|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
CLINICAL OBSERVATIONS, INTERVENTIONS, AND THERAPEUTIC TRIALS
From the Department of Haematology, Royal Bournemouth
Hospital, Bournemouth United Kingdom; Dorset Research and Development
Support Unit, Poole Hospital, Poole, United Kingdom; and Department of
Haematology, Derriford Hospital, Plymouth, United Kingdom.
This study evaluates the prognostic significance of genetic
abnormalities (detected at or shortly after presentation), clinical stage, lymphocyte morphology, CD38 expression, and IGVH
gene status in 205 patients with chronic lymphocytic leukemia (B-CLL).
Deletion of chromosome 11q23, absence of a deletion of chromosome
13q14, atypical lymphocyte morphology, and more than 30% CD38
expression are significantly associated with the presence of unmutated
IGVH genes. Advanced stage, male sex, atypical morphology,
more than 30% CD38 expression, trisomy 12, deletion of chromosome
11q23, loss or mutation of the p53 gene, and unmutated
IGVH genes are all poor prognostic factors in a univariate
analysis. However, only 98% or more homology of IGVH genes
to the germline sequence, loss or mutation of the p53 gene,
and clinical stage retain prognostic significance in a multivariate
analysis. The median survival of patients with mutated IGVH
genes, unmutated IGVH genes, and loss or mutation of the
p53 gene regardless of IGVH gene status is 310, 119, and 47 months, respectively. These data should facilitate the
design of new trials for the management of patients presenting with
advanced disease or poor prognosis early stage disease.
(Blood. 2002;100:1177-1184) Currently, 70% to 80% of patients with chronic
lymphocytic leukemia (CLL) present with a low tumor burden and are
frequently diagnosed from a blood count performed for an incidental
reason.1 Treatment of these patients at presentation with
chlorambucil does not prolong survival.2,3 Therapeutic
options for patients with progressive disease and those who present
with advanced disease have recently increased.4,5 The
introduction of new and more reliable prognostic factors may be
valuable in 2 clinical situations. First, they may facilitate the
design of randomized clinical trials to determine whether early
intensive treatment of patients with a low tumor burden and poor risk
factors can prolong survival. Second, they may influence the choice of
initial treatment and subsequently the need for and benefit of
additional treatments for patients with advanced or progressive disease.
Both the French and Spanish CLL study groups identified good risk
factors such as a normal hemoglobin, low lymphocyte count, nondiffuse bone marrow infiltration, and lymphocyte doubling time of more than 1 year, which identified a subgroup of patients with smoldering CLL from within Binet stage A or Rai stage 0 or 1 disease.6,7 However, disease in 10% of these patients
still progresses and requires treatment. Serum markers
including Genetic studies using chromosome analysis or interphase fluorescence in
situ hybridization (FISH) have identified recurring abnormalities with
prognostic significance.11,12 Patients with a normal
karyotype or deletion of 13q14 as the sole genetic abnormality have a
better prognosis than those with a complex karyotype or deletion of
11q23 or 17p13. In addition del11q23 is associated with bulky
lymphadenopathy13 and a high incidence of residual disease
following autologous transplantation,14 whereas structural abnormalities of 17p13 resulting in loss or mutation of the
p53 gene correlate with resistance to purine
analogues.15,16
In 1999, our group17 and Damle et al18
demonstrated that patients with mutated IGVH genes had
significantly superior survival compared with patients with unmutated
IGVH genes. This finding also applies to patients presenting
with Binet stage A disease and has subsequently been corroborated by
other studies.19,20 Expression of CD38 has recently been
shown to have prognostic value in multivariate analyses, which
have included clinical stage, cytogenetic abnormalities, and
The aim of this study is to evaluate the prognostic significance of
genetic abnormalities and CD38 expression, assessed at or close to
presentation, on the survival of patients whose IGVH genes
have been sequenced.
Patients
In all cases, clinical diagnosis of CLL was based on standard
morphologic and immunophenotypic criteria. Atypical lymphocyte morphology was defined as more than 10% prolymphocytes or more than
15% lymphoplasmacytoid or cleaved cells. Clinical follow-up for all
patients ranged from 4 to 370 months, with a median follow-up of 74 months, and for live patients from 8 to 370 months with a median
follow-up of 88 months. Ten patients have been followed for more than
20 years.
Patients were considered to have progressive disease if they had at
least one of the following parameters: a lymphocyte doubling time of
less than 1 year, progression to a more advanced Binet stage,
development of systemic symptoms or Richter syndrome, or a downward
trend of hemoglobin or platelet count to below the normal range.
Patients with progressive or advanced disease were treated
predominantly with chlorambucil as first-line therapy and since 1991 with fludarabine for chronically relapsing or resistant disease.
Patients who died during the period of follow-up have been categorized
either as dying from a CLL-related cause or a non-CLL-related cause.
Categorization was made independently by 2 assessors (D.G.O. and
T.J.H.), who then discussed and resolved any disagreements.
Plan of investigation
Interphase FISH was used to detect trisomy 12 and deletions at 11q23 in all cases where these abnormalities had not been detected by conventional cytogenetics; 138 and 178 cases, respectively, were thus examined. Interphase FISH was also used to detect loss of the p53 gene in 76 cases in which conventional cytogenetics had not detected abnormality at 17p, and in 13 cases that had a translocation or deletion of chromosome 17 (12 cases) or known p53 mutation (1 case). Expression of p53 protein was assessed by flow cytometry in 145 cases, including all those that were not examined by FISH. The nonisotopic RNase cleavage assay (NIRCA, AMS Biotechnology, Oxford, United Kingdom)28 was used to screen for p53 mutation in 3 of the referred cases, 1 of which had a del17p, 1 a normal karyotype, and 1 in which no metaphases were obtained for karyotype analysis. Direct sequence analysis of the p53 gene was performed in all but one of the cases that showed abnormality by FISH or flow cytometry and one case in which a positive NIRCA result was the only indication of p53 abnormality. Southern blot analysis was used as an additional method to detect loss at 13q14 in 144 cases where sufficient tumor DNA was available. This included 24 of the 34 cases with a karyotypic abnormality of 13q14 and 120 additional cases. Expression of CD38 was analyzed by flow cytometry in the 171 cases for which a suitable sample taken at or close to the time of presentation was available. Cytogenetics Cultures of peripheral blood were established using phorbol 12-myristate 13-acetate (TPA) as a mitogen, harvested after 3, 4, and 5 days of incubation and processed by standard cytogenetic techniques to obtain metaphases for analysis. Karyotype analysis of a minimum of 30 metaphases was carried out on Giemsa-trypsin-Leishman (GTL)-banded slides.Interphase FISH Separate hybridizations were carried out for loci on chromosomes 11, 12, and 17. For chromosomes 12 and 17, commercial probes were used (Vysis UK, London, United Kingdom). An alpha satellite DNA probe CEP12, directly labeled with SpectrumOrange, was used to detect aneuploidy of chromosome 12. LSIp53, together with CEP17 alpha satellite DNA probe labeled with SpectrumOrange and SpectrumGreen (Vysis), respectively, were used to evaluate chromosome deletion at 17p13.1. For chromosome 11, CEPH yacs 755b11 and 801b11 were labeled by nick translation with SpectrumOrange dUTP and SpectrumGreen dUTP (Vysis), respectively, according to the manufacturer's protocol. Hybridization was to peripheral blood lymphocytes, which were separated by density gradient centrifugation, treated with hypotonic solution (KCl) and fixed with methanol-acetic acid, or to cells from our archive of fixed TPA stimulated lymphocyte cultures, which were stored at 20°C after
karyotype analysis. A minimum of 200 interphase nuclei was assessed
from each hybridization.
