|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
CLINICAL OBSERVATIONS, INTERVENTIONS, AND THERAPEUTIC TRIALS
From the Division of Hematology-Oncology, Department of
Internal Medicine, Chang Gung Memorial Hospital, and the Biostatistics
Consulting Center, College of Medicine, Chang Gung University, Taiwan.
Essential thrombocythemia (ET) is a heterogeneous disorder in which
the clonality of hematopoiesis varies. The clinical significance of clonality status in ET remains to be determined. We used the human androgen receptor gene (HUMARA)-polymerase chain
reaction assay to investigate X-chromosome inactivation patterns
(XCIPs) and their value in predicting vascular complications in 89 female patients with ET. Fifty-four (68.4%) patients had a clonal
pattern of XCIP, and 15 (19.0%) had a polyclonal pattern. The
remaining 20 patients had either an ambiguous or a homozygous pattern
of XCIP and were therefore excluded from further analysis. Patients with clonal XCIPs were older (P = .029) and were at
greater risk for thrombosis (P = .007) than were those
with polyclonal XCIPs. We did not find a correlation between the
occurrence of hemorrhage and XCIP (P = .492). Advanced
age was predictive of thrombosis and hemorrhage. Platelet count did not
influence the risk for vascular complications. Hypertension was
significantly correlated with thrombotic events
(P = .002), whereas diabetes mellitus and hypercholesterolemia were of no predictive value. In a multivariate analysis, age was the significant predictor of thrombosis
(P = .030); however, XCIPs (P = .083) and
hypertension (P = .073) tended to predict thrombosis. Our
results suggest that older patients who have clonal XCIPs or
hypertension are at increased risk for thrombosis and should be
monitored closely for this complication.
(Blood. 2002;100:1596-1601) Essential thrombocythemia (ET) has traditionally
been considered a clonal disorder.1 However, no specific
markers have been established, and the diagnosis of ET is still based
on exclusion of other possible diagnoses.2 The
X-chromosome inactivation patterns (XCIPs) assay provides a means of
assessing clonality without the use of tumor-specific genetic or
cytogenetic markers, and this assay is potentially applicable to
clonality analysis of myeloid stem cell disorders in female
patients.3 The human androgen receptor (HUMARA) locus is
especially useful in the clonality assay because it is amenable to
polymerase chain reaction (PCR) analysis, and it is informative for its
high heterozygosity rate.4 ET, as diagnosed by standard
clinical and laboratory criteria, is a heterogeneous disorder The present study of female patients with ET addresses the clinical
relevance of their clonality status, especially with regard to its
predictive value on the risk for vascular complications. XCIPs were
determined by HUMARA-PCR assay, and the results were analyzed to
determine whether XCIPs were correlated with clinical features and
hematologic measures of patients with ET who had a long follow-up
duration. We also sought to determine other risk factors associated
with vascular complications in patients with ET.
Patient characteristics
Before they entered the study, all patients had platelet counts that
were higher than 700 × 109/L on at least 2 occasions.
Platelet counts ranged from 706 × 109/L to
3666 × 109/L (median, 1176 × 109/L). At
the time of initial evaluation, none of the patients had erythrocytosis, Philadelphia chromosome or BCR-ABL fusion
gene, collagen fibrosis, or cytogenetic or morphologic evidence of a myelodysplastic syndrome. In addition, none showed any evidence of
other causes of reactive thrombocytosis, including inflammatory disease, chronic infection, iron deficiency, malignancy, or
splenectomy. The duration of follow-up ranged from 13 months to 156 months (median, 45 months), and no causes of secondary thrombocytosis were identified during that time. Patient ages ranged between 15 and 92 years (median, 57 years). Nineteen patients had hypertension (blood
pressure higher than 150/90 mm Hg) and received antihypertensive agents; 7 patients had diabetes mellitus, for which 6 were treated with
oral hypoglycemic agents and 1 with insulin; 11 patients had
hypercholesterolemia (serum total cholesterol concentration more than
200 mg/dL), for which most were treated with dietary control alone; and
only 2 patients smoked cigarettes. Thirty-five patients with thrombotic
episodes, advanced age, or both were treated with myelosuppressive
agents, most with hydroxyurea, and 38 patients received aspirin (100 mg/d).
