Blood, 15 July 2002, Vol. 100, No. 2, pp. 734-735
CORRESPONDENCE
To the editor:
Leu208Val and Ile181Leu variants of cytochrome P450
CYP2C9 are not related to the acenocoumarol dose
requirement in a Spanish population
Cytochrome P450 CYP2C9 is the principal catalyst of
warfarin and acenocoumarol hydroxilation reactions in human liver
microsomes.1 There is a growing interest in the
identification of genetic variants of cytochrome P450
CYP2C9, which can modify its ability to inactivate warfarin and acenocoumarol, since a reduced CYP2C9 activity on these
drugs would put patients at risk of over anticoagulation and subsequent
bleeding complications.2 2C9*2
(Arg144Cys) and 2C9*3 (Ile359Leu) variant alleles
of this cytochrome have been associated with increased sensitivity to
warfarin and acenocoumarol.3-6 But the allelic frequencies
for these variants differ considerably among different ethnic groups:
Caucasians carry the 2C9*2 and 2C9*3 variants
(8% to 20% and 6% to 10%, respectively) more frequently than Asians
do (0% and 2% to 5%, respectively).7 Recently, Leung et
al8 have identified several genetic polymorphisms of
cytochrome P450 CYP2C9 in a Chinese population. Two of them, Leu208Val and Ile181Leu, could have importance in the sensitivity to
oral anticoagulant treatment in Chinese patients. Allele 208Val is more
frequent than the Caucasian wild-type Leu208 in the Chinese population
(75% heterozygotes and 19% homozygotes) and is associated with a
lower warfarin dose requirement, which could explain why the Chinese
population is more sensitive to warfarin than the Caucasian one. The
Ile181Leu allelic variant was present in 9% of studied patients in
heterozygous form and was associated with a higher warfarin dose
requirement in that population.8
We have studied Leu208Val and Ile181Leu variants in 106 Spanish
anticoagulated patients with a stable requirement for acenocoumarol to
keep the international normalized ratio (INR) between 2 and 3.2 (41 patients required no more than 7 mg/wk acenocoumarol; 44 patients required between 7 mg/wk and 28 mg/wk; finally, 21 patients
required more than 28 mg/wk). The population is described in detail
elsewhere.6 Genotyping for Leu208Val and Ile181Leu was
done by polymerase chain reaction followed by digestion with restriction enzyme. Primers for genetic analysis were
TGTGCTCCCTGCAATGTGATCTGGTC (forward) and TGGCCTTACCTGGATCCAGGGGCTGGTC
(reverse). A forced mismatch was included in position 3 from the 3' end
of forward primer to create in combination with 527ATT>CTT
(polymorphism Ile181Leu) a restriction site for
NlaIV. The reverse primer also has a forced
mismatch in position 3 from the 3' end to create in combination with
608TTG>GTG (polymorphism Leu208Val) a restriction site for
Tsp45I.
Neither Leu208Val nor the Ile181Leu variants were detected in any
of the studied patients, indicating that neither of these genetic
variants is involved in the variability of acenocoumarol requirement in
this Spanish population: if these polymorphisms played a
significant role in determining the acenocoumarol dosage in this
population, we should have found some patients carrying the
Leu208Val variant in the group with low acenocoumarol requirement and
patients carrying the Ile181Leu variant in the high-dose group.
In conclusion, we demonstrate that the Leu208Val and the Ile181Leu
polymorphisms of cytochrome P450 CYP2C9 do not seem to play
an important role in sensitivity to acenocoumarol in the Spanish
population. Factors such as 2C9*2 and 2C9*3
variants of CYP2C9, age, sex, pharmacologic
interactions, or associated diseases do not completely account for the
interindividual differences in sensitivity to anticoagulant treatment.
Therefore, it is probable that unknown genetic variants influencing the
coumarin metabolism, which are perhaps different in different
populations, will be described in the near future.
José Zarza, José Hermida, Ramón Montes, Ignacio Alberca, María Luz López, and Eduardo Rocha
Correspondence: Eduardo Rocha, University of Navarra,
Haematology, Avda Pío XII 36, Pamplona 31008, Spain; e-mail:
erocha{at}unav.es
References
1.
Hermans JJ, Thijssen HH.
Human liver microsomal metabolism of the enantiomers of warfarin and acenocoumarol: P450 isozyme diversity determines the differences in their pharmacokinetics.
Br J Pharmacol.
1993;110:482-490.
2.
Fihn SD, McDonell M, Martin D, et al.
Risk factors for complications of chronic anticoagulation: a multicenter study. Warfarin Optimized Outpatient Follow-up Study Group.
Ann Intern Med.
1993;118:511-520[Abstract/Free Full Text].
3.
Aithal GP, Day CP, Kesteven PJ, Daly AK.
Association of polymorphisms in the cytochrome P450 CYP2C9 with warfarin dose requirement and risk of bleeding complications.
Lancet.
1999;353:717-719[CrossRef][Medline]
[Order article via Infotrieve].
4.
Taube J, Halsall D, Baglin T.
Influence of cytochrome P-450 CYP2C9 polymorphisms on warfarin sensitivity and risk of over-anticoagulation in patients on long-term treatment.
Blood.
2000;96:1816-1819[Abstract/Free Full Text].
5.
Margaglione M, Colaizzo D, D'Andrea G, et al.
Genetic modulation of oral anticoagulation with warfarin.
Thromb Haemost.
2000;84:775-778[Medline]
[Order article via Infotrieve].
6.
Hermida J, Zarza J, Alberca I, et al.
Differential effects of 2C9*3 and 2C9*2 variants of cytochrome P-450 CYP2C9 on acenocoumarol sensitivity.
Blood.
2002;99:4237-4239[Abstract/Free Full Text].
7.
Takahashi H, Echizen H.
Pharmacogenetics of warfarin elimination and its clinical implications.
Clin Pharmacokinet.
2001;40:587-603[CrossRef][Medline]
[Order article via Infotrieve].
8.
Leung AY, Chow HC, Kwong YL, et al.
Genetic polymorphism in exon 4 of cytochrome P450 CYP2C9 may be associated with warfarin sensitivity in Chinese patients.
Blood.
2001;98:2584-2587[Abstract/Free Full Text].
