|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Prepublished online as a Blood First Edition Paper on May 13, 2002; DOI 10.1182/blood-2002-01-0086.
CHEMOKINES
From the Experimental Transplantation and Immunology
Branch, Center for Cancer Research, National Cancer Institute, and the
Molecular Immunogenetics and Vaccine Research Section, Metabolism
Branch, National Cancer Institute, Bethesda, MD; and the Laboratory of
Experimental and Computational Biology, National Cancer Institute,
Frederick, MD.
DNA immunizations with glycoprotein 120 (gp120) of human
immunodeficiency virus-1 (HIV-1) usually require boosting with protein or viral vaccines to achieve optimal efficacy. Here, we demonstrate for
the first time that mice immunized with DNA encoding gp120 fused with
proinflammatory chemoattractants of immature dendritic cells, such as An optimal acquired immunodeficiency syndrome
(AIDS) vaccine should be able to induce both antienvelope
(anti-Env) neutralizing antibodies and cellular systemic and
mucosal immune responses to human immunodeficiency virus
(HIV)-infected cells. Importance of mucosal immunity in the prevention
of HIV transmission and viral clearance from mucosal reservoirs has
been previously suggested.1-4 However, a broader use of
the Env glycoprotein 120 (gp120) as a vaccine is
hampered for several reasons. Particularly, gp120 is expressed in
multiple forms during infection. Moreover, monomeric gp120 released
from infected cells exposes different epitopes5,6 that are
not available on the mature oligomer gp120-gp41 of the virus
surface.7,8
Despite the simplicity and potency of naked DNA immunizations, it
has been assumed that immunizations with plasmid DNA encoding gp120
alone are not efficient, although by itself a virus envelope gp120 is weakly immunogenic. Previously, we were unable to elicit gp120-specific antibodies in BALB/c mice immunized with plasmid DNA
alone encoding gp120 or gp160 from 2 different HIV-1 isolates, 89.6 or
593 (A.B., unpublished data, 2000). A wide variety of strategies have
been used to overcome a weak immunogenicity of DNA vaccines: for
example, coadministration of various cytokines such as
granulocyte-macrophage colony-stimulating
factor,9,10 interleukin 12 (IL-12),11
IL-10,11 IL-2/immunoglobulin DNA,10 and booster immunizations with protein or recombinant viral
vaccines, the so-called prime-boost approach.12-15
Recently, we have hypothesized that nonimmunogenic self-tumor antigens
could be rendered immunogenic by targeting them to antigen-presenting
cells (APCs) via chemokine receptors16 differentially expressed on immature dendritic cells (DCs),17 skin
CD1a+ Langerhans cell precursors and
CD34+-derived DCs, and CD11b+ Peyer patch
myeloid DCs.18 Here, we wanted to test our hypothesis further and develop a simple AIDS vaccine strategy using a model antigen, gp120 from HIV-1 isolate 89.6. We demonstrate that
proinflammatory chemoattractants enabled us to overcome a weakness of
DNA vaccines expressing gp120 and to generate reactive neutralizing and
nonneutralizing antibodies to HIV-1 Env. Although the DNA
vaccine was delivered into skin by gene gun immunization, significant
CD8+ cytotoxic T lymphocyte activity (CTL) was detected in
the spleen and Peyer patch, suggesting induction of both systemic and
mucosal immunity.
