SEARCH:   Advanced

Prepublished online as a Blood First Edition Paper on April 30, 2002; DOI 10.1182/blood-2002-01-0188. This Article Abstract Full Text (PDF) All Versions of this Article: 2002-01-0188v1 100/4/1490    most recent Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Yu, L.-C. Articles by Lin, M. Search for Related Content PubMed PubMed Citation Articles by Yu, L.-C. Articles by Lin, M. Related Collections Transfusion Medicine Brief Reports Social Bookmarking                   What's this?  Previous Article  |  Table of Contents  |  Next Article  Blood, 15 August 2002, Vol. 100, No. 4, pp. 1490-1492 BRIEF REPORT Molecular genetic analysis for the B3 allele Lung-Chih Yu, Yuh-Ching Twu, Ming-Lun Chou, Ching-Yi Chang, Chia-Ying Wu, and Marie Lin From the Transfusion Medicine Laboratory, Department of Medical Research, and the Immunohematology Reference Laboratory, Mackay Memorial Hospital, Taipei, Taiwan.     Abstract Top Abstract Introduction Study design Results and discussion References Molecular genetic analysis of 14 samples from unrelated individuals with the B3 phenotype is reported here. Two different molecular changes in the blood group B gene were observed. One case was demonstrated to possess a 247G  T mutation, which predicts an Asp83Tyr alteration. The B genes of the other 13 cases were shown to have a G  A mutation at the +5 nucleotide of intron 3 (intervening sequence 3 [IVS3] + 5G  A). Reverse transcription polymerase chain reaction analysis showed that the complete exon 1-exon 7 B transcript was absent, and transcripts that skipped exon 3 were instead present in the RNA sample from the B3 individual with the IVS3 + 5G  A mutation. The result shows that the IVS3 + 5G  A mutation destroys the conserved sequence of the splice donor site and leads to the skipping of exon 3 during messenger RNA processing. The B3 transcript without exon 3 predicts a B-transferase product that lacks 19 amino acids in the N-terminal segment. (Blood. 2002;100:1490-1492) © 2002 by The American Society of Hematology.     Introduction Top Abstract Introduction Study design Results and discussion References In addition to the common ABO phenotypes, A1, A2, B, and O, numerous phenotypes with a weak expression of the A or B antigens on the red blood cells (RBCs) have been found.1-6 The B3 phenotype is characterized by mixed-field hemagglutination of RBCs with anti-B and anti-A-anti-B antibodies. Only limited results have been reported on the molecular genetic analysis of 4 B3 cases so far.7,8 The B3 phenotype was found to be the most common subgroup in Taiwanese.9-12 This study presents the molecular genetic analysis of 14 samples from unrelated Taiwanese individuals with the B3 phenotype.     Study design Top Abstract Introduction Study design Results and discussion References Sequence analysis of the ABO gene and polymerase chain reaction-restriction fragment length polymorphism analysis Preparation of the genomic DNAs and the analysis of the 7 exon regions of the ABO genes were as described previously.13 A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis was developed to demonstrate the intervening sequence-3 [IVS3] + 5G  A mutation in the B gene, as the G  A change creates a BsmI site (GAATGC). We combined 100 ng genomic DNA and 15 pmol each forward (CGTACCTGCCTCGAGGCCTTGCAGCTTCAC) and reverse (CAGCACCCCGGCCAGCATGGATGCTCCAC) primer in 25 µL PCR buffer containing 0.2 mM deoxynucleoside 5'-triphosphate and 0.5 U Taq polymerase. The PCR program included 5 minutes at 94°C followed by 30 cycles of 30 seconds at 94°C and 1 minute at 72°C. The PCR products were digested by BsmI enzyme and then analyzed by 3.5% agarose gel electrophoresis. Analysis of the ABO transcript structure Total RNAs were prepared from peripheral blood cells. The complementary DNAs (cDNAs) were primed by oligodeoxythymidine primer, and 2 rounds of PCR amplification followed. The first PCR was performed with forward (TTGCGGACGCTGGCCGGAAAACCAAA, spanning the exon 1-2 junction of ABO cDNA) and reverse (TGTCCACGTCCACGCACACCAGGTAATCCA, locating exon 7) primers. Products from the first PCR were amplified by nested forward (CAAAATGCCACGCACTTCGACCTATGATCC, locating exon 2) and reverse (CGCTCGCAGAAGTCACTGATC, locating exon 7) primers. The PCR conditions were similar to those described above, except that the annealing temperatures were 65°C and 60°C in the first and the nested PCR, respectively.     