Cell separation and DNA extraction
HUMARA-PCR assay The state of activation of the X-chromosome was determined by using the methylation-sensitive restrictive enzyme HpaII. HpaII cleaves the unmethylated (active) X-chromosome and precludes amplification by PCR with primers flanking both HpaII sites and the CAG repeat in the first exon of the HUMARA locus.4The HUMARA-PCR assays of samples from the first 48 patients were performed according to the method of Gale et al10 with minor modification, which has been previously described in detail.7 Briefly, 1 µg genomic DNA was digested with 20 U RsaI (New England BioLabs, Beverly, MA) for 3 hours at 37°C and then with 10 U HpaII (New England BioLabs) overnight at 37°C. PCR was carried out in 25 µL reaction mixture that contained 0.1 µg digested DNA mixture, 0.3 µL each HUMARA primer (0.25 µg/µL), 2.5 µL of 10× PCR buffer, 1 µL of 2.5 mM dNTP, 1 µL dimethyl sulfoxide (Sigma, St Louis, MO), 0.1 µL Taq DNA polymerase (5 U/µL) (HT Biotechnology, Cambridge, United Kingdom), and 16.5 µL H2O. The upstream primer sequence was 5'-TCCAGAATCTGTTTCCAGAGC-3', and the downstream primer sequence was 5'-TGGGGAGAACCATCCTCACC-3'. The downstream primer was labeled with 32P. PCR was performed in a 9600 thermal cycler (Perkin-Elmer-Cetus, Norwalk, CT). The program consisted of an initial denaturation step at 94°C for 3 minutes, which was followed by 28 cycles of the following steps: 94°C for 45 seconds, 60°C for 30 seconds, and 72°C for 30 seconds. After the last cycle, a final extension step was performed at 72°C for 7 minutes. PCR products were subjected to electrophoresis on a 5% denaturing polyacrylamide gel, and the gel was then dried and exposed to x-ray film (Eastman Kodak, Rochester, NY). Autoradiographic signals were quantified by using a Fluorescent Image Analyzer FLA2000 with SW-Mac BAS Ver-2E software (FujiFilm, Tokyo, Japan). For the subsequent 41 patients, HUMARA-PCR assays were performed as described above except that the AR1 primer (CAGGCACCCAGAGGCCGCGAG) and the AR2 primer (CCAGGACCAGGTAGCCTGTGGGGC) were used. The AR2 primer was labeled with fluorescein, as described by El-Kassar et al.5 Samples (4 µL) of PCR products were mixed with 5 µL solution of formamide (95%) and loading buffer (5% blue dextran, 25 mM EDTA) that contained 0.55 µL Rox-500. A 1.5-µL sample of this mixture was loaded on a 5% Long Ranger-6 M urea gel with 1× TBE (0.089 M Tris, 0.089 M borate, 0.002 M EDTA) buffer. Electrophoresis was performed at 200 W for 2.25 hours, and the data were analyzed by an automated ABI 377 DNA sequencer (Applied Biosystems, Foster City, CA) and quantified by Genescan 3.1 software (Applied Biosystems). Each sample was analyzed at least in duplicate, and the results were expressed as a mean of the values. To compare the different methods, we analyzed duplicate samples from 20 patients by performing PCR analysis with 32P-labeled primers and fluorescein-labeled primers; this analysis yielded identical results for samples from the same patient. Interpretation of XCIPs A proportion of granulocytes derived from the dominant clone was analyzed by using the method of Asimakopoulos et al.11 After correcting for the preferential amplification of alleles after RsaI digestion, we derived the granulocyte allele ratios (RG). After HpaII digestion, we divided the signal of the less intense granulocyte allele by that of the other granulocyte allele. T-cell allele ratios (RT) were similarly derived. The percentage of clonal granulocytes (GC) was calculated from the RT and RG as follows: if RT was greater than RG, then GC = [(RT RG)/RT (RG + 1)] × 100%; if RT was less than
RG, then
GC = [(RG RT)/(RG + 1)] × 100%.