Fusion gene cloning and plasmid constructions
HIV-1 Env CTL and antibody assays
Immune cells from spleen or Peyer patches were cultured at
5 × 106/mL in 24-well culture plates in complete T-cell
medium: RPMI 1640 containing 10% fetal bovine serum, 2 mM
L-glutamine, 100 U/mL penicillin, 100 mg/mL
streptomycin, and 5 × 10 Serum anti-Env antibodies were assayed by
enzyme-linked immunosorbent assay (ELISA) in a 96-well plate
coated with 2.5 µg/mL gp120 protein (isolate 89.6, expressed vaccinia
virus; a gift of Dr S. K. Phogat, National Cancer
Institute). The bound antibodies were detected by goat antimouse
immunoglobulin G(Fc)-horseradish peroxidase (IgG(Fc)-HRP)
monoclonal antibody (Caltag, Burlingame, CA) and developed with
azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) peroxidase
substrate (KPL, Gaithersburg, MD). Similarly, serum isotypes of
Detection of neutralizing activity of sera by the cell-cell
fusion assay
HIV-neutralization assay Virus-neutralization assays were performed by means of infection with a luciferase reporter HIV-1 Env pseudotyping system.22 Viral stocks were prepared by transfecting 293T cells with plasmids encoding the luciferase virus backbone (pNL-Luc-ER) and Env from various HIV strains. The resulting supernatant was clarified by centrifugation for 10 minutes at 2000 rpm in a Sorvall RT-7 centrifuge (RTH-750 rotor) (Kendro Laboratory Products, Asheville, NC) and stored at 4°C. The virus was preincubated with titrated amounts of immune sera for 1 hour at 37°C. Cells were then infected with 100 µL virus preparation containing 8 µg diethylaminoethyl ether per milliliter for 4 hours at 37°C. After 5 washes with phosphate-buffered saline (PBS), 0.2 mL fresh medium was added to each well in a 96-well plate. Cells were lysed at 48 hours after infection by resuspending in 105 µL cell lysis buffer (Promega, Madison, WI), and 50 µL of the resulting lysate was assayed for luciferase activity, with the use of an equal volume of luciferase substrate (Promega).In vivo immunizations Animal care was provided in accordance with the procedures outlined in Guide for the Care and Use of Laboratory Animals (National Institutes of Health Publication No. 86-23, 1985). Six- to 9-week-old female BALB/c mice (Charles River Laboratories, Frederick, MD) were immunized with plasmid DNA via Helios Gene Gun System (Bio-Rad, Hercules, CA) 5 times every 2 weeks. The abdominal area of mice was shaved, and 1 µm gold particles (Bio-Rad) carrying 1 to 2 µg DNA were injected at 400 psi.16
Fusion with proinflammatory chemoattractants can reverse the lack of immunogenicity of gp120-expressing DNA vaccines To reverse a weak immunogenicity of such antigens as HIV-1 gp120, we constructed mammalian expression plasmids that expressed in-frame fused gp120 of HIV-1 with murine -defensin 2, human MDC, human
MCP-3, or vMIP2 (pmDF2gp120, pMDCgp120, pMCP3gp120, and pvMIP2gp120,
respectively, Figure 1). In addition, we
hypothesized that gp140-14, gp120 with the extracellular domain of gp41
linked via a flexible 14-amino acid spacer peptide, might expose
additional conformational epitopes not found on gp120. Therefore,
fusion constructs using vMIP2 or MDC chemokines were also made for
gp140-14, resulting in pvMIP2gp140-14 and pMDCgp140-14, respectively
(Figure 1). Control constructs expressed gp120 or gp140 alone, and
pgp120 and pgp140-14, respectively. All constructs expressed
equivalent amounts of gp120 when transfected transiently in HEK293
cells (data not shown). Previously, we reported that purified fusion proteins with inflammatory chemokines or murine -defensin 2 generally retained chemokine functional integrity, as demonstrated by
receptor binding assays and chemoattraction of murine bone-marrow
derived immature, but not mature, DCs.16,19
Five BALB/c mice per group were immunized 5 times biweekly by means of
a gene gun with DNA plasmids encoding gp120 alone, or fusion constructs
of gp120 with