Results and discussion Top Abstract Introduction Study design Results and discussion References Identification of the IVS3 + 5G  A mutation in the B gene of the B3 propositus The sequences of the 7 exons and the adjacent splice sites of the ABO gene of the individual with the B3 phenotype were inspected. The results demonstrated that the individual harbored a B gene and an O1v gene with the respective wild-type coding sequences.4,14 However, a G  A substitution at the +5 nucleotide of intron 3 (IVS3 + 5G  A) was identified in the B gene. No abnormality was detected in 7 of the 12 clones bearing the fragment encompassing the exon 2-intron 3 region. These 7 clones represented O1v gene as they had a T nucleotide at position 106 of ABO cDNA.4,14 The other 5 clones representing B gene possessed the IVS3 + 5G  A mutation. Direct sequencing of the PCR product demonstrated the heterozygous state of the G and A nucleotides at that position (Figure 1, right panel). Direct sequencing of the PCR product amplified from a group B individual did not show the G  A change at that position (Figure 1, left panel). View larger version (21K): [in this window] [in a new window]   Figure 1. Sequencing results of the exon 3-intron 3 junction of the ABO genes of a common group B individual and the B3 propositus. Genomic DNAs were purified from an individual with common group B phenotype and an individual with B3 phenotype. The regions from exon 2 to intron 3 of the ABO genes were amplified by PCR, and the sequences were analyzed by direct sequencing. The sequencing results of the exon 3-intron 3 junctions of the common group B (left panel) and the B3 (right panel) samples are shown. In the B3 sample, a heterozygous state for G and A nucleotides (underlined) at the +5 position of intron 3 was demonstrated. A dashed line indicates the conserved sequence of the splice donor site. The IVS3 + 5G  A mutation is present in 13 out of 14 B3 individuals The PCR-RFLP analysis was used to detect the IVS3 + 5 G  A mutation in the other 13 unrelated B3 individuals and in 30 randomly selected group B individuals. Twelve of the other 13 B3 individuals (Figure 2, lanes 2-13) had one allele with the IVS3 + 5G  A mutation at their ABO loci, as did the B3 propositus (lane 1), while none of the 30 group B individuals possessed the mutation (one of the results is shown in Figure 2, lane B). Further analysis demonstrated that all of the 12 B3 individuals with the IVS3 + 5G  A mutation were heterozygotes with one O allele as in the B3 propositus (data not shown). These results show that 13 of the 14 B3 individuals possess the B gene with the IVS3 + 5G  A mutation, while the mutation is virtually absent in the general group B population. One B3 individual did not possess the mutation in the B gene (Figure 2, lane 14). View larger version (39K): [in this window] [in a new window]   Figure 2. PCR-RFLP analysis of the IVS3 + 5 G  A splice site mutation in ABO genes. The IVS3 + 5G  A mutation identified in the B gene of the B3 propositus creates a BsmI site. The 247-bp PCR product, encompassing the exon 3-intron 3 junction, amplified from the gene with the IVS3 + 5G  A mutation yielded 206- and 41-bp fragments, after digestion with BsmI restriction endonuclease, while the 247-bp PCR product from a wild-type gene was resistant to digestion. The BsmI-cleaved products were analyzed by 3.5% agarose gel electrophoresis. Samples