XCIPs were divided into 3 categories (Figure
1): (1) clonal XCIP, in which the
GC was greater than 50% (this category corresponds to an
RG less than 0.33 in the presence of an RT that
equals 1.0.); (2) polyclonal XCIP, in which the GC was less
than 50% and the RT was greater than 0.33; and (3)
ambiguous XCIP, in which the GC was less than 50% and the
RT was less than 0.33.
Statistical analysis Fisher exact test, 2 analysis, unpaired
t test, or Wilcoxon rank sum test was used, as appropriate, to
compare data between groups. Multiple logistic regression analysis was
used to identify the independent predictors of thrombosis or
hemorrhage. P = .05 was required for retention in the
model. All P values were calculated by using 2-sided tests.
Correlation between clinicohematologic features and XCIPs Of the 89 female patients with ET, 10 were homozygous at the HUMARA locus; 54 had clonal patterns, 15 had polyclonal patterns, and 10 had ambiguous patterns. Patients with homozygous or ambiguous patterns that could not be interpreted were excluded from further analysis. Thus, 69 patients formed the basis of the present study. Table 1 shows the comparisons of clinicohematologic features between the clonal and polyclonal XCIP categories. Patients with clonal XCIPs were significantly older than those with polyclonal XCIPs (P = .029). Between the 2 groups, no differences were observed in hematocrit (Ht), WBC count, platelet count, leukocyte alkaline phosphatase (LAP) score, duration of follow-up, or incidence of splenomegaly or myelofibrosis.
Correlation between vascular complications and XCIPs or other risk factors Twenty-five of the 69 patients with ET experienced thrombotic complications during the course of ET 8 patients had a history of
thrombosis, 9 experienced thrombotic events at the time of diagnosis, 1 experienced thrombotic events before and at the time of diagnosis of
ET, and 7 experienced thrombotic complications during follow-up. Three
patients had recurrent thrombotic events, and 1 had 2 recurrent
episodes. The thrombotic complications included 10 episodes of
cerebrovascular occlusion, 6 of peripheral arterial disease, 4 of
transient ischemic attack, 2 of ischemic cardiovascular disease, 2 of
deep venous thrombosis, 2 of erythromelalgia, 1 of splenic infarction,
and 1 of pulmonary embolism. Bleeding occurred in 16 patients
(gastrointestinal tract bleeding in 14, hematoma in 1, and subarachnoid
hemorrhage in 1). Bleeding occurred before or at diagnosis in 8 patients and during follow-up in the other 8 patients. Eight patients
had thrombotic and hemorrhagic complications. Two of the 29 patients
who received aspirin experienced gastrointestinal bleeding after
aspirin therapy. At a median follow-up time of 43 months, 6 patients
had died; 1 death was caused by a thrombotic complication, 1 by acute
myeloid leukemia, 1 by myelodysplastic syndrome, and the remaining 3 patients, who were older than 80 years, died of pneumonia or sepsis.
Thirty-seven (53.6%) patients remained asymptomatic throughout
follow-up.
Table 2 shows the results of univariate
analyses of potential risk factors for vascular complications in 69 female patients with ET. Clonal XCIPs were associated with a
significantly higher risk for thrombosis (P = .007) but
not with hemorrhagic events (P = .492). Older age was
strongly associated with a significantly higher risk for thrombosis
(P = .014) or hemorrhage (P < .0001), and an
elevated WBC count was also a predictor of hemorrhage
(P = .010). We found that platelet count did not influence
the risk for thrombosis (P = .402) or hemorrhage
(P = .414). There was a trend for patients with
splenomegaly (P = .057) or elevated LAP score
(P = .073) to be at increased risk for thrombosis. Neither splenomegaly nor elevated LAP score was associated with an increased risk for hemorrhage. There was no difference in Ht, follow-up time, or
presence of myelofibrosis between patients with vascular complications
and those without. Among the known cardiovascular risk factors
evaluated, hypertension was significantly associated with thrombotic
complications (P = .002) but not with hemorrhage (P = .287). Neither diabetes mellitus nor
hypercholesterolemia was linked to the risk for thrombosis or
hemorrhage. Only 2 patients smoked; therefore, an analysis of the
effect of cigarette smoking was precluded.