Separate sets of experiments were performed to assess the immunogenicity of gp140 constructs. Similarly to pgp120 immunizations, pgp140-14 plasmid did not elicit significant anti-gp120 antibodies, although small amounts of specific antibodies (Abs) were detected at serum dilutions below 1:100 (see group pgp140-14, Figure 2B). Similarly, no anti-gp120 antibodies were detected in the sera of mice immunized with a construct expressing MCP-3 fusion with an irrelevant enhanced green fluorescent protein (EGFP) antigen (pMCP3-EGFP, Figure 2B). In contrast, significant levels of anti-gp120 antibodies were detected in sera of mice immunized with pMDCgp140-14, but not with pvMIP2gp140-14 (Figure 2B). Overall, DNA vaccines pMDCgp120 and pMCP3gp120 elicited repeatedly higher levels of anti-gp120 antibodies than pMDCgp140-14 vaccine (P < .05; Figure 2B). Next we tested whether physical linkage between gp120 and a chemoattractant was required. Five mice per group were immunized with a mixture of DNA constructs encoding unlinked, free MCP-3 and gp120 (pMCP3 plus pgp120); fusion pMCP3gp120 or fusion pMDCgp140-14; or pgp120 alone. As shown in Figure 2C, specific antibodies were elicited only when the DNA vaccine encoded MCP-3 or MDC fused in frame with gp120. Anti-gp120-positive sera from chemokine-gp120 DNA vaccines inhibit HIV-1 Env-mediated cell fusion It has been widely postulated that antibodies elicited to monomeric gp120, recombinant or shed from the virus envelope complex, may be directed to regions that are hidden on the assembled trimer and would thus not have neutralizing activity.5,23 Therefore, we wanted to test whether DNA vaccination, which presumably produced "properly" glycosylated forms of gp120, would generate virus-neutralizing antibodies. We used the vaccinia virus-based reporter gene activation assay for sensitive quantitation of the ability of immune sera to inhibit the fusogenic activities of X4 HIV-1 Env (see "Materials and methods").21 Figure 3 demonstrates that immune sera from mice vaccinated with pMCP3gp120 (Figure 3), pmDF2gp120 (Figure 3A), or pMDCgp120 (Figure 3B), but not with PBS (data not shown), pvMIP2gp120 (Figure 3A), or an irrelevant antigen expressing plasmid (pMCP3-EGFP, Figure 3B), significantly inhibited the fusogenic activity
of the HIV-1 Env. Interestingly, sera from control plasmid pMCP3-EGFP- or pvMIP2gp120-vaccinated mice also slightly inhibited (10%-14%) cell fusion at lower dilutions (1:5 to 1:10). Therefore, to
exclude the possible nonspecific inhibitory activity of mouse sera,
total serum immunoglobulin from pMCP3gp120-immunized mice was purified
on protein G-Sepharose and tested in the assay after normalization of
anti-gp120 antibody content. The purified total serum immunoglobulin
from pMCP3gp120-vaccinated mice also significantly inhibited fusion
mediated by the HIV-1 Env (IgG-pMCP3gp120; Figure 3A). These
results suggest that DNA vaccinations with gp120 fused to MCP-3, MDC,
or -defensin 2 also generated neutralizing antibodies to the
Env from HIV-1, 89.6, although at lower titers (1:125).
Sera from mice immunized with chemokine constructs fused with gp120, particularly with gp140, elicit antibodies with a broader neutralizing activity Next we tested whether sera from DNA-immunized mice could inhibit infection of HIV-1 pseudotype virus. The assay, originally reported by Connor et al,22 used infection of human CD4 and chemokine coreceptor (CCR5 or CXCR4) transfected cells with a luciferase reporter gene containing HIV-1 pseudotype virus (pNL4-3-Luc-ER), which expressed Env from various HIV strains, such as JRFL, NL4-3 (for R5); or 89.6 (for R5×4). Control sera from PBS-treated mice (Figure 4A) or mice immunized with a construct expressing control antigen (EGFP) fused with MCP-3 (Figure 4B,C) did not inhibit infection of pseudotype HIV virus expressing any of the Env. In contrast, immune sera from pMDCgp120-, pMDCgp140-14, or pMCP3gp120-vaccinated mice inhibited infection of CCR5/CD4-transfected cells with pseudotype virus expressing Env of 89.6 HIV-1 (Figure 4A). Inhibition was statistically significant (P < .01), and there was no difference in the inhibition of pseudotype virus expressing 89.6 Env between groups vaccinated with chemokine gp120 and gp140 constructs. Furthermore, these sera also inhibited infection of HIV-1 pseudotype virus expressing Env of other HIV-1 isolates, such as M-tropic NL4-3 (Figure 4B) and JRFL (Figure 4C). However, the magnitude of inhibition for HIV-1 pseudotype viruses expressing either NL4-3 Env (P < .005 in comparison with pMDCgp120; Figure 4B) or JRFL Env (P < .004 and P < .03 in comparison with pMCP3gp120 and pMDCgp120, respectively; Figure 4C) was significantly higher for sera from mice immunized with pMDCgp140-14, despite the fact that these sera contained lower titers of anti-gp120 Abs (Figure 2B). Therefore, the proportion of antibodies that are neutralizing is higher when vaccine includes the gp140 construct rather than the gp120 construct. Overall, these data suggest that DNA vaccinations can elicit significant humoral responses to weakly immunogenic HIV-1 gp120, if this antigen is used as a fusion construct with proinflammatory chemotactic ligands.