from the B3 propositus (lane 1) and another 13 unrelated B3 individuals (lanes 2-14) together with samples from 30 randomly selected group B individuals were subjected to PCR-RFLP analysis. One of the results obtained from the group B individuals is shown in lane B. Lane M shows the molecular mass standards of the 100-bp ladder. The results indicate that 13 of the 14 B3 individuals, all but the 1 shown in lane 14, possessed one allele with the IVS3 + 5G  A mutation, while none of the 30 group B individuals had the mutation. One B3 individual possesses the B gene with 247G  T missense mutation The ABO gene of the B3 individual without the IVS3 + 5G  A mutation was analyzed as described above. This B3 individual was shown to have a B/O1 genotype, and a nucleotide change of 247G  T (translation initiation codon of ABO cDNA as nucleotides 1 to 3) was identified in the B gene. The 247 position locates in the exon 6 region, and the G  T mutation predicts an Asp83Tyr amino acid alteration. The nucleotide 247 position of the ABO genes of 30 group B individuals was inspected through PCR amplification and sequencing; none of them possessed a G  T mutation. Exon 3 is skipped in the transcripts encoded from the B allele with the IVS3 + 5G  A mutation As the IVS3 + 5G  A mutation changes the consensus sequence of a splice donor site (GTA/GAGT),15-18 the transcript structures encoded from the B allele with the splice site mutation were inspected by reverse transcription PCR (RT-PCR). Two fragments (559 and 424 bp) were obtained from the RNA sample from the group B individual (Figure 3A, lane B). Direct sequencing of the products revealed that the larger fragment was composed of the complete B exon 2-exon 7 cDNA structure, while the smaller one had the same structure but without the exon 6 region. RT-PCR of the RNA of the B3 individual gave 2 smaller products (502 and 367 bp) (Figure 3A, lane B3). The 502-bp fragment was demonstrated to be the B exon 2-exon 7 structure with exon 3 skipped (Figure 3B), and the 367-bp fragment was the same structure without the exon 3 and exon 6 regions. View larger version (20K): [in this window] [in a new window]   Figure 3. ABO transcript structures of the group B individual and the B3 individual with the IVS3 + 5G  A mutation analyzed by RT-PCR. (A) RT-PCR results obtained from the RNA samples of the group B individual and the B3 individual with the IVS3 + 5G  A mutation. The RT-PCR products were analyzed by 3.0% agarose gel electrophoresis. The results obtained from the common B and the B3 samples are shown in lane B and lane B3, respectively. Lane M shows the molecular mass standards of the 100-bp ladder. The 2 products (559 and 424 bp) from the group B sample were demonstrated to be amplified from the complete B cDNA structure and from the B cDNA structure without the exon 6 region, respectively. The 2 smaller products (502 and 367 bp) from the B3 sample were shown to be amplified, respectively, from the B cDNA with exon 3 skipped and from the B cDNA with exon 3 and exon 6 skipped. (B) Sequencing result of the 502-bp product obtained from the B3 RNA sample. The 502-bp fragment obtained from the B3 RNA sample was eluted from the agarose gel and sequenced. It was demonstrated to have the exon 2-exon 7 structure but without the exon 3 region. The linkage of exon 2 and exon 4, indicating the skipping of exon 3, is shown. Although the B3 individual possesses a normal O1v allele, the O1v transcript was not detected in this RT-PCR analysis. This phenomenon is believed to result from a decreased stability of the O allele transcript.19 The presence of the transcripts without exon 6 is believed to result from alternative splicing of the ABO transcripts.4,20 The transcript with exon 6 skipped develops a translation stop codon at the exon 5-exon 7 junction, and thus is believed to be unable to produce a product with transferase activity. The