Southern blot Southern analysis for deletion at 13q14 was carried out as described previously.29 Ten micrograms of both tumor and control DNA was digested with the restriction enzymes EcoRI or HindIII and size fractionated on a 1% agarose gel before transfer to Hybond-N membrane (Amersham Pharmacia Biotech, Uppsala, Sweden). The resulting membrane was then hybridized with the probe p9E4.3, which recognizes a 4.3-kb EcoRI fragment within a region 10 kb centromeric of D13S319, a marker frequently deleted in CLL.The membrane was also hybridized with a control probe, p105-15A, located at 5q11.2, which serves as an internal hybridization standard. Following hybridization the resulting autoradiographs were examined using a scanning densitometer (Amersham Pharmacia Biotech). Tumor samples were assessed as heterozygously deleted when the ratio of test to control probe was 40% to 75% that of the control sample on the membrane. Tumor samples were assessed as homozygously deleted at the p9E4.3 13q14 locus if the ratio of the test to control probe was less than 20% compared to the control samples. p53 expression Ficol-separated peripheral blood lymphocytes were fixed in 0.5% paraformaldehyde for 30 minutes at 4°C followed by 80% ethanol at20°C. Cells were washed in phosphate-buffered saline (PBS) with
1% human serum albumin (Bio-Products Laboratory, Elstree, Herts,
United Kingdom) and 0.05% Tween 20 (Sigma, Poole, Dorset, United
Kingdom), before being labeled with 5 µL 1:20 dilution of
unconjugated p53 antibody (clone D0-7, Dako, Glostrup, Denmark). A
fluorescein isothiocyanate (FITC)-labeled sheep antimouse secondary antibody (Novacastra Laboratories, Newcastle, United Kingdom) diluted
1:200 was then applied. Isotype controls were run in parallel. Five
thousand events were collected from each sample on a Becton Dickinson
(San Jose, CA) FACSCalibur flow cytometer and analyzed using Cell Quest
software. Eleven patients, who had no p53 mutations on sequencing, were
used to establish the cutoff value for p53 by flow cytometry. The
cutoff value (median plus 2 SDs) for this group was 30%, and values
more than 30% were considered to be positive.30
p53 mutational analysis Complementary DNA (cDNA) was synthesized by reverse transcription using an oligo (dT) primer (Promega, Madison, WI) from RNA extracted from Ficol-separated peripheral blood lymphocytes. A 1.1-kb fragment of the coding region was amplified by polymerase chain reaction (PCR) using primers p53S2 (5'GAGCCGCAGTCAGATCCTAG3') and p53CT (5'GTCTGAGTCAGGCCCTTCTG3'). Direct sequencing using 6 internal primers 1: 5'CAGACCTATGGAAACTACTTCCTG3'; 2: 5'TCGGATAAGATGCTGAGGAG3'; 3: 5'CCTATGAGCCGCCTGAGGTT3'; 4: 5'CTTCCAGTGTGATGATGGTG3'; 5: 5'AACATCTCGAAGCGCTCACG3'; 6: 5'AACATCTTGTTGAGGGCAGG3'), which were designed to optimize the coverage of exons 3 to 10, was performed on an ABI 310 sequencer (Applied Biosystems, Foster City, CA). Sequence data were compared with wild-type sequence and any mutations identified were confirmed by duplicate PCR and sequence analysis.IGVH gene analysis Immunoglobulin variable region genes were sequenced as previously described.17 The preferred source material was RNA. cDNA was synthesized as above and amplified by PCR using a mixture of oligonucleotide 5' primers specific for each leader sequence of the VH1 to VH6 families or a consensus 5' FW1 region primer, together with either a consensus 3' primer complementary to the germ line JH regions or a 3' primer complementary to the constant region. Clonal sequences were determined by sequencing amplicons from at least 2 independent PCR reactions. The majority of samples were sequenced directly using the automated DNA sequencer. Nucleotide sequences were aligned to EMBL/GenBank and current databases (V-BASE sequence directory,31 using MacVector 4.0 sequence analysis software; International Biotechnologies, New Haven, CT, and Lasergene; DNASTAR, Madison, WI). Percentage homology was calculated by counting the number of mutations between the 5' end of FR1 and the 3' end of FR3.Analysis of CD38 expression Cells (106) from cryopreserved specimens or fresh whole blood were incubated for 15 minutes with 5 µL of the following antibodies: FITC-labeled anti-CD5 (clone DK23, Dako), phycoerythrin (PE)-labeled anti-CD38 (clone HB7, Becton Dickinson), and R-phycoerythrin-cyanine 5 (RPE-Cy5) labeled anti-CD19 (clone HD37, Dako). Red cells were lysed with FACSlyse (Becton Dickinson) and a minimum of 10 000 cells was acquired in the Cell Quest program on a FACSCalibur flow cytometer (Becton Dickinson). Each sample was run with an appropriate isotype control (FITC-labeled mouse IgG1 and PE-labeled mouse IgG1, both from Dako) and this was used to define the negatively stained cells. In each case the dot-plot was gated on the lymphoid gate on the side scatter-forward scatter (SCC-FSC) plot. Within this gate the markers were set on the isotype control to define the negative population. A single cell was regarded as CD38+ if its position lay outside this marker. The tumor population was defined by gating of the lymphoid population on the SCC-FSC plot, followed by gating of the CD5+/CD19+ population. The percentage of CD38+ cells in this gate was then determined. A cutoff point for CD38 expression of 30% was chosen because we have previously been shown this to give the highest Youden index.24Statistical methods Data were analyzed using SPSS for Windows Version 10. The association between prognostic factors and IGVH gene status was summarized using odds ratios with 95% CIs. For each level of each factor the odds ratio for having unmutated VH genes has been expressed relative to a reference level. The P values for the unadjusted associations were calculated using the 2 test for association, incorporating Yates continuity
correction when the prognostic factor had only 2 levels. Because these
prognostic factors are statistically interrelated, logistic regression
was used to determine those factors that were independently associated with IGVH gene status. A forward stepping modeling procedure
(using a 5% significance level) was chosen, so that the ratio of
number of patients with unmutated genes to the number of prognostic
factors in the model at each step was as high as possible. Because
patients are excluded from this modeling procedure if they have missing data for any of the factors, the odds ratios and P values
for the final model were then recalculated using only those factors that were significant. The remaining factors were then added to this
model singly to confirm that their P values remained high.