DNA immunization with fusion constructs of gp120 with proinflammatory chemotactic ligands elicit systemic and mucosal HIV-specific CD8+ CTL In separate experiments, BALB/c mice were immunized 5 times biweekly via a gene gun with DNA plasmids encoding gp120 alone, or fusion constructs of gp120 with-defensin 2, human MDCs, or MCP-3
(pgp120, pmDF2gp120, pMDCgp120, and pMCP3gp120, respectively). At 2 weeks after the last vaccination, splenocytes or Peyer patch cells were
removed and assayed for CTL against P815 target cells pulsed with HIV-1
89.6A9 peptide (see "Materials and methods"). As shown in
Figure 5A, spleen cells from mice
immunized with MCP-3 or -defensin 2 fusion constructs demonstrated
significant lysis of P815 target cells pulsed with P18-89.6A9 peptide
(pmDF2gp120 and pMCP3g120, respectively, pulsed [indicated by an
asterisk] versus unpulsed targets). In contrast, no CTL were detected
in mice immunized with pgp120 alone, MDC fusion, or PBS. These data suggest that immunizations with DNA plasmids encoding gp120 fused with
proinflammatory chemokines or -defensins induced significant P18-89.6A9-specific systemic CTL. Moreover, mice immunized with DNA
encoding gp120 fused with MCP-3 elicited significant CTL activity in
Peyer patches, suggesting that these vaccines also induced mucosal
immunity (Figure 5B). Similarly, mice immunized with pmDF2gp120 elicited significant, but lower levels of CTL in Peyer patches in 50:1
effector-to-target ratio only (Figure 5C). No CTL were observed in
Peyer patches from control mice immunized with PBS, pgp120, or
pMDCgp120 (Figure 5B,C).
We observed that immunizations delivered into the skin of mice with plasmid DNA expressing gp120 fused with proinflammatory chemoattractants of APCs, such as immature DCs, but not gp120 alone, elicited significant humoral immunity and systemic and mucosal gp120-specific CTL. These results extend our previous demonstration that DNA immunizations with constructs expressing proinflammatory chemokines fused with otherwise nonimmunogenic self-tumor antigens induced protective antitumor immunity that required effector CD8+ T-cells.16,19 In that earlier study, we also observed that the vaccine required physical linkage between chemokine and antigen, and similarly to gp120 constructs, no immunity was elicited by vaccination with mixture of free, unlinked chemokine and antigen. Furthermore, vaccine immunogenicity depended on the ability of the chemokine moiety to retain chemokine receptor binding.16 For example, no immunity was detected when vaccines expressed tumor antigen fused with point-mutated and inactive chemokine. In the current study, we also observed that fusion vaccines
induced low levels of antibodies against the mouse defensin moiety (titers below 1:20; data not shown). We did not detect any harmful effects of these antidefensin or antichemokine Abs in mice
housed in a controlled and sterile environment (data not shown).
However, to circumvent the potential problem of autoimmunity in future human vaccines generated by these fusions, we have proposed that vaccines use xenogeneic or viral chemokines, which may be functionally active across species. In the current study, proof of principle was
demonstrated with the use of human MCP-3 or MDC carriers in mice, which
generated antihuman, but not antimouse, chemokine antibodies (data not
shown). In accordance with that finding, we previously reported
that both murine and human chemokines, such as MCP-3 and MIP3- The precise mechanism of immunity elicited by simple fusion of
gp120 to chemokines or defensin remains to be elucidated. In addition
to targeting gp120 to chemokine receptors on professional APCs,
chemokine or defensin fusion proteins may induce expression of
costimulatory molecules and production of proinflammatory cytokines by
various subsets of immature DCs in vivo. Moreover, T-helper 1 (TH1) or TH2 cells could be differentially
attracted by chemokines, thus modulating immunity. For example, some
chemokines, such as MCP-1 and MDCs, selectively chemoattract
TH2 cells and induce TH2
polarization.25-27 In this respect, while both MDC and
MCP-3 vaccine constructs induced similar levels of anti-gp120 antibody production (Figure 2), MDC fusion constructs failed to elicit HIV-1
P18-89.6A9-peptide specific CTL. Thus, it is tempting to suggest that,