complete exon 1-exon 7 transcript of the B gene was shown to be virtually absent in the RNA of the B3 individual with the IVS3 + 5G  A mutation, and instead, both of the transcripts encoded from the B3 allele with the splice site mutation skipped exon 3. These results show that the IVS3 + 5G  A mutation in the B gene destroys the consensus of the splice donor site and thus leads to the skipping of exon 3 during mRNA splicing processes (Figure 4). View larger version (12K): [in this window] [in a new window]   Figure 4. Diagrammatic representation of the molecular basis for the B3 allele with the IVS3 + 5G  A splice site mutation. The IVS3 + 5G  A mutation of the B3 allele changes the consensus sequence of the splice donor site and causes the removal of exon 3 during the mRNA splicing processes, making the exon a pseudoexon. The dashed lines represent the intron regions, and the solid lines illustrate the linkages of exons during mRNA processing. Exon 3 of the ABO gene comprises 57 bp, and the B3 transcript without exon 3 still retains the reading frame and predicts a protein product that lacks 19 amino acid residues in the N-terminal portion (Figure 5). The deleted segment of the 19 amino acids includes several residues of the predicted transmembrane domain of a normal B transferase. Whether this affects or changes the enzyme characteristic of the transferase is worth further investigation. View larger version (31K): [in this window] [in a new window]   Figure 5. Comparison of the amino acid sequences predicted from the B transcript and the B3 transcript with exon 3 skipped. A normal B cDNA predicts a polypeptide of 354 amino acids with a transmembrane segment of residues 17 through 37 (double underlined). The amino acid sequence predicted from the B3 transcript with exon 3 skipped lacks 19 amino acid residues in the N-terminal portion and preserves the majority of the transferase protein with the catalytic C-terminal remaining intact. The translation start and stop codons are underlined.     Acknowledgments The authors would like to thank the Taipei Blood Donation Center for help in collecting B3 blood samples.     Footnotes Submitted February 6, 2002; accepted March 20, 2002. Prepublished online as Blood First Edition Paper, April 30, 2002; DOI 10.1182/blood-2002-01-0188. Supported in part by National Health Research Institute grant NHRI-EX90-8601SL (M.L.) and National Science Council grant NSC 90-2320-B-195-004 (L.-C.Y.). The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734. Reprints: Marie Lin, Transfusion Medicine Laboratory, Department of Medical Research, Mackay Memorial Hospital, 45 Ming-San Rd, Tamshui, Taipei County 251, Taiwan; e-mail: marilin{at}ms2.mmh.org.tw.     References Top Abstract Introduction Study design Results and discussion References 1. Watkins WM. Molecular basis of antigenic specificity in the ABO, H and Lewis blood-group systems. In: Montreuil J,Schachter H,Vliegenthart JFG, eds. Glycoproteins. Amsterdam, The Netherlands: Elsevier Science; 1995:313-390. 2. Daniels G. Human Blood Groups. Oxford, England: Blackwell Science; 1995. 3. Issitt PD, Anstee DJ. Applied Blood Group Serology. Durham, NC: Montgomery Scientific Publications; 1998. 4. Yamamoto F, Clausen H, White T, Marken J, Hakomori S. Molecular genetic basis of the histo-blood group ABO system. Nature. 1990;345:229-233[CrossRef][Medline] [Order article via Infotrieve]. 5. Ogasawara K, Yabe R, Uchikawa M, et al. Molecular genetic analysis of variant phenotype of the ABO blood group system. Blood. 1996;88:2732-2737[Abstract/Free Full Text]. 6. Olsson ML, Irshaid NM, Hosseini-Maaf B, et al. Genomic analysis of clinical samples with serologic ABO blood grouping discrepancies: identification of 15 novel A and B subgroup alleles. Blood. 2001;98:1585-1593[Abstract/Free Full Text]. 