Multivariate analysis (Table 3) indicated
that age was the most important risk factor for thrombosis
(P = .030) or hemorrhage (P = .003). XCIPs
and hypertension were also associated with the development of
thrombosis. After the data were adjusted for age and presence of
hypertension, we found that patients with clonal XCIPs had a 6.9-fold
higher risk (95% confidence interval, 0.78-60.66) for thrombosis than
did those with polyclonal XCIPs. The type of XCIP had no impact on the
occurrence of hemorrhage.
Analysis of XCIPs is a useful tool in the diagnosis of clonal myelopoiesis in female patients with myeloid stem cell disorders. In the present study, clonality analysis of granulocytes was carried out in patients with ET; analysis of platelets or megakaryocytes was not performed because all these cell types belong to the myeloid lineage. However, during the course of ET, granulocytes can be polyclonal, whereas platelets and megakaryocytes are clonal. Indeed, evidence of this type of clonal evolution has been found in patients with polycythemia vera. Gilliland et al12 found that 1 of 3 patients with polycythemia vera had clonal erythropoiesis but not clonal granulopoiesis. Similarly, El-Kassar et al5 demonstrated that 3 of 10 patients with ET exhibited polyclonal XCIPs in their granulocytes but clonal XCIPs in their platelets. In contrast, Harrison et al6 did not demonstrate restriction of clonality to the megakaryocytic lineage in their 8 patients who had ET with polyclonal granulopoiesis. Chiusolo et al8 reported that none of their 15 patients with polyclonal granulopoiesis had clonal patterns in their platelets. Distinguishing extreme lyonization from acquired clonal dominance affecting granulocytes and T cells is impossible in patients with ambiguous XCIPs13; therefore, our evaluation of the clinical significance of XCIPs was restricted to patients with clonal or polyclonal hematopoiesis. When we compared the clinical and hematologic features of patients with clonal XCIPs and those of patients with polyclonal XCIPs, we found that older age was significantly associated with clonal XCIPs, whereas there was no correlation between XCIPs and platelet counts or other hematologic features. The incidence of vascular complications in ET varied considerably among the different studies.14 Our results showed that the incidence of thrombosis (36.2%) was more frequent than that of hemorrhage (23.2%). Most (72%) of the thrombotic events occurred before or at the time of diagnosis. In a randomized study, hydroxyurea effectively prevented thrombosis in high-risk patients with ET.15 In the current study, all patients who had thrombosis were treated with myelosuppressive agents immediately following the initial diagnosis; this treatment probably resulted in a low rate of recurrence of thrombosis in the subsequent course of disease. Patients with clonal XCIPs were more likely to experience thrombotic complications (24 of 54) than were those with polyclonal XCIPs (1 of 15). We did not observe a correlation between bleeding episodes and XCIP categories; however, we did evaluate other clinicohematologic features that might be predictive of vascular complications. Older age was strongly associated with thrombosis and hemorrhage. Elevated WBC count was also a predictor for hemorrhage. In contrast, no associations were detected between vascular complications and platelet count, Ht level, elevated LAP score, duration of follow-up, presence of splenomegaly, or presence of myelofibrosis. Findings from different studies of risk factors of vascular complications in patients with ET are conflicting.15-23 Most investigators observed a lack of correlation between platelet count and risk for thrombosis.15-21 On the other hand, degree of thrombocytosis was identified as a risk factor for bleeding manifestations in some studies16,22,23 but not in others, including ours.18,19 Besses et al20 found that cardiovascular risk factors such as hypertension, diabetes mellitus, and hypercholesterolemia were linked to thrombotic events, but others did not detect this association.15,21 When we analyzed these cardiovascular risk factors in our patients, we observed that hypertensive patients had a significantly higher incidence of thrombosis than normotensive patients. No predictive value was observed for diabetes mellitus or hypercholesterolemia. In addition, no correlation was found between cardiovascular risk factors and hemorrhagic complications. We and other investigators7,13,24 have shown that excessive skewing is more frequent in granulocytes than in T cells in healthy women, especially in elderly women. Excessive skewing that affects granulocytes more than T cells would result in a pseudoclonal pattern in elderly patients. In addition, the replacement of normal polyclonal hematopoiesis with