unlike the MCP-3 or In addition, it is encouraging that DNA vaccinations with constructs encoding gp120 fused with proinflammatory chemotactic ligands elicited virus-neutralizing antibodies. This suggests that the expressed monomeric antigen was folded and glycosylated appropriately to expose epitopes available on a trimeric Env complex of the virus. Furthermore, the importance of neutralizing antibodies, including ones to the V3 loop and the CD4-binding domain of gp120, in protection from HIV-1 or simian immunodeficiency virus and human immunodeficiency virus (SHIV) infection has been quite extensively reported.3,4,30,31 The chemokine-gp120 immune sera inhibited HIV-1 Env-mediated cell fusion and infection of pseudotype virus expressing not only the same Env from the 89.6 isolate, but also HIV-1 pseudotype virus expression of various Env (89.6 [for R5×4], Figure 4A; NL4-3 [for R5], Figure 4B; and JRFL [for R5], Figure 4C) despite different coreceptor usage. Furthermore, our data suggest that efficiency of neutralization may be augmented by the use of modified Env antigens, such as gp140-14, a fusion of gp120 with the extracellular domain of gp41 linked via flexible 14-amino acid spacer peptide. Specifically, sera from mice immunized with gp140-14 fusion fused with MDC, but not gp140-14 alone, inhibited both HIV-1 pseudotype viruses expressing heterologous Env, such as NL4-3 or JRFL, with significantly higher efficiency, than gp120 chemokine fusion constructs (pMDCgp120 and pMCP3gp120, respectively). This is despite the fact that the former sera contained lower titers of anti-gp120 antibodies (Figure 2B,C). Although, these differences may not have any biologic significance, it is tempting to speculate that this augmentation in neutralizing activity against pseudovirus expressing various Envs may be related to better accessibility or exposure of conserved epitopes in the gp120-gp41 heterotrimeric complex. In addition, purified gp140-14 protein itself inhibited HIV-1 Env-mediated cell fusions and infection of the pseudotype HIV viruses at 100-fold lower concentration than gp120.37 Additional studies are planned to determine whether antibodies to gp140-14 can neutralize HIV-1 from primary isolates, which have Env with less accessibility of epitopes than viruses adapted to grow in T-cell lines. In summary, we have developed an efficient and simple DNA-based vaccine approach, with differential use of proinflammatory chemokines or defensins, as a general strategy for development of more effective vaccines for AIDS and other clinically relevant diseases. This approach may be further exploited by combining several HIV antigens with different chemoattractants targeting professional APCs to develop a polyvalent AIDS vaccine that elicits both robust systemic and mucosal T-cell immune responses, as well as high titers of anti-Env antibodies with broadly neutralizing activity. Induction of mucosal immunity in mice has been observed by others when DNA encoding gp160 was administered via mucosal routes.3,32-34 The importance of mucosal immunity, a primary natural route of transmission of HIV, and a major site of HIV/SIV replication,2 has been suggested by the prevention of mucosal transmission of virus in mice,1 where systemic CTL were not sufficient; by protection from intrarectally challenged SIV; and by the clearance of pathogenic SHIV from the gastrointestinal mucosal reservoir in nonhuman primates.35,36 Therefore, our observation that DNA immunizations with constructs expressing gp120 in the skin induced both mucosal and systemic CTL may be a critical feature for an effective AIDS vaccine.
We are grateful to Drs S. Munhsuren, E. Klyushnenkova, P. A. Ruffini, O. C. Bowersox, and B. Haines for technical assistance; Dr J. Mikovits (SAIC-Frederick, MD) for the gift of anti-gp120 antibody; Dr S. Phogat (Laboratory of Experimental and Computational Biology, National Cancer Institute-Frederick, MD) for providing purified gp120; Drs P. Earl, National Institutes of Health, and T. C. VanCott, US Military HIV Program, for the gift of plasmid DNA containing a portion of HIV-1; and B. Reis (SAIC-Frederick) for proofreading.
Submitted January 15, 2002; accepted April 9, 2002.
Prepublished online as Blood First Edition Paper, May 13, 2002; DOI 10.1182/blood-2002-01-0086.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Arya Biragyn, Building 567, Room 207, National Cancer Institute, Frederick, MD 21702; e-mail: arya{at}mail.ncifcrf.gov.
1. Belyakov IM, Ahlers JD, Brandwein BY, et al. The importance of local mucosal HIV-specific CD8(+) cytotoxic T lymphocytes for resistance to mucosal viral transmission in mice and enhancement of resistance by local administration of IL-12. J Clin Invest. 1998;102:2072-2081[Medline] [Order article via Infotrieve].