Survival functions have been estimated using the product-limit (Kaplan-Meier) method. Ten-year mortality (together with its SE) and median survival times (95% CI) have been used as summary statistics for the survival curves. The advantage of the former is that it can be calculated even when survival times are long relative to length of follow-up. The effect of prognostic factors on survival has been summarized using hazard ratios with 95% CIs, and for each level of each factor these have been expressed relative to a reference level. For univariable analysis, survival curves have been compared between groups using the log-rank test. Because these prognostic factors are interrelated the Cox proportional hazards model has been used to identify the independent prognostic factors. The method for reaching the final model is the same as described for logistic regression above. Interactions between prognostic factors were also tested. The 10-year mortality rate from non-CLL-related causes has been calculated by subtracting the 10-year mortality for CLL related deaths from the 10-year mortality for all deaths. Because there is controversy as to which percentage homology to the
nearest germline sequence most reliably separates patients into good or
poor risk groups, the Youden index32 for accurate identification of deaths was calculated for IGVH gene
homologies from 94% to 99% in 1% increments. The sensitivities and
specificities, which are given equal weight in calculating the
index for each cut-point (x), were estimated from the 10-year
mortality rates for patients above and below x, and the proportion of
patients above x. The best cutoff point has been chosen on the basis of having the highest Youden index (sensitivity + specificity
Patient data We have studied 205 patients with CLL; 118 (58%) were men and 87 were women. At presentation 169 (82%) were Binet stage A, 21 (10%) stage B, and 15 (7%) stage C. A total of 137 (67%) patients had stable disease. There were 77 deaths during 1665 total years follow-up of which 46 deaths were considered to be disease related. The 10-year mortality from CLL-unrelated deaths was similar for patients with mutated IGVH genes and those with unmutated VH genes (13% versus 9%).The IGVH genes were mutated in 123 cases (60%) and unmutated in 82. Lymphocyte morphology was evaluable in 199 patients, of whom 68 (34%) had atypical morphology. CD38 expression was tested in 171 cases of whom 71 (42%) had more than 30% expression of CD38. Cytogenetic and genetic data An abnormal karyotype was detected at or near the time of presentation in 141 (69%) patients. The prevalence of trisomy 12 and structural abnormalities of chromosomes 11q23, 13q14, and 17p13 detected by karyotype analysis was 29%, 10%, 17%, and 6%, respectively. Surprisingly interphase FISH detected trisomy 12, del11q23, and loss of the p53 gene in only 1.4%, 2.2%, and 0%, respectively, of the cases that lacked these abnormalities karyotypically. For the 13q14 locus Southern analysis using a 13q14.3 probe showed either heterozygous or homozygous loss in all 24 patients with a karyotypic abnormality of 13q14 and detected deletion of this locus in 54 of 120 (45%) cases with no evidence of 13q14 abnormality by conventional chromosome analysis.The overall incidence of trisomy 12 and structural abnormalities of 13q14, 11q23, and 17p13 was therefore 30%, 62%, 19%, and 6%, respectively. The true incidence of 13q14 loss may be underestimated because 60 cases without karyotypic abnormality of 13q14 were not tested by Southern blot analysis. Fifteen patients had loss or mutation of p53 (Table
1). All 12 cases with a translocation or
deletion of 17p13 were shown to have lost one p53 allele by FISH.
Increased expression of p53 protein was found in 6 of 10 cases with a
structural abnormality of 17p and in 1 of 145 cases with no 17p
abnormality detected by karyotype (Figure
1). This case (patient 7) had a
translocation of chromosome 17 with a q arm breakpoint and retained
both p53 alleles by FISH. Mutational analysis was performed in 14 of 15 cases and a p53 mutation was found in 12 of 14 cases; 10 had a point
mutation, 1 had a frameshift mutation, and 1 had a silent mutation.
Karyotype evolution was detected in 37 of 145 cases; of these 3 acquired del11q23, 2 acquired a structural abnormality of 17p, and 1 acquired a structural abnormality of 13q. Association between prognostic variables and IGVH gene status To determine which percentage homology to the nearest germ line IGVH sequence most reliably separates patients into good or poor risk groups, the Youden index was used. The highest value of the Youden index32 occurred for a cutoff of 98% whether CLL-related deaths (Table 2) or all deaths were analyzed.
Table 3 shows the relationship between
IGVH gene status and other prognostic variables. All except
the presence of karyotypic evolution and chromosome 17 abnormalities
were significantly associated with IGVH gene status
(P = < .05). However, for these 2 nonsignificant factors, the odds ratios were still high and the CIs were wide, indicating a possible type 2 error (incorrectly concluding that the
factor is not important).
Because many of these prognostic factors are statistically associated,
logistic regression was used to determine which factors were
independently associated with VH gene status (Tables
4 and 5). Deletion of chromosome
11q23, absence of chromosome 13q14 loss, atypical lymphocyte
morphology, and more than 30% expression of CD38 were all
independently associated with unmutated IGVH genes. The
remaining factors were not statistically significant, but this needs to
be interpreted with care because the adjusted odds ratios for sex and
chromosome 17 abnormalities were still large (both > 2), and the CIs
for all 6 factors were wide, particularly for chromosome 17 abnormalities, which had a low prevalence. This means that the
prognostic value of these factors remains uncertain.
Prognostic factors Male sex, advanced stage, atypical morphology, unmutated IGVH genes, CD38 expression, trisomy 12, and deletion at 11q23 or 17p13 but not at 13q14 are all poor prognostic factors in a univariate analysis of CLL-related deaths (Table 6). The same parameters remain significant when all deaths are evaluated and also when the 17 cases referred from other centers are excluded.
Using the Cox proportional hazards regression to determine which of these prognostic factors were independent predictors of mortality, only clinical stage, unmutated IGVH genes, and chromosome 17 abnormalities remain significant when deaths from CLL- related causes (Table 6) and all deaths (data not shown) are assessed. The hazard ratio remains high for some factors including del11q23 and CD38 expression, which were not statistically significant, and because sample size is relatively small the possibility of a type 2 error exists. The adjusted hazard ratios for IGVH gene status and chromosome 17 status were significantly higher in stage A patients than in stage B and C patients combined (P = .01 for each of the interaction events). When the analysis is confined to stage A patients, the hazard ratio for IGVH gene status (after adjusting for chromosome 17 status) is 17.9 (3.9-82.7; P < .001) and the hazard ratio for chromosome 17 status (after adjusting for IGVH gene status) was 11.2 (3.2-35.9; P < .001). Median survival data The median survival (95% CI) of patients included in the study was 180 months (range, 146-214 months) for all deaths and 293 months (range, 212-374 months) for disease-related deaths. The impact of cytogenetic and genetic abnormalities on survival is shown in Figure 2. The median survival of patients with a normal karyotype and no evidence of trisomy 12, or deletions of 11q23, 13q14, or 17p13 using additional molecular techniques was 209 months. Patients with deletions of 13q14 as the sole abnormality had a median survival of 292 months, those with trisomy 12, 122 months, those with del11q23, 117 months, and those with loss or mutation of the p53 gene, 47 months. Figure 3A illustrates the superior survival of patients with mutated IGVH genes (median survival, 310 months) compared to cases with unmutated IGVH genes (median survival, 119 months) and demonstrates the poor prognosis of patients with p53 loss or mutation, regardless of IGVH gene status.
Similar differences in survival were seen in patients presenting with stage A disease (Figure 3B).
