar, et al. Keratinocyte growth factor (KGF) enhances postnatal T-cell development via enhancements in proliferation and function of thymic epithelial cells Blood, May 1, 2007; 109(9): 3803 - 3811. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. H. D. Gray, D. Tull, T. Ueno, N. Seach, B. J. Classon, A. Chidgey, M. J. McConville, and R. L. Boyd A Unique Thymic Fibroblast Population Revealed by the Monoclonal Antibody MTS-15 J. Immunol., April 15, 2007; 178(8): 4956 - 4965. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Min, A. Panoskaltsis-Mortari, M. Kuro-o, G. A. Hollander, B. R. Blazar, and K. I. Weinberg Sustained thymopoiesis and improvement in functional immunity induced by exogenous KGF administration in murine models of aging Blood, March 15, 2007; 109(6): 2529 - 2537. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. H. D. Gray, N. Seach, T. Ueno, M. K. Milton, A. Liston, A. M. Lew, C. C. Goodnow, and R. L. Boyd Developmental kinetics, turnover, and stimulatory capacity of thymic epithelial cells Blood, December 1, 2006; 108(12): 3777 - 3785. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. R. Blazar, D. J. Weisdorf, T. DeFor, A. Goldman, T. Braun, S. Silver, and J. L. M. Ferrara Phase 1/2 randomized, placebo-control trial of palifermin to prevent graft-versus-host disease (GVHD) after allogeneic hematopoietic stem cell transplantation (HSCT) Blood, November 1, 2006; 108(9): 3216 - 3222. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. O. Gillard and A. G. Farr Features of Medullary Thymic Epithelium Implicate Postnatal Development in Maintaining Epithelial Heterogeneity and Tissue-Restricted Antigen Expression J. Immunol., May 15, 2006; 176(10): 5815 - 5824. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Alpdogan, V. M. Hubbard, O. M. Smith, N. Patel, S. Lu, G. L. Goldberg, D. H. Gray, J. Feinman, A. A. Kochman, J. M. Eng, et al. Keratinocyte growth factor (KGF) is required for postnatal thymic regeneration Blood, March 15, 2006; 107(6): 2453 - 2460. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. R Blazar and W. J Murphy Bone marrow transplantation and approaches to avoid graft-versus-host disease (GVHD) Phil Trans R Soc B, September 29, 2005; 360(1461): 1747 - 1767. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. N. Haining, D. S. Neuberg, H. L. Keczkemethy, J. W. Evans, S. Rivoli, R. Gelman, H. M. Rosenblatt, W. T. Shearer, J. Guenaga, D. C. Douek, et al. Antigen-specific T-cell memory is preserved in children treated for acute lymphoblastic leukemia Blood, September 1, 2005; 106(5): 1749 - 1754. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A.-M. Wagner, K. Beier, E. Christen, G. A. Hollander, and W. Krenger Leydig cell injury as a consequence of an acute graft-versus-host reaction Blood, April 1, 2005; 105(7): 2988 - 2990. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Imado, T. Iwasaki, Y. Kataoka, T. Kuroiwa, H. Hara, J. Fujimoto, and H. Sano Hepatocyte growth factor preserves graft-versus-leukemia effect and T-cell reconstitution after marrow transplantation Blood, September 1, 2004; 104(5): 1542 - 1549. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Krenger, H. Schmidlin, G. Cavadini, and G. A. Hollander On the Relevance of TCR Rearrangement Circles as Molecular Markers for Thymic Output during Experimental Graft-versus-Host Disease J. Immunol., June 15, 2004; 172(12): 7359 - 7367. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M.-E. Blais, G. Gerard, M. M. Martinic, G. Roy-Proulx, R. M. Zinkernagel, and C. Perreault Do thymically and strictly extrathymically developing T cells generate similar immune responses? Blood, April 15, 2004; 103(8): 3102 - 3110. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Zoller Tumor Vaccination after Allogeneic Bone Marrow Cell Reconstitution of the Nonmyeloablatively Conditioned Tumor-Bearing Murine Host J. Immunol., December 15, 2003; 171(12): 6941 - 6953. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. E. Jenkinson, E. J. Jenkinson, and G. Anderson Differential Requirement for Mesenchyme in the Proliferation and Maturation of Thymic Epithelial Progenitors J. Exp. Med., July 21, 2003; 198(2): 325 - 332. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Ray, Y. Devaux, D. B. Stolz, M. Yarlagadda, S. C. Watkins, Y. Lu, L. Chen, X.-f. Yang, and A. Ray Inducible expression of keratinocyte growth factor (KGF) in mice inhibits lung epithelial cell death induced by hyperoxia PNAS, May 13, 2003; 100(10): 6098 - 6103. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-M. Waldburger, S. Rossi, G. A. Hollander, H.-R. Rodewald, W. Reith, and H. Acha-Orbea Promoter IV of the class II transactivator gene is essential for positive selection of CD4+ T cells Blood, May 1, 2003; 101(9): 3550 - 3559. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2002 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
/CD3 complex renders DP cells
subject to thymic selection generating a repertoire of CD4 and CD8
single positive (SP) cells able to distinguish between vital self and
injurious nonself. During the obligatory postselection maturation,
which takes place in the medulla and may last as little as one day,
thymocytes acquire full functional competence and finally emigrate to
the periphery.
) or HBSS (
). B6D2F1 mice that received
transplants with syngeneic splenocytes served as non-GVHD controls and
received HBSS (
). (A) Thymus weight (mg) and (B) cellularity (total
cell number × 106) were determined. (C) Infiltration
of donor T cells into the thymus (in percent, left; total cell
number × 105, right). Donor-derived T cells were
distinguished from host cells (CD45.2+) by the expression
of CD45.1. (D) Cell surface expression of CD3, CD4, and CD8 on thymic
cells was analyzed by flow cytometry and the major thymocyte subsets
were quantified (% of total cells and total cell numbers × 106, respectively). TN indicates CD3, CD4, CD8
triple-negative thymocytes; DP indicates CD4, CD8 double-positive
thymocytes. The graph represents pooled data from 3 independent
experiments, with 10 mice analyzed for each group. Analysis by ANOVA;
*P < .05.
and consequently on
thymocyte development