2.
Veazey RS, DeMaria M, Chalifoux LV, et al.
Gastrointestinal tract as a major site of CD4+ T cell depletion and viral replication in SIV infection.
Science.
1998;280:427-431 3. Winchell JM, Routray S, Betts PW, Van Kruiningen HJ, Silbart LK. Mucosal and systemic antibody responses to a C4/V3 construct following DNA vaccination of rabbits via the Peyer's patch. J Infect Dis. 1998;178:850-853[Medline] [Order article via Infotrieve]. 4. Baba TW, Liska V, Hofmann-Lehmann R, et al. Human neutralizing monoclonal antibodies of the IgG1 subtype protect against mucosal simian-human immunodeficiency virus infection. Nat Med. 2000;6:200-206[CrossRef][Medline] [Order article via Infotrieve]. 5. Wyatt R, Kwong PD, Desjardins E, et al. The antigenic structure of the HIV gp120 envelope glycoprotein. Nature. 1998;393:705-711[CrossRef][Medline] [Order article via Infotrieve]. 6. Kwong PD, Wyatt R, Robinson J, Sweet RW, Sodroski J, Hendrickson WA. Structure of an HIV gp120 envelope glycoprotein in complex with the CD4 receptor and a neutralizing human antibody. Nature. 1998;393:648-659[CrossRef][Medline] [Order article via Infotrieve]. 7. VanCott TC, Polonis VR, Loomis LD, Michael NL, Nara PL, Birx DL. Differential role of V3-specific antibodies in neutralization assays involving primary and laboratory-adapted isolates of HIV type 1. AIDS Res Hum Retroviruses. 1995;11:1379-1391[Medline] [Order article via Infotrieve].
8.
Kwong PD, Wyatt R, Sattentau QJ, Sodroski J, Hendrickson WA.
Oligomeric modeling and electrostatic analysis of the gp120 envelope glycoprotein of human immunodeficiency virus.
J Virol.
2000;74:1961-1972
9.
Barouch DH, Santra S, Schmitz JE, et al.
Control of viremia and prevention of clinical AIDS in rhesus monkeys by cytokine-augmented DNA vaccination.
Science.
2000;290:486-492
10.
Barouch DH, Santra S, Steenbeke TD, et al.
Augmentation and suppression of immune responses to an HIV-1 DNA vaccine by plasmid cytokine/Ig administration.
J Immunol.
1998;161:1875-1882 11. Boyer JD, Cohen AD, Ugen KE, et al. Therapeutic immunization of HIV-infected chimpanzees using HIV-1 plasmid antigens and interleukin-12 expressing plasmids. AIDS. 2000;14:1515-1522[CrossRef][Medline] [Order article via Infotrieve]. 12. Hanke T, Blanchard TJ, Schneider J, et al. Enhancement of MHC class I-restricted peptide-specific T cell induction by a DNA prime/MVA boost vaccination regime. Vaccine. 1998;16:439-445[CrossRef][Medline] [Order article via Infotrieve]. 13. Caver TE, Lockey TD, Srinivas RV, Webster RG, Hurwitz JL. A novel vaccine regimen utilizing DNA, vaccinia virus and protein immunizations for HIV-1 envelope presentation. Vaccine. 1999;17:1567-1572[CrossRef][Medline] [Order article via Infotrieve]. 14. Putkonen P, Quesada-Rolander M, Leandersson AC, et al. Immune responses but no protection against SHIV by gene-gun delivery of HIV-1 DNA followed by recombinant subunit protein boosts. Virology. 1998;250:293-301[CrossRef][Medline] [Order article via Infotrieve]. 15. Amara RR, Villinger F, Altman JD, et al. Control of a mucosal challenge and prevention of AIDS by a multiprotein DNA/MVA vaccine. Science. 2001;292:69-74[CrossRef][Medline] [Order article via Infotrieve]. 16. Biragyn A, Tani K, Grimm MC, Weeks SD, Kwak LW. Genetic fusion of chemokines to a self tumor antigen induces protective, T-cell dependent antitumor immunity. Nat Biotechnol. 1999;17:253-258[CrossRef][Medline] [Order article via Infotrieve]. 17. Sallusto F, Palermo B, Lenig D, et al. Distinct patterns and kinetics of chemokine production regulate dendritic cell function. Eur J Immunol. 1999;29:1617-1625[CrossRef][Medline] [Order article via Infotrieve].
18.
Dieu-Nosjean MC, Massacrier C, Homey B, et al.
Macrophage inflammatory protein 3alpha is expressed at inflamed epithelial surfaces and is the most potent chemokine known in attracting Langerhans cell precursors.
J Exp Med.
2000;192:705-718
19.
Biragyn A, Surenhu M, Yang D, et al.
Mediators of innate immunity that target immature, but not mature, dendritic cells induce antitumor immunity when genetically fused with nonimmunogenic tumor antigens.
J Immunol.
2001;167:6644-6653
20.
Belyakov IM, Wyatt LS, Ahlers JD, et al.
Induction of a mucosal cytotoxic T-lymphocyte response by intrarectal immunization with a replication-deficient recombinant vaccinia virus expressing human immunodeficiency virus 89.6 envelope protein.
J Virol.
1998;72:8264-8272
21.
Nussbaum O, Broder CC, Berger EA.
Fusogenic mechanisms of enveloped-virus glycoproteins analyzed by a novel recombinant vaccinia virus-based assay quantitating cell fusion-dependent reporter gene activation.
J Virol.
1994;68:5411-5422 22. Connor RI, Chen BK, Choe S, Landau NR. Vpr is required for efficient replication of human immunodeficiency virus type-1 in mononuclear phagocytes. Virology. 1995;206:935-944[CrossRef][Medline] [Order article via Infotrieve]. 23. Moore JP, Sodroski J. Antibody cross-competition analysis of the human immunodeficiency virus type 1 gp120 exterior envelope glycoprotein. J Virol. 1996;70:1863-1872[Abstract].
24.
Kledal TN, Rosenkilde MM, Coulin F, et al.
A broad-spectrum chemokine antagonist encoded by Kaposi's sarcoma-associated herpesvirus.
Science.
1997;277:1656-1659 25. Karpus WJ, Lukacs NW, Kennedy KJ, Smith WS, Hurst SD, Barrett TA. Differential CC chemokine-induced enhancement of T helper cell cytokine production. J Immunol. 1997;158:4129-4136[Abstract].
26.
Imai T, Nagira M, Takagi S, et al.
Selective recruitment of CCR4-bearing Th2 cells toward antigen-presenting cells by the CC chemokines thymus and activation-regulated chemokine and macrophage-derived chemokine.
Int Immunol.
1999;11:81-88 27. Gu L, Tseng S, Horner RM, Tam C, Loda M, Rollins BJ. Control of TH2 polarization by the chemokine monocyte chemoattractant protein-1. Nature. 2000;404:407-411[CrossRef][Medline] [Order article via Infotrieve]. 28. Kikuchi T, Crystal RG. Antigen-pulsed dendritic cells expressing macrophage-derived chemokine elicit Th2 responses and promote specific humoral immunity. J Clin Invest. 2001;108:917-927[CrossRef][Medline] [Order article via Infotrieve]. 29. Boyer JD, Kim J, Ugen K, et al. HIV-1 DNA vaccines and chemokines. Vaccine. 1999;17(suppl 2):S53-S64[CrossRef]. 30. Mascola JR, Stiegler G, VanCott TC, et al. Protection of macaques against vaginal transmission of a pathogenic HIV-1/SIV chimeric virus by passive infusion of neutralizing antibodies. Nat Med. 2000;6:207-210[CrossRef][Medline] [Order article via Infotrieve]. 31. Burton DR, Montefiori DC. The antibody response in HIV-1 infection. AIDS. 1997;11(suppl A):S87-S98.
32.
Horner AA, Datta SK, Takabayashi K, et al.
Immunostimulatory DNA-based vaccines elicit multifaceted immune responses against HIV at systemic and mucosal sites.
J Immunol.
2001;167:1584-1591 33. Asakura Y, Lundholm P, Kjerrstrom A, et al. DNA-plasmids of HIV-1 induce systemic and mucosal immune responses. Biol Chem. 1999;380:375-379[CrossRef][Medline] [Order article via Infotrieve]. 34. Wang B, Dang K, Agadjanyan MG, et al. Mucosal immunization with a DNA vaccine induces immune responses against HIV-1 at a mucosal site. Vaccine. 1997;15:821-825[CrossRef][Medline] [Order article via Infotrieve]. 35. Belyakov IM, Hel Z, Kelsall B, et al. Mucosal AIDS vaccine reduces disease and viral load in gut reservoir and blood after mucosal infection of macaques. Nat Med. 2001;7:1320-1326[CrossRef][Medline] [Order article via Infotrieve].