This study confirms that unmutated IGVH genes, high expression of CD38, atypical lymphocyte morphology, trisomy 12, del11q23, and loss or mutation of the p53 gene are all poor prognostic factors when evaluated in a univariate analysis of a large series of patients with CLL presenting predominantly with Binet stage A disease. Care was taken to ensure that only samples taken at or close to the time of presentation were tested. This is of particular importance when assessing the prognostic significance of p53 abnormalities, which are frequently acquired during the course of the disease. A potential cause of bias was the inclusion of cases from other centers because of their cytogenetic abnormalities. However, only presentation data were used, and the prognostic factors determined by univariate analyses remained unchanged when these cases were excluded. Whether the degree of somatic hypermutation has prognostic significance in CLL is a controversial issue. Initial studies used a cutoff of 98% homology to the nearest germline sequence to allow for the presence of polymorphisms in unmutated IGVH genes. Stilgebauer et al33 have found that in their hands 96% homology provides a better separation of patients with differing prognoses. However, their use of a PCR primer within the framework 1 region rather than the IGVH gene leader sequence may have resulted in an apparent increase in the percentage of mutations, because the frequency of mutation in the 5' framework 1 region is very low (personal observation of Z.A.D. in more than 250 IGVH gene sequences). Applying the Youden index to our own data shows that 98% homology is the optimum cutoff regardless of whether all deaths or only CLL-related deaths are analyzed. This result is consistent with the concept that the better prognosis of patients with somatic hypermutation reflects the origin of the disease from a postgerminal center B cell. We have previously noted a close correlation between trisomy 12 and unmutated IGVH genes in patients with clinically aggressive disease and between structural abnormalities of chromosome 13q14 and mutated IGVH genes in patients with benign disease.34 These findings raised the question as to whether or not the difference in survival between the 2 IGVH gene subsets was a consequence of differing susceptibility of each subgroup to acquire subsequent genetic abnormalities with prognostic significance. Pettitt et al35 have recently shown that failure to up-regulate p21 expression in response to in vitro irradiation identifies cases with p53 dysfunction due either to mutations of the p53 or ATM (ataxia telangiectasia mutated) genes. They have subsequently shown that p53 dysfunction is confined to patients with less than 5% divergence from the nearest germline IGVH gene and hypothesize that p53 and ATM mutations are at least partly responsible for the poor prognosis of patients with unmutated IGVH genes.36 Our current study confirms the association between trisomy 12 and del11q23 with unmutated IGVH genes and between structural abnormalities of 13q14 and mutated IGVH genes. We were unable to demonstrate a significant association between IGVH gene status and loss or mutation of the p53 gene although the hazard ratio is high and a type 2 error, reflecting the small patient sample and low prevalence of the latter, is possible. However, the finding of p53 mutations in cases with heavily mutated IGVH genes is clearly documented. We did not find CD38 expression to have independent prognostic significance despite showing that CD38 expression was an independent prognostic factor in patients of known IGVH gene status in a recent analysis of 145 patients, all of whom were included in this larger study.24 After adjusting for disease stage and V gene status the previous study found an odds ratio (95% CI) of 3.1 (1.1-8.8; P = .04) between CD38- and CLL-related deaths. The present analysis, after adjusting for these same 2 factors, produced a smaller odds ratio with a narrower CI, reflecting the increased sample size (odds ratio = 2.1 [range, 0.9-4.8]; P = .09). Further adjustment for chromosome 17 status reduced the odds ratio further to 1.7 (0.6-4.4; P = .29; Table 6). Thus the apparent difference in results between the 2 sets of analyses is not substantial, is of borderline statistical significance, and can partly be explained by the further adjustment for chromosome 17 status. Multivariate analysis of all potential factors in a much larger group of patients is required to clarify the true prognostic significance of CD38. The most important finding in this study was that p53 loss or mutation had independent prognostic significance in patients with known IGVH gene status. In 13 of 15 patients, of whom 9 had stage A disease, the p53 abnormalities were detected at presentation confirming recent data that clinically significant genetic abnormalities may be found in Binet stage A disease.37 We used a combination of karyotype analysis, interphase FISH, and flow cytometry to screen for abnormalities of 17p13 and p53 dysfunction. Karyotypic analysis and interphase FISH were of comparable sensitivity and superior to flow cytometry, but none of these assays identified all the cases with a p53 mutation. A more sensitive screening test, direct genomic sequencing, or DNA microarray analysis should ideally be used.38 Despite an overall poor prognosis there was considerable variation in the survival of patients presenting with a p53 mutation. A much larger series of cases with p53 mutation will be required to determine whether these differences reflect the size of the p53 clone, the site of the mutation and function of the mutant protein, IGVH gene status, or other unknown variable. The failure of del11q23 to emerge as an independent prognostic factor is surprising in view of previous studies demonstrating the poor prognosis of patients with this abnormality, although the CI for the hazard ratio is wide and so might be a type 2 error. Also, in our current study bulky lymphadenopathy was confined to those patients with del11q who had unmutated IGVH genes (data not shown). Schaffner et al39 found ATM mutations in only a subset of patients with del11q23, and Stankovic et al40 detected loss of heterozygosity in only 2 of 16 cases with an ATM mutation suggesting that deletions involving 11q23 may have differing molecular consequences with varying prognostic significance. In summary, our results indicate that knowledge of IGVH gene status and p53 dysfunction should facilitate the design of clinical trials to assess the potential of new treatments. In particular younger patients with unmutated IGVH genes or p53 mutations should be considered for intensive or novel treatments regardless of clinical stage. Whereas IGVH gene status remains constant throughout the course of the disease, additional genetic abnormalities may be acquired and further studies are necessary to determine the clinical value of sequential genetic analysis.
We express our gratitude to Mo Tiller for excellent technical assistance. We thank Dr S. Johnson (Taunton), Dr P. Stross (Chichester), Dr M. Hilali (Dorchester), and Dr J. Rees (Cambridge) for referring patients.
Submitted November 14, 2001; accepted March 20, 2002.
Supported by research grants from the Bournemouth Leukaemia Fund, Tenovus, the Leukaemia Research Fund, and the National Health Service Executive South and West.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: David G. Oscier, Department of Haematology, Royal Bournemouth Hospital, Castle Lane East, Bournemouth, BH7 7DW, United Kingdom; e-mail: david.oscier{at}lineone.net.
1.
Rozman C, Montserrat E.
Chronic lymphocytic leukemia.
N Engl J Med.
1995;333:1052-1057
2.
Dighiero G, Maloum K, Desablens B, et al.
Chlorambucil in indolent chronic lymphocytic leukemia. French Cooperative Group on Chronic Lymphocytic Leukemia.
N Engl J Med.
1998;338:1506-1514
3.
CLL Trialists' Collaborative Group.
Chemotherapeutic options in chronic lymphocytic leukemia: a meta-analysis of randomised trials.
J Natl Cancer Inst.
1999;91:861-868
4.
Dighiero G, Binet JL.
When and how to treat chronic lymphocytic leukemia.
N Engl J Med.
2000;343:1799-1801 5. Hamblin TJ. Achieving optimal outcomes in chronic lymphocytic leukaemia. Drugs. 2001;61:593-611[Medline] [Order article via Infotrieve]. 6. French Cooperative Group on Chronic Lymphocytic Leukaemia. Natural history of stage A chronic lymphocytic leukaemia untreated patients. Br J Haematol. 1990;76:45-54[Medline] [Order article via Infotrieve]. 7. Montserrat E, Vinolas N, Reverer JC. Natural history of chronic lymphocytic leukemia: on the progression and prognosis of early stages. Nouv Rev Fr Hematol. 1988;30:359-361[Medline] [Order article via Infotrieve]. 8. Keating M, Lerner S, Kantarjian HM. The serum beta 2-microglobulin level is more powerful than stage in predicting response and survival in chronic lymphocytic leukaemia [abstract]. Blood. 1995;86:606a.
9.
Sarfati M, Chevret S, Chastang C, et al.
Prognostic importance of serum soluble CD23 level in chronic lymphocytic leukemia.