clonal hematopoiesis may be a slowly progressive process in ET, if it happens at all. Thus, patients with clonal granulopoiesis might represent those whose disease has progressed from polyclonal to clonal hematopoiesis by clonal evolution and expansion with time. Older patients with ET might have had the disease longer; hence, their cells might have had more time to evolve and acquire a more detectable clonal pattern. To adjust for the acquired skewing toward clonal XCIPs occurring with increasing age, we used multivariate analysis to evaluate the risk factors. In this analysis, older age was the most predictive risk factor. Because of the strong correlation between the XCIP category and age, XCIP and hypertension were only marginally related to the development of thrombosis. Clonal progression in patients who have ET remains an important process that requires further elucidation. If patients demonstrated clonal granulopoiesis at the time of initial diagnosis, there were no earlier samples available to clarify whether clonal evolution in those patients might have lasted longer than in their polyclonal counterparts. On the other hand, serial clonality assays of patients with polyclonal XCIPs may be beneficial. However, many of our patients received myelosuppressive agents after their initial examination, and these agents might have induced a shift in the clonality of hematopoiesis toward normal. Before the current study, only 3 smaller studies that investigated the
clinical relevance of XCIPs in ET had been performed (Table
4). In the earlier studies, only
univariate analysis of data from patients with polyclonal XCIPs and
from younger patients (younger than 65 years) with monoclonal disease
was performed. The incidence of thrombosis in our patients who were
younger than 65 years and had clonal XCIPs (33.3%) tended to be higher
than that of patients with polyclonal XCIPs (6.7%;
P = .073). Harrison et al6 and Chiusolo et
al8 observed that thrombosis occurred significantly more
frequently in the monoclonal group. In contrast, El-Kassar et
al5 found that there was no correlation between the
prevalence of ischemic or hemorrhagic episodes and XCIPs. These
discrepant results were probably caused by the small sample size in the
studies. The inclusion of a larger number of patients and the use of
multivariate analysis allowed us to firmly establish the relation
between older age and the development of thrombosis. To determine
whether monoclonal XCIPs and hypertension are associated with increased
risk for thrombosis will require additional studies.
ET can evolve into acute myeloid leukemia (AML) or myelofibrosis.25,26 Disease progression was assessed in our patients, and only one experienced AML transformation. This patient had clonal hematopoiesis, was treated with busulfan and long-term hydroxyurea therapy, and experienced AML transformation 9.5 years after the initial diagnosis of ET. Two other patients with clonal XCIPs demonstrated increasing myelofibrosis during follow-up. None of the patients with polyclonal XCIPs had myelofibrosis progression. The small number of patients with AML or myelofibrosis progression precluded any analysis of the difference in disease progression between clonal and polyclonal hematopoiesis.
We thank Ching-Ping Tseng, PhD, for technical counseling, Dr Tzung-Chih Tang for help in sample collection, Dr Ching-Hon Pui and Dr Angela McArthur for critical review, and Ms Yu-Feng Wang for secretarial assistance.
Submitted August 27, 2001; accepted April 17, 2002.
Supported by grants NSC87-2314-B-182-018 and NSC88-2314-B-182-013 from the National Science Council, Taiwan and grant CMRP859 from Chang Gung Memorial Hospital, Taiwan.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Lee-Yung Shih, Division of Hematology-Oncology, Department of Internal Medicine, Chang Gung Memorial Hospital, 199 Tung Hwa North Rd, Taipei 105, Taiwan; e-mail: sly7012{at}adm.cgmh.org.tw.
1.
Fialkow PJ, Faguet GB, Jacobson RJ, Vaidya K, Murphy S.
Evidence that essential thrombocythemia is a clonal disorder with origin in a multipotent stem cell.
Blood.
1981;58:916-919 2. Murphy S, Peterson P, Iland H, Laszlo J. Experience of the Polycythemia Vera Study Group with essential thrombocythemia: a final report on diagnostic criteria, survival, and leukemic transition by treatment. Semin Hematol. 1997;34:29-39[Medline] [Order article via Infotrieve]. 3. Gale RE. Evaluation of clonality in myeloid stem-cell disorders. Semin Hematol. 1999;36:361-372[Medline] [Order article via Infotrieve]. 4. Allen RC, Zoghbi HY, Moseley AB, Rosenblatt HM, Belmont JW. Methylation of HpaII and HhaI sites near the polymorphic CAG repeat in the human androgen-receptor gene correlates with X-chromosome inactivation. Am J Hum Genet. 1992;51:1229-1239[Medline] [Order article via Infotrieve].