36.
Murphey-Corb M, Wilson LA, Trichel AM, et al.
Selective induction of protective MHC class I-restricted CTL in the intestinal lamina propria of rhesus monkeys by transient SIV infection of the colonic mucosa.
J Immunol.
1999;162:540-549 37. Chow YH, Wei OL, Phogat S, et al. Conserved structures exposed in HIV-1 envelope glycoproteins stabilized by flexible linkers as potent entry inhibitors and potential immunogens. Biochemistry. 2002;41:7176-7182[CrossRef][Medline] [Order article via Infotrieve].
© 2002 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  G. Diamond, N. Beckloff, and L.K. Ryan Host Defense Peptides in the Oral Cavity and the Lung: Similarities and Differences Journal of Dental Research, October 1, 2008; 87(10): 915 - 927. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. A. Pfender, S. Grosch, G. Roussel, M. Koch, E. Trifilieff, and J. M. Greer Route of Uptake of Palmitoylated Encephalitogenic Peptides of Myelin Proteolipid Protein by Antigen-Presenting Cells: Importance of the Type of Bond between Lipid Chain and Peptide and Relevance to Autoimmunity J. Immunol., February 1, 2008; 180(3): 1398 - 1404. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. B. Fredriksen and B. Bogen Chemokine-idiotype fusion DNA vaccines are potentiated by bivalency and xenogeneic sequences Blood, September 15, 2007; 110(6): 1797 - 1805. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. A. Ryan, J. M. Spratt, W. J. Britton, and J. A. Triccas Secretion of Functional Monocyte Chemotactic Protein 3 by Recombinant Mycobacterium bovis BCG Attenuates Vaccine Virulence and Maintains Protective Efficacy against M. tuberculosis Infection Infect. Immun., January 1, 2007; 75(1): 523 - 526. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Weinberg, M.E. Quinones-Mateu, and M.M. Lederman Role of Human {beta}-defensins in HIV Infection Advances in Dental Research, April 1, 2006; 19(1): 42 - 48. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Biragyn, P. A. Ruffini, M. Coscia, L. K. Harvey, S. S. Neelapu, S. Baskar, J.-M. Wang, and L. W. Kwak Chemokine receptor-mediated delivery directs self-tumor antigen efficiently into the class II processing pathway in vitro and induces protective immunity in vivo Blood, October 1, 2004; 104(7): 1961 - 1969. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2002 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
-interferon inducible protein-10 (IP10/CXCL10) secretion signal sequence (pgp120) with the
use of polymerase chain reaction (PCR) primers PRM89.6ENV-5' (AAAGTCGACAAAGAAAAAACGTGG GTCACAATCT) and PR89.6ENV-3'
(ATTCCCGGGTTATTTTTCTCTTTGCACTGTTCT TCTC). The cloning strategy for
chemokine genes has been reported elsewhere.
5 M 2-mercaptoethanol. At 3 days later, 10% concanavalin A supernatant was added as a source of
IL-2 (T-STIM; Collaborative Biomedical Products, Bedford, MA). Spleen
or Peyer patch cells were stimulated in vitro with P18-89.6A9 peptide
(Ile-Gly-Pro-Gly-Arg-Ala-Phe-Tyr-Ala)
spontaneous release)/(maximum release - spontaneous
release). Maximum release was determined from supernatants of cells
that were lysed by addition of 5% Triton-X 100. Spontaneous release
was determined from target cells incubated without added effector cells.
-gp120 antibodies were assayed with the use of HRP-conjugated goat
antimouse IgG1, IgG2a, IgG2b, and IgG3 (Caltag). Serum
antichemokine and antidefensin antibodies were assayed by
ELISA in a 96-well plate coated with 2.5 µg/mL human monocyte
chemoattractant protein-3 (MCP-3/CCL7), macrophage-derived chemokine
(MDC/CCL22), or viral macrophage inflammatory protein II (vMIP2) (R&D
Systems, Minneapolis, MN), or purified 