Blood.
1996;88:4259-4264
10.
Hallek M, Langenmayer I, Nerl C, et al.
Elevated serum thymidine kinase levels identify a subgroup at high risk of disease progression in early, nonsmoldering chronic lymphocytic leukemia.
Blood.
1999;93:1732-1737 11. Juliusson G, Oscier DG, Fitchett M, et al. Prognostic subgroups in B-cell chronic lymphocytic leukemia defined by specific chromosomal abnormalities. N Engl J Med. 1990;323:720-724[Abstract].
12.
Dohner H, Stilgenbauer S, Benner A, et al.
Genomic aberrations and survival in chronic lymphocytic leukemia.
N Engl J Med.
2000;343:1910-1916
13.
Dohner H, Stilgenbauer S, James MR, et al.
11q deletions identify a new subset of B-cell chronic lymphocytic leukemia characterized by extensive nodal involvement and inferior prognosis.
Blood.
1997;89:2516-2522 14. Stilgenbauer S, von Neuhoff N, Bullinger L. Deletion 11q23 identifies B-CLL patients at high risk for molecular disease persistence after high dose therapy and autografting [abstract]. Blood. 2000;96:715a.
15.
El Rouby S, Thomas A, Costin D, et al.
p53 gene mutation in B-cell chronic lymphocytic leukemia is associated with drug resistance and is independent of MDR1/MDR3 gene expression.
Blood.
1993;82:3452-3459
16.
Dohner H, Fischer K, Bentz M, et al.
p53 gene deletion predicts for poor survival and non-response to therapy with purine analogs in chronic B-cell leukemias.
Blood.
1995;85:1580-1589
17.
Hamblin TJ, Davis Z, Gardiner A, Oscier DG, Stevenson FK.
Unmutated Ig V(H) genes are associated with a more aggressive form of chronic lymphocytic leukemia.
Blood.
1999;94:1848-1854
18.
Damle RN, Wasil T, Fais F, et al.
Ig V gene mutation status and CD38 expression as novel prognostic indicators in chronic lymphocytic leukemia.
Blood.
1999;94:1840-1847 19. Krober A, Seiler T, Leupolt E. IgHV mutated and unmutated B-CLL tumors show distinct genetic aberrations patterns [abstract]. Blood. 2000;96:3609a.
20.
Maloum K, Davi F, Merle-Beral H, et al.
Expression of unmutated VH genes is a detrimental prognostic factor in chronic lymphocytic leukemia.
Blood.
2000;96:377-379
21.
Ibrahim S, Keating M, Do KA, et al.
CD38 expression as an important prognostic factor in B-cell chronic lymphocytic leukemia.
Blood.
2001;98:181-186
22.
Del Poeta G, Maurillo L, Venditti A, et al.
Clinical significance of CD38 expression in chronic lymphocytic leukemia.
Blood.
2001;98:2633-2639 23. Chevallier P, Penther D, Avet-Loiseau H, et al. CD38 expression and secondary 17p deletion are important prognostic factors in chronic lymphocytic leukaemia. Br J Haematol. 2002;116:142-150[CrossRef][Medline] [Order article via Infotrieve].
24.
Hamblin TJ, Orchard JA, Ibbotson RE, et al.
CD38 expression and immunoglobulin variable region mutations are independent prognostic variables in chronic lymphocytic leukemia, but CD38 expression may vary during the course of the disease.
Blood.
2002;99:1023-1029 25. Jelinek DF, Tschumper S, Geyer SM, et al. Analysis of clonal B-cell CD38 and immunoglobulin variable region sequence status in relation to clinical outcome for B-chronic lymphocytic leukaemia. Br J Haematol. 2001;115:854-861[CrossRef][Medline] [Order article via Infotrieve].
26.
Thunberg U, Johnson A, Roos G, et al.
CD38 expression is a poor predictor for VH gene mutational status and prognosis in chronic lymphocytic leukemia.
Blood.
2001;97:1892-1894 27. Leupolt E, Stilgenbauer S, Krober A, Bullinger L, Lichter P, Dohner H. Clonal evolution in B-CLL: aquisition of deletions involving 6q21, 11q23, and 10p13(TP53) associated with disease progression [abstract]. Blood. 2001;98:471a. 28. Goldrick MM, Kimball GR, Liu Q, Martin LA, Sommer SS, Tseng JY. NIRCA: a rapid robust method for screening for unknown point mutations. Biotechniques. 1996;21:106-112[Medline] [Order article via Infotrieve].
29.
Corcoran MM, Rasool O, Liu Y, et al.
Detailed molecular delineation of 13q14.3 loss in B-cell chronic lymphocytic leukemia.
Blood.
1998;91:1382-1390 30. Talbot D, Givan AL, Shenton BK, Stratton A, Proud G, Taylor RM. The relevance of a more sensitive crossmatch assay to renal transplantation. Transplantation. 1989;47:552-555[Medline] [Order article via Infotrieve]. 31. Cook GP, Tomlinson IM. The human immunoglobulin VH repertoire. Immunol Today. 1995;16:237-242[CrossRef][Medline] [Order article via Infotrieve]. 32. Armitage P, Berry G. Statistical Methods in Medical Research. Blackwell Science, Oxford: United Kingdom; 1987. 33. Stilgenbauer S, Krober A, Seiler T. VH mutation status, CD38 expression level, genomic alterations, and survival in chronic lymphocytic leukemia [abstract]. Blood. 2001;98:472a.
34.
Oscier DG, Thompsett A, Zhu D, Stevenson FK.
Differential rates of somatic hypermutation in V(H) genes among subsets of chronic lymphocytic leukemia defined by chromosomal abnormalities.
Blood.
1997;89:4153-4160
35.
Pettitt AR, Sherrington PD, Stewart G, Cawley JC, Taylor AM, Stankovic T.
p53 dysfunction in B-cell chronic lymphocytic leukemia: inactivation of ATM as an alternative to TP53 mutation.
Blood.
2001;98:814-822 36. Sherrington PD, Stankovic T, Dennis M. p53 dysfunction as a cause of drug resistance and short survival of B-CLL patients with non-hypermutated IgVH genes [abstract]. Br J Haematol. 2002;113:60. 37. Bullinger L, Krautle C, Busch R, et al. Incidence and correlation of genomic aberrations with clinical and biological risk factors in B-CLL stage Binet-A within the CLL1 trial of the GCLLSG [abstract]. Blood. 2001;98:359a. 38. Soussi T, Beroud C. Assessing TP53 status in human tumours to evaluate clinical outcome. Nature Rev Cancer. 2001;1:233-240[CrossRef][Medline] [Order article via Infotrieve].
39.
Schaffner C, Stilgenbauer S, Rappold GA, Dohner H, Lichter P.
Somatic ATM mutations indicate a pathogenic role of ATM in B-cell chronic lymphocytic leukemia.
Blood.
1999;94:748-753
40.
Stankovic T, Stewart GS, Fegan C, et al.
Ataxia telangiectasia mutated-deficient B-cell chronic lymphocytic leukemia occurs in pregerminal center cells and results in defective damage response and unrepaired chromosome damage.
Blood.
2002;99:300-309
© 2002 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  G. G. Johnson, P. D. Sherrington, A. Carter, K. Lin, T. Liloglou, J. K. Field, and A. R. Pettitt A Novel Type of p53 Pathway Dysfunction in Chronic Lymphocytic Leukemia Resulting from Two Interacting Single Nucleotide Polymorphisms within the p21 Gene Cancer Res., June 15, 2009; 69(12): 5210 - 5217. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. M. Lucas, R. B. Edwards, G. Lozanski, D. A. West, J. D. Shin, M. A. Vargo, M. E. Davis, D. M. Rozewski, A. J. Johnson, B.-N. Su, et al. The novel plant-derived agent silvestrol has B-cell selective activity in chronic lymphocytic leukemia and acute lymphoblastic leukemia in vitro and in vivo Blood, May 7, 2009; 113(19): 4656 - 4666. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. A. Hernandez, A. E. Rodriguez, M. Gonzalez, R. Benito, C. Fontanillo, V. Sandoval, M. Romero, G. Martin-Nunez, A. G. de Coca, R. Fisac, et al. A high number of losses in 13q14 chromosome band is associated with a worse outcome and biological differences in patients with B-cell chronic lymphoid leukemia Haematologica, March 1, 2009; 94(3): 364 - 371. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Rossi, M. Cerri, C. Deambrogi, E. Sozzi, S. Cresta, S. Rasi, L. De Paoli, V. Spina, V. Gattei, D. Capello, et al. The Prognostic Value of TP53 Mutations in Chronic Lymphocytic Leukemia Is Independent of Del17p13: Implications for Overall Survival and Chemorefractoriness Clin. Cancer Res., February 1, 2009; 15(3): 995 - 1004. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Sargent, D. Jones, L. V. Abruzzo, H. Yao, J. Bonderover, M. Cisneros, W. G. Wierda, M. J. Keating, and R. Luthra Customized Oligonucleotide Array-Based Comparative Genomic Hybridization as a Clinical Assay for Genomic Profiling of Chronic Lymphocytic Leukemia J. Mol. Diagn., January 1, 2009; 11(1): 25 - 34. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. J. Kipps Chronic Lymphocytic Leukemia: Advances in Assessing Prognosis and Therapy ASCO Educational Book, January 1, 2009; 2009(1): 385 - 393. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Y. H. Hallaert, A. Jaspers, C. J. van Noesel, M. H. J. van Oers, A. P. Kater, and E. Eldering c-Abl kinase inhibitors overcome CD40-mediated drug resistance in CLL: implications for therapeutic targeting of chemoresistant niches Blood, December 15, 2008; 112(13): 5141 - 5149. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Vanura, T. Le, H. Esterbauer, F. Spath, E. Porpaczy, M. Shehata, K. Eigenberger, A. Hauswirth, C. Skrabs, E. Kromer, et al. Autoimmune conditions and chronic infections in chronic lymphocytic leukemia patients at diagnosis are associated with unmutated IgVH genes Haematologica, December 1, 2008; 93(12): 1912 - 1916. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Pepper, T. T. Lin, G. Pratt, S. Hewamana, P. Brennan, L. Hiller, R. Hills, R. Ward, J. Starczynski, B. Austen, et al. Mcl-1 expression has in vitro and in vivo significance in chronic lymphocytic leukemia and is associated with other poor prognostic markers Blood, November 1, 2008; 112(9): 3807 - 3817. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Kujawski, P. Ouillette, H. Erba, C. Saddler, A. Jakubowiak, M. Kaminski, K. Shedden, and S. N. Malek Genomic complexity identifies patients with aggressive chronic lymphocytic leukemia Blood, September 1, 2008; 112(5): 1993 - 2003. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Roos, R. Rosenquist, and S. Stilgenbauer Response: Or both? Blood, June 15, 2008; 111(12): 5756 - 5757. [Full Text] [PDF]
|
|
|
|
|
|
E. M. Ghia, S. Jain, G. F. Widhopf II, L. Z. Rassenti, M. J. Keating, W. G. Wierda, J. G. Gribben, J. R. Brown, K. R. Rai, J. C. Byrd, et al. Use of IGHV3-21 in chronic lymphocytic leukemia is associated with high-risk disease and reflects antigen-driven, post-germinal center leukemogenic selection Blood, May 15, 2008; 111(10): 5101 - 5108. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O V Moshynska and A Saxena Clonal relationship between Hashimoto thyroiditis and thyroid lymphoma J. Clin. Pathol., April 1, 2008; 61(4): 438 - 444. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Roos, A. Krober, P. Grabowski, D. Kienle, A. Buhler, H. Dohner, R. Rosenquist, and S. Stilgenbauer Short telomeres are associated with genetic complexity, high-risk genomic aberrations, and short survival in chronic lymphocytic leukemia Blood, February 15, 2008; 111(4): 2246 - 2252. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Gachard, A. Salviat, C. Boutet, C. Arnoulet, F. Durrieu, B. Lenormand, S. Lepretre, S. Olschwang, F. Jardin, M. Lafage-Pochitaloff, et al. Multicenter study of ZAP-70 expression in patients with B-cell chronic lymphocytic leukemia using an optimized flow cytometry method Haematologica, February 1, 2008; 93(2): 215 - 223. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Saddler, P. Ouillette, L. Kujawski, S. Shangary, M. Talpaz, M. Kaminski, H. Erba, K. Shedden, S. Wang, and S. N. Malek Comprehensive biomarker and genomic analysis identifies p53 status as the major determinant of response to MDM2 inhibitors in chronic lymphocytic leukemia Blood, February 1, 2008; 111(3): 1584 - 1593. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. W. Hauswirth and U. Jager Impact of cytogenetic and molecular prognostic markers on the clinical management of chronic lymphocytic leukemia Haematologica, January 1, 2008; 93(1): 14 - 19. [Full Text] [PDF]
|
|
|
|
|
|
A. F. Santidrian, A. M. Cosialls, L. Coll-Mulet, D. Iglesias-Serret, M. de Frias, D. M. Gonzalez-Girones, C. Campas, A. Domingo, G. Pons, and J. Gil The potential anticancer agent PK11195 induces apoptosis irrespective of p53 and ATM status in chronic lymphocytic leukemia cells Haematologica, December 1, 2007; 92(12): 1631 - 1638. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. M. Tsimberidou, S. Wen, S. O'Brien, P. McLaughlin, W. G. Wierda, A. Ferrajoli, S. Faderl, J. Manning, S. Lerner, C. V. Mai, et al. Assessment of Chronic Lymphocytic Leukemia and Small Lymphocytic Lymphoma by Absolute Lymphocyte Counts in 2,126 Patients: 20 Years of Experience at The University of Texas M.D. Anderson Cancer Center J. Clin. Oncol., October 10, 2007; 25(29): 4648 - 4656. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Stilgenbauer, S. Sander, L. Bullinger, A. Benner, E. Leupolt, D. Winkler, A. Krober, D. Kienle, P. Lichter, and H. Dohner Clonal evolution in chronic lymphocytic leukemia: acquisition of high-risk genomic aberrations associated with unmutated VH, resistance to therapy, and short survival Haematologica, September 1, 2007; 92(9): 1242 - 1245. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Sabattini, R. Orduz, C. Campidelli, P. L. Zinzani, V. Callea, S. Zupo, G. Cutrona, F. Morabito, M. Ferrarini, and S. Pileri B cell chronic lymphocytic leukaemia/small lymphocytic lymphoma: role of ZAP70 determination on bone marrow biopsy specimens J. Clin. Pathol., June 1, 2007; 60(6): 627 - 632. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Tinhofer, G. Rubenzer, C. Holler, E. Hofstaetter, M. Stoecher, A. Egle, M. Steurer, and R. Greil Expression levels of CD38 in T cells predict course of disease in male patients with B-chronic lymphocytic leukemia Blood, November 1, 2006; 108(9): 2950 - 2956. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Dicker, S. Schnittger, T. Haferlach, W. Kern, and C. Schoch Immunostimulatory oligonucleotide-induced metaphase cytogenetics detect chromosomal aberrations in 80% of CLL patients: a study of 132 CLL cases with correlation to FISH, IgVH status, and CD38 expression Blood, November 1, 2006; 108(9): 3152 - 3160. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. D. Shanafelt, T. E. Witzig, S. R. Fink, R. B. Jenkins, S. F. Paternoster, S. A. Smoley, K. J. Stockero, D. M. Nast, H. C. Flynn, R. C. Tschumper, et al. Prospective Evaluation of Clonal Evolution During Long-Term Follow-Up of Patients With Untreated Early-Stage Chronic Lymphocytic Leukemia J. Clin. Oncol., October 1, 2006; 24(28): 4634 - 4641. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. D. Shanafelt, J. C. Byrd, T. G. Call, C. S. Zent, and N. E. Kay Narrative review: initial management of newly diagnosed, early-stage chronic lymphocytic leukemia. Ann Intern Med, September 19, 2006; 145(6): 435 - 447. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. W. L. Yee and S. M. O'Brien Chronic Lymphocytic Leukemia: Diagnosis and Treatment Mayo Clin. Proc., August 1, 2006; 81(8): 1105 - 1129. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Coll-Mulet, D. Iglesias-Serret, A. F. Santidrian, A. M. Cosialls, M. de Frias, E. Castano, C. Campas, M. Barragan, A. F. de Sevilla, A. Domingo, et al. MDM2 antagonists activate p53 and synergize with genotoxic drugs in B-cell chronic lymphocytic leukemia cells Blood, May 15, 2006; 107(10): 4109 - 4114. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Hus, M. Podhorecka, A. Bojarska-Junak, J. Rolinski, M. Schmitt, M. Sieklucka, E. Wasik-Szczepanek, and A. Dmoszynska The clinical significance of ZAP-70 and CD38 expression in B-cell chronic lymphocytic leukaemia Ann. Onc., April 1, 2006; 17(4): 683 - 690. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Krober, J. Bloehdorn, S. Hafner, A. Buhler, T. Seiler, D. Kienle, D. Winkler, M. Bangerter, R. F. Schlenk, A. Benner, et al. Additional Genetic High-Risk Features Such As 11q Deletion, 17p Deletion, and V3-21 Usage Characterize Discordance of ZAP-70 and VH Mutation Status in Chronic Lymphocytic Leukemia J. Clin. Oncol., February 20, 2006; 24(6): 969 - 975. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Montserrat, C. Moreno, J. Esteve, A. Urbano-Ispizua, E. Gine, and F. Bosch How I treat refractory CLL Blood, February 15, 2006; 107(4): 1276 - 1283. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Chiaretti, A. Guarini, M. S. De Propris, S. Tavolaro, S. Intoppa, A. Vitale, S. Iacobelli, L. Elia, C. Ariola, J. Ritz, et al. ZAP-70 expression in acute lymphoblastic leukemia: association with the E2A/PBX1 rearrangement and the pre-B stage of differentiation and prognostic implications Blood, January 1, 2006; 107(1): 197 - 204. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Stamatopoulos, C. Belessi, A. Hadzidimitriou, T. Smilevska, E. Kalagiakou, K. Hatzi, N. Stavroyianni, A. Athanasiadou, A. Tsompanakou, T. Papadaki, et al. Immunoglobulin light chain repertoire in chronic lymphocytic leukemia Blood, November 15, 2005; 106(10): 3575 - 3583. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Marasca, R. Maffei, M. Morselli, P. Zucchini, I. Castelli, S. Martinelli, M. Fontana, S. Ravanetti, M. Curotti, G. Leonardi, et al. Immunoglobulin Mutational Status Detected through Single-Round Amplification of Partial VH Region Represents a Good Prognostic Marker for Clinical Outcome in Chronic Lymphocytic Leukemia J. Mol. Diagn., November 1, 2005; 7(5): 566 - 574. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Falt, M. Merup, G. Tobin, U. Thunberg, G. Gahrton, R. Rosenquist, and A. Wennborg Distinctive gene expression pattern in VH3-21 utilizing B-cell chronic lymphocytic leukemia Blood, July 15, 2005; 106(2): 681 - 689. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Grabowski, M. Hultdin, K. Karlsson, G. Tobin, A. Aleskog, U. Thunberg, A. Laurell, C. Sundstrom, R. Rosenquist, and G. Roos Telomere length as a prognostic parameter in chronic lymphocytic leukemia with special reference to VH gene mutation status Blood, June 15, 2005; 105(12): 4807 - 4812. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. L. Sorror, M. B. Maris, B. M. Sandmaier, B. E. Storer, M. J. Stuart, U. Hegenbart, E. Agura, T. R. Chauncey, J. Leis, M. Pulsipher, et al. Hematopoietic Cell Transplantation After Nonmyeloablative Conditioning for Advanced Chronic Lymphocytic Leukemia J. Clin. Oncol., June 1, 2005; 23(16): 3819 - 3829. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. L. Kienle, C. Korz, B. Hosch, A. Benner, D. Mertens, A. Habermann, A. Krober, U. Jager, P. Lichter, H. Dohner, et al. Evidence for Distinct Pathomechanisms in Genetic Subgroups of Chronic Lymphocytic Leukemia Revealed by Quantitative Expression Analysis of Cell Cycle, Activation, and Apoptosis-Associated Genes J. Clin. Oncol., June 1, 2005; 23(16): 3780 - 3792. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Moreton, B. Kennedy, G. Lucas, M. Leach, S. M.B. Rassam, A. Haynes, J. Tighe, D. Oscier, C. Fegan, A. Rawstron, et al. Eradication of Minimal Residual Disease in B-Cell Chronic Lymphocytic Leukemia After Alemtuzumab Therapy Is Associated With Prolonged Survival J. Clin. Oncol., May 1, 2005; 23(13): 2971 - 2979. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Chiorazzi, K. R. Rai, and M. Ferrarini Chronic Lymphocytic Leukemia N. Engl. J. Med., February 24, 2005; 352(8): 804 - 815. [Full Text] [PDF]
|
|
|
|
 |
|