5.
El-Kassar N, Hetet G, Brière J, Grandchamp B.
Clonality analysis of hematopoiesis in essential thrombocythemia: advantages of studying T lymphocytes and platelets.
Blood.
1997;89:128-134
6.
Harrison CN, Gale RE, Machin SJ, Linch DC.
A large proportion of patients with a diagnosis of essential thrombocythemia do not have a clonal disorder and may be at lower risk of thrombotic complications.
Blood.
1999;93:417-424 7. Shih LY, Lin TL, Dunn P, et al. Clonality analysis using X-chromosome inactivation patterns by HUMARA-PCR assay in female controls and patients with idiopathic thrombocytosis in Taiwan. Exp Hematol. 2001;29:202-208[CrossRef][Medline] [Order article via Infotrieve]. 8. Chiusolo P, La Barbera EO, Laurenti L, et al. Clonal hemopoiesis and risk of thrombosis in young female patients with essential thrombocythemia. Exp Hematol. 2001;29:670-676[CrossRef][Medline] [Order article via Infotrieve]. 9. Sambrook J, Maniatis T, Fritsch EF. Molecular Cloning: A Laboratory Manual. 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1989. 10. Gale RE, Mein CA, Linch DC. Quantification of X-chromosome inactivation patterns in haematological samples using the DNA PCR-based HUMARA assay. Leukemia. 1996;10:362-367[Medline] [Order article via Infotrieve].
11.
Asimakopoulos FA, Gilbert JG, Aldred MA, Pearson TC, Green AR.
Interstitial detection constitutes the major mechanism for loss of heterozygosity on chromosome 20q in polycythemia vera.
Blood.
1996;88:2690-2698
12.
Gilliland DG, Blanchard KL, Levy J, Perrin S, Bunn HF.
Clonality in myeloproliferative disorders: analysis by means of the polymerase chain reaction.
Proc Natl Acad Sci U S A.
1991;88:6848-6852 13. Champion KM, Gilbert JG, Asimakopoulos FA, Hinshelwood S, Green AR. Clonal haemopoiesis in normal elderly women: implications for the myeloproliferative disorders and myelodysplastic syndromes. Br J Haematol. 1997;97:920-926[CrossRef][Medline] [Order article via Infotrieve]. 14. Barbui T, Finazzi G, Dupuy E, Kiladjian JJ, Brierè J. Treatment strategies in essential thrombocythemia: a critical appraisal of various experiences in different centers. Leuk Lymphoma. 1996;22(suppl 1):149-160[Medline] [Order article via Infotrieve].
15.
Cortelazzo S, Finazzi G, Ruggeri M, et al.
Hydroxyurea for patients with essential thrombocythemia and a high risk of thrombosis.
N Engl J Med.
1995;332:1132-1136 16. Bellucci S, Janvier M, Tobelem G, et al. Essential thrombocythemias: clinical evolutionary and biological data. Cancer. 1986;58:2440-2447[CrossRef][Medline] [Order article via Infotrieve]. 17. Cortelazzo S, Viero P, Finazzi G, D'Emilio A, Rodeghiero F, Barbui T. Incidence and risk factors for thrombotic complications in a historical cohort of 100 patients with essential thrombocythemia. J Clin Oncol. 1990;8:556-562[Abstract]. 18. Colombi M, Radaelli F, Zocchi L, Maiolo AT. Thrombotic and hemorrhagic complications in essential thrombocythemia: a retrospective study of 103 patients. Cancer. 1991;67:2926-2930[CrossRef][Medline] [Order article via Infotrieve]. 19. Watson KV, Key N. Vascular complications of essential thrombocythaemia: a link to cardiovascular risk factors. Br J Haematol. 1993;83:198-203[Medline] [Order article via Infotrieve]. 20. Besses C, Cervantes F, Pereira A, et al. Major vascular complications in essential thrombocythemia: a study of the predictive factors in a series of 148 patients. Leukemia. 1999;13:150-154[CrossRef][Medline] [Order article via Infotrieve]. 21. Bazzan M, Tamponi G, Schinco P, et al. Thrombosis-free survival and life expectancy in 187 consecutive patients with essential thrombocythemia. Ann Hematol. 1999;78:539-543[CrossRef][Medline] [Order article via Infotrieve]. 22. Fenaux P, Simon M, Caulier MT, Lai JL, Goudemand J, Bauters F. Clinical course of essential thrombocythemia in 147 cases. Cancer. 1990;66:549-556[CrossRef][Medline] [Order article via Infotrieve]. 23. van Genderen PJ, Mulder PG, Waleboer M, van de Moesdijk D, Michiels JJ. Prevention and treatment of thrombotic complications in essential thrombocythaemia: efficacy and safety of aspirin. Br J Haematol. 1997;97:179-184[CrossRef][Medline] [Order article via Infotrieve]. 24. Gale RE, Fielding AK, Harrison CN, Linch DC. Acquired skewing of X-chromosome inactivation patterns in myeloid cells of the elderly suggests stochastic clonal loss with age. Br J Haematol. 1997;98:512-519[CrossRef][Medline] [Order article via Infotrieve].