7. Yamamoto F, McNeil PD, Yamamoto M, et al. Molecular genetic analysis of the ABO blood group system: 1. weak subgroup: A3 and B3 alleles. Vox Sang. 1993;64:116-119[Medline] [Order article via Infotrieve]. 8. Ogasawara K, Yabe R, Uchikawa M, et al. Recombination and gene conversion-like events may contribute to ABO gene diversity causing various phenotypes. Immunogenetics. 2001;53:190-199[CrossRef][Medline] [Order article via Infotrieve]. 9. Lin-Chu M, Broadberry RE, Chiou PW. The B3 phenotype in Chinese. Transfusion. 1986;26:428-430[CrossRef][Medline] [Order article via Infotrieve]. 10. Lin-Chu M, Broadberry RE, Tsai SJL. Incidence of ABO subgroups in Chinese in Taiwan [letter]. Transfusion. 1987;27:114-115[CrossRef][Medline] [Order article via Infotrieve]. 11. Lin-Chu M, Broadberry RE. Heterogeneity of the ABO subgroups among Chinese in Taiwan. Rev Fr Transfus Immunohematol. 1987;30:563-568[Medline] [Order article via Infotrieve]. 12. Lin M, Broadberry RE. Immunohematology in Taiwan. Transfus Med Rev. 1998;12:56-72[CrossRef][Medline] [Order article via Infotrieve]. 13. Yu L-C, Lee H-L, Chan Y-S, Lin M. The molecular basis for the B(A) allele: an amino acid alteration in the human histoblood group B -(1,3)-galactosyltransferase increases its intrinsic -(1,3)-N-acetylgalactosaminyltransferase activity. Biochem Biophys Res Commun. 1999;262:487-493[CrossRef][Medline] [Order article via Infotrieve]. 14. Olsson ML, Chester MA. Frequent occurrence of a variant O1 gene at the blood group ABO locus. Vox Sang. 1996;70:26-30[Medline] [Order article via Infotrieve]. 15. Padgett RA, Grabowski PJ, Konarska MM, Seiler S, Sharp PA. Splicing of messenger RNA precursors. Ann Rev Biochem. 1986;55:1119-1150[CrossRef][Medline] [Order article via Infotrieve]. 16. Sharpiro MB, Senapathy P. RNA splice junctions of different classes of eukaryotes: sequence statistics and functional implications in gene expression. Nucleic Acids Res. 1987;15:7155-7174[Abstract/Free Full Text]. 17. Krawczak M, Reiss J, Cooper DN. The mutational spectrum of single base-pair substitutions in mRNA splice junctions of human genes: causes and consequences. Hum Genet. 1992;90:41-54[Medline] [Order article via Infotrieve]. 18. Nakai K, Sakamoto H. Construction of a novel database containing aberrant splicing mutations of mammalian genes. Gene. 1994;141:171-177[CrossRef][Medline] [Order article via Infotrieve]. 19. O'Keefe DS, Dobrovic A. Decreased stability of the O allele mRNA transcript of the ABO gene [letter]. Blood. 1996;87:3061-3062[Free Full Text]. 20. Yamamoto F, McNeil PD, Hakomori S. Genomic organization of human histo-blood group ABO genes. Glycobiology. 1995;5:51-58[Abstract/Free Full Text]. © 2002 by The American Society of Hematology.   CiteULike    Connotea    Del.icio.us    Digg    Reddit    Technorati    What's this? This article has been cited by other articles: D.-P. Chen, C.-P. Tseng, H.-T. Lin, and C.-F. Sun Application of Real-Time PCR and Melting Curve Analysis in Rapid Detection of Ael and Bel Blood Types Ann. Clin. Lab. Sci., January 1, 2005; 35(1): 25 - 30. [Abstract] [Full Text] [PDF] Z.-H. Deng, Q. Yu, Y.-L. Lian, G.-G. Wu, Y.-Q. Su, and X. Zhang Identification of a Novel B Variant Allele at the ABO Locus in Chinese Han Individuals with B Subgroup Ann. Clin. Lab. Sci., January 1, 2005; 35(3): 265 - 269. [Abstract] [Full Text] [PDF] A. Seltsam, M. Hallensleben, A. Kollmann, and R. Blasczyk The nature of diversity and diversification at the ABO locus Blood, October 15, 2003; 102(8): 3035 - 3042. [Abstract] [Full Text] [PDF] This Article Abstract Full Text (PDF) All Versions of this Article: 2002-01-0188v1 100/4/1490    most recent Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Yu, L.-C. Articles by Lin, M. Search for Related Content PubMed PubMed Citation Articles by Yu, L.-C. Articles by Lin, M. Related Collections Transfusion Medicine Brief Reports Social Bookmarking                   What's this?

	Copyright © 2002 by American Society of Hematology         Online ISSN: 1528-0020