 G. Dighiero CLL Biology and Prognosis Hematology, January 1, 2005; 2005(1): 278 - 284. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Tobin, U. Thunberg, K. Karlsson, F. Murray, A. Laurell, K. Willander, G. Enblad, M. Merup, J. Vilpo, G. Juliusson, et al. Subsets with restricted immunoglobulin gene rearrangement features indicate a role for antigen selection in the development of chronic lymphocytic leukemia Blood, November 1, 2004; 104(9): 2879 - 2885. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. F. Widhopf II, L. Z. Rassenti, T. L. Toy, J. G. Gribben, W. G. Wierda, and T. J. Kipps Chronic lymphocytic leukemia B cells of more than 1% of patients express virtually identical immunoglobulins Blood, October 15, 2004; 104(8): 2499 - 2504. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Haslinger, N. Schweifer, S. Stilgenbauer, H. Dohner, P. Lichter, N. Kraut, C. Stratowa, and R. Abseher Microarray Gene Expression Profiling of B-Cell Chronic Lymphocytic Leukemia Subgroups Defined by Genomic Aberrations and VH Mutation Status J. Clin. Oncol., October 1, 2004; 22(19): 3937 - 3949. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Tchirkov, C. Chaleteix, C. Magnac, Y. Vasconcelos, F. Davi, A. Michel, F. Kwiatkowski, O. Tournilhac, G. Dighiero, and P. Travade hTERT expression and prognosis in B-chronic lymphocytic leukemia Ann. Onc., October 1, 2004; 15(10): 1476 - 1480. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Z. Rassenti, L. Huynh, T. L. Toy, L. Chen, M. J. Keating, J. G. Gribben, D. S. Neuberg, I. W. Flinn, K. R. Rai, J. C. Byrd, et al. ZAP-70 Compared with Immunoglobulin Heavy-Chain Gene Mutation Status as a Predictor of Disease Progression in Chronic Lymphocytic Leukemia N. Engl. J. Med., August 26, 2004; 351(9): 893 - 901. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. A. Calin, C.-G. Liu, C. Sevignani, M. Ferracin, N. Felli, C. D. Dumitru, M. Shimizu, A. Cimmino, S. Zupo, M. Dono, et al. MicroRNA profiling reveals distinct signatures in B cell chronic lymphocytic leukemias PNAS, August 10, 2004; 101(32): 11755 - 11760. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Moshynska, K. Sankaran, P. Pahwa, and A. Saxena Prognostic Significance of a Short Sequence Insertion in the MCL-1 Promoter in Chronic Lymphocytic Leukemia J Natl Cancer Inst, May 5, 2004; 96(9): 673 - 682. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Lozanski, N. A. Heerema, I. W. Flinn, L. Smith, J. Harbison, J. Webb, M. Moran, M. Lucas, T. Lin, M. L. Hackbarth, et al. Alemtuzumab is an effective therapy for chronic lymphocytic leukemia with p53 mutations and deletions Blood, May 1, 2004; 103(9): 3278 - 3281. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. J. Rush, A. Raval, P. Funchain, A. J. Johnson, L. Smith, D. M. Lucas, M. Bembea, T.-H. Liu, N. A. Heerema, L. Rassenti, et al. Epigenetic Profiling in Chronic Lymphocytic Leukemia Reveals Novel Methylation Targets Cancer Res., April 1, 2004; 64(7): 2424 - 2433. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. D. Shanafelt, S. M. Geyer, and N. E. Kay Prognosis at diagnosis: integrating molecular biologic insights into clinical practice for patients with CLL Blood, February 15, 2004; 103(4): 1202 - 1210. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. C. Byrd, S. Stilgenbauer, and I. W. Flinn Chronic Lymphocytic Leukemia Hematology, January 1, 2004; 2004(1): 163 - 183. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. A. E. Cochran, C. A. Evans, D. Blinco, J. Burthem, F. K. Stevenson, S. J. Gaskell, and A. D. Whetton Proteomic Analysis of Chronic Lymphocytic Leukemia Subtypes with Mutated or Unmutated Ig VH Genes Mol. Cell. Proteomics, December 1, 2003; 2(12): 1331 - 1341. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Vasconcelos, F. Davi, V. Levy, P. Oppezzo, C. Magnac, A. Michel, M. Yamamoto, O. Pritsch, H. Merle-Beral, K. Maloum, et al. Binet's Staging System and VH Genes Are Independent but Complementary Prognostic Indicators in Chronic Lymphocytic Leukemia J. Clin. Oncol., November 1, 2003; 21(21): 3928 - 3932. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Kienle, A. Krober, T. Katzenberger, G. Ott, E. Leupolt, T. F. E. Barth, P. Moller, A. Benner, A. Habermann, H. K. Muller-Hermelink, et al. VH mutation status and VDJ rearrangement structure in mantle cell lymphoma: correlation with genomic aberrations, clinical characteristics, and outcome Blood, October 15, 2003; 102(8): 3003 - 3009. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O Moshynska, K Sankaran, and A Saxena Molecular detection of the G(-248)A BAX promoter nucleotide change in B cell chronic lymphocytic leukaemia Mol. Pathol., August 1, 2003; 56(4): 205 - 209. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Guarini, G. Gaidano, F. R. Mauro, D. Capello, F. Mancini, M. S. De Propris, M. Mancini, E. Orsini, M. Gentile, M. Breccia, et al. Chronic lymphocytic leukemia patients with highly stable and indolent disease show distinctive phenotypic and genotypic features Blood, August 1, 2003; 102(3): 1035 - 1041. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Wiestner, A. Rosenwald, T. S. Barry, G. Wright, R. E. Davis, S. E. Henrickson, H. Zhao, R. E. Ibbotson, J. A. Orchard, Z. Davis, et al. ZAP-70 expression identifies a chronic lymphocytic leukemia subtype with unmutated immunoglobulin genes, inferior clinical outcome, and distinct gene expression profile Blood, June 15, 2003; 101(12): 4944 - 4951. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Tobin, U. Thunberg, A. Johnson, I. Eriksson, O. Soderberg, K. Karlsson, M. Merup, G. Juliusson, J. Vilpo, G. Enblad, et al. Chronic lymphocytic leukemias utilizing the VH3-21 gene display highly restricted V{lambda}2-14 gene use and homologous CDR3s: implicating recognition of a common antigen epitope Blood, June 15, 2003; 101(12): 4952 - 4957. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Crespo, F. Bosch, N. Villamor, B. Bellosillo, D. Colomer, M. Rozman, S. Marce, A. Lopez-Guillermo, E. Campo, and E. Montserrat ZAP-70 Expression as a Surrogate for Immunoglobulin-Variable-Region Mutations in Chronic Lymphocytic Leukemia N. Engl. J. Med., May 1, 2003; 348(18): 1764 - 1775. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. M. Staudt Molecular Diagnosis of the Hematologic Cancers N. Engl. J. Med., May 1, 2003; 348(18): 1777 - 1785. [Full Text] [PDF]
|
|
|
|
|
|
P. Ghia, G. Guida, S. Stella, D. Gottardi, M. Geuna, G. Strola, C. Scielzo, and F. Caligaris-Cappio The pattern of CD38 expression defines a distinct subset of chronic lymphocytic leukemia (CLL) patients at risk of disease progression Blood, February 15, 2003; 101(4): 1262 - 1269. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. J. Keating, N. Chiorazzi, B. Messmer, R. N. Damle, S. L. Allen, K. R. Rai, M. Ferrarini, and T. J. Kipps Biology and Treatment of Chronic Lymphocytic Leukemia Hematology, January 1, 2003; 2003(1): 153 - 175. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. A. Calin, C. D. Dumitru, M. Shimizu, R. Bichi, S. Zupo, E. Noch, H. Aldler, S. Rattan, M. Keating, K. Rai, et al. Frequent deletions and down-regulation of micro- RNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia PNAS, November 26, 2002; 99(24): 15524 - 15529. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. E. Kay, T. J. Hamblin, D. F. Jelinek, G. W. Dewald, J. C. Byrd, S. Farag, M. Lucas, and T. Lin Chronic Lymphocytic Leukemia Hematology, January 1, 2002; 2002(1): 193 - 213. [Abstract] [Full Text]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2002 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
2-microglobulin,