25.
Sterkers Y, Preudhomme C, Lai JL, et al.
Acute myeloid leukemia and myelodysplastic syndromes following essential thrombocythemia treated with hydroxyurea: high proportion of cases with 17p deletion.
Blood.
1998;91:616-622 26. Tefferi A, Solberg LA, Silverstein MN. A clinical update in polycythemia vera and essential thrombocythemia. Am J Med. 2000;109:141-149[CrossRef][Medline] [Order article via Infotrieve].
© 2002 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  J. R. Lambert, T. Everington, D. C. Linch, and R. E. Gale In essential thrombocythemia, multiple JAK2-V617F clones are present in most mutant-positive patients: a new disease paradigm Blood, October 1, 2009; 114(14): 3018 - 3023. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Antonioli, P. Guglielmelli, G. Poli, C. Bogani, A. Pancrazzi, G. Longo, V. Ponziani, L. Tozzi, L. Pieri, V. Santini, et al. Influence of JAK2V617F allele burden on phenotype in essential thrombocythemia Haematologica, January 1, 2008; 93(1): 41 - 48. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. E. Gale, A. J.R. Allen, M. J. Nash, and D. C. Linch Long-term serial analysis of X-chromosome inactivation patterns and JAK2 V617F mutant levels in patients with essential thrombocythemia show that minor mutant-positive clones can remain stable for many years Blood, February 1, 2007; 109(3): 1241 - 1243. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. P. Steensma and R. E. Richard Myeloproliferative disorders ASH Self-Assessment Program, January 1, 2007; 2007(1): 172 - 227. [Full Text] [PDF]
|
|
|
|
 |
|
 L.-Y. Shih, C.-T. Lee, T.-L. Lin, C.-H. Chang, C.-F. Huang, P.-N. Wang, M.-C. Kuo, P. Dunn, J.-H. Wu, H. Chang, et al. EEC Growth, JAK2 Mutation, PRV-1 Overexpression and X-Chromosome Inactivation Pattern: Predicting Values on Polycythemia Vera Evolution and Risk of Thrombosis in Idiopathic Thrombocytosis. Blood (ASH Annual Meeting Abstracts), November 16, 2006; 108(11): 2692 - 2692. [Abstract] [PDF]
|
|
|
|
|
|
A. M. Ferraris, R. Mangerini, N. Pujic, O. Racchi, D. Rapezzi, A. Gallamini, S. Casciaro, and G. F. Gaetani High telomerase activity in granulocytes from clonal polycythemia vera and essential thrombocythemia Blood, March 1, 2005; 105(5): 2138 - 2140. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. I. Schafer Thrombocytosis N. Engl. J. Med., March 18, 2004; 350(12): 1211 - 1219. [Full Text] [PDF]
|
|
|
|
|
|
K. Ishiyama, T. Chuhjo, H. Wang, A. Yachie, M. Omine, and S. Nakao Polyclonal hematopoiesis maintained in patients with bone marrow failure harboring a minor population of paroxysmal nocturnal hemoglobinuria-type cells Blood, August 15, 2003; 102(4): 1211 - 1216. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2002 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction