|
|
Prepublished online as a Blood First Edition Paper on May 13, 2002; DOI 10.1182/blood-2002-03-0861.
 Previous Article | Table of Contents | Next Article 
Blood, 1 September 2002, Vol. 100, No. 5, pp. 1845-1851
PHAGOCYTES
Identification of a novel NCF-1 (p47-phox)
pseudogene not containing the signature GT deletion: significance for
A47° chronic granulomatous disease carrier detection
Paul G. Heyworth,
Deborah Noack, and
Andrew R. Cross
From the Department of Molecular and Experimental
Medicine, The Scripps Research Institute, La Jolla, CA.
 |
Abstract |
The p47-phox gene, NCF-1, has 2 nearly
identical pseudogenes ( NCF-1) in proximity at
chromosomal locus 7q11.23. A dinucleotide deletion ( GT) at the
beginning of exon 2 that leads to a frameshift and premature stop codon
is considered the signature sequence of the pseudogenes. It is also the
most prevalent mutation in p47-phox-deficient (A47°)
chronic granulomatous disease (CGD) as a result of the insertion of a
GT-containing fragment of pseudogene into NCF-1.
Extending our study of the relationship between NCF-1 and
NCF-1 to 53 unaffected control individuals, we found
that although in most (n = 44), the ratio of pseudogene (GT) to
functional gene (GTGT) sequence in amplicons spanning exon 2 was 2:1,
as previously observed, surprisingly, in 7 persons the ratio was 1:1,
and in 2 persons the ratio was 1:2. The lowered ratios are explained by
the presence, in a heterozygous or homozygous state, respectively, of a
pseudogene that contains GTGT rather than GT. It is possible that
this pseudogene has not undergone deletion of GT, but more likely,
based on analysis of additional NCF-1/NCF-1 markers, it
represents the previously unidentified product of the reciprocal
crossover of DNA fragments between the functional gene and one of its
pseudogenes. The mutated NCF-1 resulting from this event is
the predominant A47°CGD allele. The existence of 2 extended
haplotypes encompassing NCF-1/NCF-1 further complicates the detection of A47°CGD carriers. Although most have a GT/GTGT ratio of 5:1, some have a ratio of 2:1 and are indistinguishable by
this means from unaffected individuals.
(Blood. 2002;100:1845-1851)
© 2002 by The American Society of Hematology.
| |
Introduction |
In stimulated normal phagocytes, reduced
nicotinamide adenine dinucleotide phosphate (NADPH) oxidase
catalyzes the reduction of oxygen to superoxide. Superoxide and its
more potent microbicidal derivatives (eg, hydrogen peroxide, hypohalous
acids) are important for killing invading microorganisms. In
chronic granulomatous disease (CGD), an uncommon inherited disorder of
the innate immune system, the primary defect occurs in any 1 of 4 genes
encoding phox proteins of the phagocyte NADPH oxidase
complex. Gp91-phox and p22-phox together form
flavocytochrome b558, the catalytic core of the
enzyme, whereas p47-phox and p67-phox are found
in the soluble fraction of resting phagocytes. The association of p47-phox and p67-phox with the flavocytochrome at
the plasma or phagosomal membrane is crucial for enzyme activation. In
CGD patients, phagocyte NADPH oxidase activity is absent or occurs at
very low levels. Consequently, patients are highly susceptible to
severe, sometimes fatal, recurrent bacterial and fungal infections
(reviewed by Roos and Curnutte1 and Segal et
al2).
The p47-phox-deficient form of CGD (A47°CGD), which
accounts for about 20% of all CGD cases, is inherited in an autosomal recessive manner and caused by mutations in the gene NCF-1.
A47°CGD is unique among the 4 forms of the disease in that a common
mutation has been identified in approximately 95% of affected alleles
analyzed worldwide. Ninety-five of 104 unrelated patients reported to
date were homozygous and a further 7 were heterozygous for a
dinucleotide deletion (GT) in a GTGT sequence at the beginning of
exon 2 of NCF-1.3-9 The deletion predicts a
frameshift and a premature stop codon at residue 51 and leads to
complete absence of p47-phox protein from the patients'
phagocytes (A47°CGD).3 Only 8 other mutations have been
identified in NCF-1.4,8,10,11 In contrast, the
mutations that cause the other forms of CGD are highly heterogeneous, with many of them being specific to each affected family (mutations and
primary references are tabulated by Cross et al11 and
Heyworth et al12). A47°CGD is also unusual in that it is
at least 4 times more common than the other autosomal recessive forms
of the disease. Defects in the genes for p22-phox (CYBA) and
p67-phox (NCF-2) each account for approximately
5% or less of all cases. The remaining 70% of cases are inherited in
an X-chromosome-linked manner and are caused by mutations in the
gp91-phox gene, CYBB.1,13
NCF-1 has at least 2 pseudogenes, each of which is highly
homologous (approximately 98% identical) to the functional gene and
colocalizes with it to chromosome 7q11.23.7,14-18 The
NCF-1 pseudogenes (NCF-1) are distinguished
from the functional gene by 3 well-characterized differences (Figure
1). One of them, considered the signature
sequence of the pseudogenes, is the GT deletion at the beginning of
exon 2 that causes CGD when it occurs in the functional gene. The
others are a C>T transition in intron 1, 122-base pair (bp) upstream
of the 5' end of exon 2, and a 20-bp duplication 176 bp downstream from
the 5' end of intron 2. It is now apparent that the relatively high
incidence of A47°CGD and the predominance of the GT mutation are
due to recombination events between NCF-1 and its
pseudogenes resulting from their proximity, their high degree of
similarity, and the presence within each gene of multiple recombination
hot spots.7,9,15,19 Interestingly, these genes occur in a
region of chromosome 7 that contains large (approximately 200-400 kilobase [kb]) duplicated segments (duplicons) of DNA, in each of
which lies a single copy of NCF-1 or NCF-1, in
addition to other gene/pseudogene sequences. The complex 7q11.23
region, which has been difficult to map because of the high level of
duplication, has been intensively studied because it also contains the
locus of Williams-Beuren syndrome.16-18,20
View larger version (11K):
[in this window]
[in a new window]
| Figure 1.
Differences between NCF-1 and its
pseudogenes.
Within a small segment of the gene, the most well-characterized
differences between NCF-1 and its pseudogenes
(NCF-1) are shown. These are a C/T transition in intron 1 at  122 bp from the start of exon 2, GTGT or GT at the beginning of
exon 2, and the single or duplicated 20-bp stretch in intron 2 at +176
bp from the end of exon 2.
|
|
The minimum incidence of CGD was recently estimated at between 1 per
200 000 and 1 per 250 000 live births.13 Therefore, the
estimated incidence of A47°CGD is approximately 1 per million births,
from which the carrier frequency can be calculated as 1 per 500 individuals. The high degree of homology between NCF-1 and
NCF-1, which results in the coamplification of DNA
strands from the functional gene and its pseudogenes with most
oligonucleotide primers, complicates the molecular analysis of families
affected by A47°CGD as well as the detection of the carrier state in
other individuals. The majority of patients (ie, with the common
GT/GT genotype) can be detected with relative ease because the
GTGT-containing sequence is absent from polymerase chain reaction (PCR)
products encompassing exon 2. Recently, we also described an
allele-specific strategy to simplify the detection of rare non-GT
mutations in NCF-1.8 The main difficulty lies
in confidently diagnosing the common carrier state (GTGT/GT) because
the genomes of all unaffected individuals also include DNA sequence
with the GT deletion within the p47-phox pseudogenes. To
determine whether the ratio of pseudogene (GT) to functional gene
(GTGT) sequence8 can be used reliably to identify carriers
of A47°CGD,21 we studied in more detail the relationship
between NCF-1 and NCF-1 in unaffected control
individuals and obligate carriers of the disease. In so doing, we
identified a novel form of NCF-1 that does not contain GT. The presence of this pseudogene sheds new light on the
recombination events that cause A47°CGD but further complicates the
detection of the GT carrier state.
| |
Materials and methods |
Collection of blood samples and preparation of DNA
Protocols and consent forms for the collection of blood samples
were approved by the Human Subjects Committee of the Scripps Office for
the Protection of Research Subjects. Informed consent was obtained
according to the Declaration of Helsinki. Whole blood was collected
with EDTA (ethylenediaminetetraacetic acid) as an anticoagulant, and
genomic DNA was isolated using the Puregene DNA Isolation Kit (Gentra
Systems, Minneapolis, MN). Custom-synthesized oligonucleotide primers
were purchased from Sigma-Genosys (The Woodlands, TX).
Determination of the ratio of GT- to GTGT-containing
sequence
Two independent methods were used to estimate the ratio of
GT- to GTGT-containing sequence in genomic DNA samples. In the first
method, exon 2 of NCF-1/NCF-1 was amplified using
intronic primers 2LB2 (GTGCACACAGCAAAGCCTCT) and 2RB2
(CTAAGGTCCTTCCCAAAGGGT). Reaction conditions have been described
previously.8 PCR-amplified fragments were purified using a
QIAquick PCR purification kit (Qiagen, Valencia, CA) and sequenced
using the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction
Kit (PE Applied Biosystems, Foster City, CA) and an ABI Prism 310 Genetic Analyzer. Nucleotide peak heights were measured directly using
the instrument software over a 27-bp stretch of sequence, corresponding
to nucleotides 81 to 107 of the p47-phox cDNA. At each
position, the ratio of nucleotide peak heights was calculated and a
mean ratio was determined for the entire section. Peak heights were not
measured at the 3 positions within this stretch at which nucleotides in
the pseudogene and functional gene coincided (Figure
2). When peak heights were measured over
the entire exon, the calculated ratios were very similar to those
obtained by measurements over the 27-bp stretch.
View larger version (54K):
[in this window]
[in a new window]
| Figure 2.
Sequencing electropherograms distinguish among 3 different
NCF-1/NCF-1 genotypes in the normal population, as well
as carriers of the common NCF-1 GT mutation.
Genomic DNA from control individuals unaffected by CGD and obligate
carriers of A47°CGD was amplified using primers 2LB2 and 2RB2, which
do not distinguish between NCF-1 and NCF-1.
The figure shows representative electropherograms that cover a 27-bp
stretch starting 9 nucleotides downstream from the start of exon 2 (ie,
nucleotides 81-107 of the NCF-1 cDNA). In each case, double
sequence is observed because it diverges after the initial GT at the
start of the exon (not shown). The nucleotide sequences of the
pseudogenes and functional gene are shown at the top and bottom of the
figure, respectively. Unaffected control individuals fell into 3 distinct groups with approximate GT/GTGT sequence ratios of 2:1,
1:1, and 1:2, as shown, based on peak height measurements. This is well
illustrated, for example, by the G (NCF-1) and C
(NCF-1) at the fifth position. Most obligate carriers of the
GT mutation had a much higher ratio of GT (pseudogene) sequence,
as seen in the top electropherogram.
|
|
In the second method, radiolabeled PCR products encompassing the start
of exon 2 were separated on denaturing acrylamide gels, and quantified.
DNA from 62 bp 5' from the start of exon 2 through 38 bp into exon 2 was amplified using 32P end-labeled 2LB2 and unlabeled
cDNA2R (TCCGACAGGTCCTGCCA). Primer 2LB2 was end-labeled using 90 ng
2LB2, 180 µCi (6.66 MBq)  -32P adenosine
triphosphate, 0.5 µL T4 10× buffer, and 2.5 U T4 polynucleotide kinase in a final volume of 5 µL. The radiolabeling mixture was incubated at 37°C for 30 minutes, after which the kinase was
inactivated by heating to 65°C for 20 minutes. The amplification
reaction was performed in the following buffer: 33.5 mM Tris-HCl (pH
8.8), 8.3 mM (NH4)2SO4, 3.35 mM
MgCl2, 85 µg/mL bovine serum albumin, 5%
dimethylsulfoxide, 0.125 mM each deoxyribonucleoside triphosphate, 90 ng cDNA2R, 90 ng 32P-labeled 2LB2, 2.5 U AmpliTaq
polymerase, and 100 ng DNA. An initial denaturation for 3 minutes at 94°C was followed by 40 cycles at 94°C for 5 seconds and
70°C for 1 minute, with a final extension for 15 minutes at 72°C.
This PCR resulted in a 98-bp or 100-bp fragment, depending on whether
the sequence contained GT or GTGT. For separation of the fragments,
5 µL PCR product was mixed with 4 µL denaturing dye solution,
denatured for 5 minutes at 95°C, chilled on ice, and then run on a
6% acrylamide sequencing gel (SequaGel 6; National Diagnostics,
Atlanta, GA) for 3 hours at 50 to 55 W. The radiolabeled bands were
quantified either using a Cyclone Storage Phosphor System and OptiQuant
image analysis software (Packard Instrument, Meriden, CT) or by
Cerenkov counting following autoradiography and their excision.
Allele-specific PCR
To avoid coamplification of DNA with the GT
deletion, we used an allele-specific PCR strategy to amplify the entire
functional NCF-1 and, where present, the GTGT-containing
NCF-1. The amplification reactions, which are described
fully by Noack et al,8 used either forward or reverse
primers including the GTGT at the beginning of exon 2. Allele
specificity of the reactions was checked by sequencing the reaction
products to ensure that only GTGT-containing sequence was
present.7,8 Purification and sequencing of amplified fragments were performed as described above. Sequence numbering in this
report is based on the convention that +1 is the A of the ATG initiator
codon. This is 12 nucleotides less than the numbering of the cDNA
sequence for NCF-1 in GenBank (accession numbers M25665
and M26193).
Allele-specific RT-PCR
Total RNA was isolated from whole blood using the RNeasy Blood
Mini Kit (Qiagen). Reverse transcription (RT)-PCR was performed exactly as described previously using the SuperScript Preamplification System for first-strand cDNA synthesis.8 Briefly, 2 allele-specific PCRs were performed. In the first, a fragment from the
beginning of exon 1 to the beginning of exon 2 was amplified with
primers cDNA1F and GTGT-R. In the second, primers cDNAGTGT and cDNA11R were used to amplify from the start of exon 2 to the end of exon 11. Primer sequences are given in Table 1 of the previous
publication.8 The allele specificity of the RT-PCR
products was checked by sequencing into the region of the
allele-specific primer to ensure that only GTGT sequence was
present.
| |
Results and discussion |
We have shown previously that examination of the
electropherogram peak heights for the p47-phox pseudogene
and functional gene sequence in exon 2 can be a useful, preliminary
guide for distinguishing between patients with the common GT/GT
genotype and those with rare non-GT mutations.8 In the
relatively small number of control individuals (unaffected by CGD)
included in that previous study, the ratio of GT-containing sequence
to GTGT-containing sequence was approximately 2:1, consistent with the
presence of 2 copies of NCF-1 and a single copy of the
functional gene.15-17 In obligate heterozygous carriers
(GT/GTGT) of the predominant form (GT/GT) of A47°CGD, the
peak height ratios were predictably much higher (approximately
5:1).8
Three different GT/GTGT ratios in the general
population
Our earlier findings therefore raised the possibility that a
simple measurement of the ratio of GT to GTGT sequence could be used
to reliably identify carriers of the GT mutation. Indeed, a method
using this general principle has recently been
published.21 To study further the relationship between the
NCF-1 and NCF-1 genes and to assess the
reliability of this technique, we analyzed DNA from a group of 53 unaffected and unrelated control individuals and additional obligate
carriers of the disease. Using oligonucleotide primers that do not
distinguish between the gene and its pseudogenes, we amplified and
sequenced fragments spanning exon 2. We initially compared
electropherogram peak heights over a 27-bp stretch of double sequence
because this method had yielded results in our previous study
consistent with published data. As shown in Figures 2 and
3, analysis of genomic DNA from this
large group of control individuals revealed that 3 distinct
electropherogram patterns with different GT/GTGT sequence ratios
were reproducibly obtained. In 44 of the 53 control individuals (Figure
3), the ratio of GT sequence to GTGT sequence was approximately 2:1
(2.25 ± 0.14; mean ± SD), as we had previously observed and
consistent with data from human genome sequencing. In 7 persons, the
amount of GTGT sequence was approximately equal to that of the GT
sequence, giving a ratio of 1:1 (1.02 ± 0.05). Surprisingly, in DNA
from 2 control subjects, the ratio of GT to GTGT sequence was
completely reversed at approximately 1:2 (0.46 ± 0.03). As
previously observed,8,21 most obligate carriers of the
GT mutation had a much higher ratio of GT to GTGT sequence
(Figure 2, top).
View larger version (16K):
[in this window]
[in a new window]
| Figure 3.
Estimated ratios of GT/GTGT sequence in the normal
population and in carriers of A47°CGD.
The ratios of GT- to GTGT-containing sequence in 53 unrelated
control individuals unaffected by CGD were determined from
electropherogram peak height measurements as described in "Materials
and methods." Within this group, separation of symbols on the
horizontal axis is for purposes of clarity only. DNA samples from 9 carrier parents of A47°CGD patients homozygous for GT
(GT/GT) were analyzed in the same way. For the experiment shown
in the final column, DNA from each of 3 controls (2:1 ratio) was mixed
with an equal amount of DNA from a GT/GT patient prior to PCR
amplification and estimation of the GT/GTGT ratio. Mean values are
presented in Table 1, together with confirmatory data using a second,
independent method.
|
|
Measuring electropherogram peak height ratios is not necessarily a
reliable way to estimate relative numbers of each gene because it
requires not only equal efficiency of the NCF-1 and NCF-1 DNA amplification reactions, but also quantitative
data from the sequencing reaction. To verify our results, we
used a second independent method, using the same upstream primer (2LB2) end-labeled with 32P and a different downstream primer
(cDNA2R). Representative results using this method to analyze the
GT/GTGT ratios in control individuals and A47°CGD carriers
are shown in Figure 4. The pooled data in Table 1 show that the results from the
2 methods were generally in good agreement. The largest difference
occurred in the group of 7 A47°CGD carriers, where the frequency of
the functional gene appeared to be consistently underestimated based on
peak height measurements and overestimated using the gel-based
technique, assuming a theoretical value of 5 (see below).
However, the mean value with the 2 methods (4.83) was very close to the
theoretical value and in good agreement with the results of Dekker et
al,21 who used a similar technique with a
fluorochrome-labeled forward primer.
View larger version (22K):
[in this window]
[in a new window]
| Figure 4.
Analysis of the ratio of GT- to GTGT-containing
sequence based on PCR product size.
32P-labeled PCR products encompassing the start of exon 2 from control individuals and carriers of the GT mutation were
separated on denaturing acrylamide sequencing gels. Bands were detected
by autoradiography (as shown here) or in a Cyclone storage phosphor
system. The upper (100 bp) and lower (98 bp) bands represent fragments
containing the functional GTGT or the GT mutation, respectively.
Results from a single representative experiment are shown; mean values
for each group are presented in Table 1.
|
|
NCF-1 containing GTGT at the start of exon
2
The GT/GTGT ratios of approximately 2, 1, and 0.5 that we have
determined experimentally in unaffected controls are most easily
explained by the presence in the general population of a second,
previously unidentified type of NCF-1 pseudogene (or duplicate copy of the gene) containing GTGT at the start of exon 2 rather than the signature GT. We refer to this novel pseudogene as
Type II and the more common GT-containing pseudogenes as Type I, but
for this classification we do not take into account possible single-nucleotide differences between pseudogenes.15 The
presence of 2 types of pseudogenes in the general population would
generate at least 2 extended NCF-1 gene/pseudogene
haplotypes. The more common haplotype would have 2 copies of Type I
NCF-1 and one copy of the functional NCF-1.
The less common haplotype would have one copy each of Type I and Type
II NCF-1 and one copy of the functional gene. The 3 genotypes that result from different combinations of these extended
haplotypes are shown in Figure 5,
together with the theoretical GT/GTGT ratios. Our observed ratios
(Table 1) match these values very closely. The data in the table
indicate that 11 of 106 (about 10%) of the chromosomes 7 analyzed (in
genomic DNA from 53 control individuals) contained the Type II
pseudogene, as 7 persons had GT/GTGT ratios of approximately 1.0 (heterozygous for Type II NCF-1) and 2 had ratios of
approximately 0.5 (homozygous for Type II NCF-1). Dekker
et al21 also identified one individual, out of a control
group of 16, who had equal amounts of GT- and GTGT-containing
sequence.
View larger version (18K):
[in this window]
[in a new window]
| Figure 5.
Predicted
NCF-1/NCF-1 genotypes based on observed GT/GTGT
ratios in unaffected individuals and in carriers and patients with
A47°CGD.
We have identified unaffected control individuals with 3 different
ratios of GT/GTGT sequence in exon 2 of the
NCF-1/NCF-1 genes: 2:1, 1:1, or 1:2. The most likely
explanation for these ratios is the existence in the population of 2 main extended haplotypes (see "Results and discussion"), giving
rise to the NCF-1/NCF-1 genotypes shown. This figure
reflects only the nucleotide sequence at the start of exon 2; it does
not take into consideration other known differences between the gene
and its pseudogenes. The solid and open bars represent GTGT-containing
and GT-containing (nonfunctional) genes, respectively. As depicted,
the central gene on each chromosome is NCF-1. It is flanked
by its 2 pseudogenes,16,18 which are either of Type I
(GT) or Type II (GTGT). In the majority of A47°CGD patients, both
copies of NCF-1 contain the GT mutation. Their carrier
parents are heterozygous for the mutation, and although most have a
GT/GTGT sequence ratio of 5:1, as shown, approximately 10% would be
predicted to show a ratio of 2:1 (see "Results and
discussion").
|
|
Evidence to support the existence of the genotypes presented in Figure
5 was provided by analysis of genomic DNA from the parents and siblings
of 1 of the 2 control individuals identified as having a GT/GTGT
ratio of approximately 0.5 (1:2) in Figure 3 (referred to here as
subject P). For our model to be correct, both his parents would have to
have at least one copy of a Type II NCF-1 pseudogene within
their genomes. As shown in the pedigree of this family (Figure
6), the mother and father of subject P both had GT/GTGT ratios of 1:1. This is internally consistent with
their having copies of each of the 2 extended haplotypes, allowing
subject P (indicated by the asterisk) to have inherited a Type II
NCF-1 from each of his parents. Both siblings of subject P had GT/GTGT ratios of 1:1. Additional support for our model came
from experiments in which we mixed equal amounts of DNA (measured spectrophotometrically) from 3 different 2:1 control individuals with
DNA from a single A47°CGD patient homozygous for GT. These samples
represent the first and final genotypes in Figure 5 and, as would be
predicted, when combined gave GT/GTGT ratios very similar to those
of most A47° carriers close to the theoretical value of 5:1 (Figure
3).
View larger version (13K):
[in this window]
[in a new window]
| Figure 6.
The parents of control subject P, who has the uncommon
GT/GTGT ratio of 1:2, both have a ratio of 1:1, suggesting that they
carry one copy of each of the extended haplotypes.
Exon 2 of NCF-1/NCF-1 in genomic DNA of the parents and
siblings of control subject P (indicated by an asterisk in the
pedigree) was amplified, and the ratio of GT to GTGT sequence was
estimated using the sequence- and gel-based methods. Both parents were
found to have a ratio of 1:1, which is consistent with our hypothesis
that subject P is homozygous for the extended haplotype that contains a
single copy each of the Type I and Type II pseudogenes. The siblings
both had GT/GTGT ratios of 1:1. The family is unaffected by CGD. All
other details are the same as in Figure 5.
|
|
Obligate carriers of GT can have a GT/GTGT ratio of
2:1
As indicated in Figure 5, the existence of 2 NCF-1/NCF-1 extended haplotypes in the population
predicts that although most carriers of the common A47°CGD allele
would have a GT/GTGT sequence ratio of 5:1, a minority would have a
ratio of 2:1. Based on the prevalence calculated above for the Type II
NCF-1 pseudogene, approximately 1 in 10 GT carriers would
be expected to have the Type I NCF-1/Type II
NCF-1/NCF-1 (1:2) extended haplotype on their second
(functional) copy of chromosome 7. In our analysis of 9 parents of
homozygous GT A47° patients, we identified 2 such carriers (Figure
3). In one case, we could not categorically rule out the possibility
that a de novo GT mutation had occurred in a germline cell, raising
the possibility that the parent with a 2:1 ratio was unaffected and not
a carrier. However, in the second case the evidence was much stronger
that the mother, whose GT/GTGT ratio was 2:1, was indeed a carrier.
As shown in this family's pedigree (Figure
7), 2 daughters had A47°CGD and were homozygous for GT, making the possibility of a de novo mutation very
unlikely. In addition, and more conclusively, the third sibling, who
was unaffected by CGD, had a GT/GTGT ratio of 1:1. She must therefore have acquired the more common (2:1) haplotype from her father
(who had a ratio of 5:1) and the less common (1:2) haplotype from her
mother. Two parents of homozygous GT patients with GT/GTGT ratios
of 2:1 were also identified in a previous study,21 but de
novo GT mutations were not excluded.
View larger version (12K):
[in this window]
[in a new window]
| Figure 7.
NCF-1/NCF-1 genotypes in a family
affected by A47°CGD.
Exon 2 of NCF-1/NCF-1 in genomic DNA from the members of
a family affected by A47°CGD was amplified, and the ratio of GT to
GTGT sequence was estimated. Two sisters ( ) have A47°CGD and are
homozygous for the GT mutation. Both parents were considered
obligate carriers of the disease, but the GT/GTGT ratio of the
mother ( ) was 2:1, identical to that of an unaffected individual. A
third sister ( ) was found to have a GT/GTGT ratio of 1:1. These
data indicate that the mother carries the GT mutation in
NCF-1 on one copy of chromosome 7 and one each of the type I
and type II pseudogenes on the other copy. All other details are the
same as in Figure 5.
|
|
Origin of the GTGT-containing pseudogene
There appear to be 2 main possibilities for the origin of the
GTGT-containing (Type II) pseudogene. One is that it represents a
duplication of the functional gene in which the deletion of GT has not
(yet) occurred, perhaps because this duplication is more recent from an
evolutionary standpoint. A second possibility is that it represents the
previously unidentified product of the reciprocal crossover of a DNA
fragment between the functional NCF-1 gene and one of its
pseudogenes. In an attempt to distinguish between these events, we
analyzed additional markers previously shown to discriminate between
the gene and its pseudogenes. These included the C/T transition in
intron 1; the 20-bp stretch in intron 2 that is duplicated in the
pseudogenes; and the single-nucleotide differences 269G>A, 496A>G,
558A>G, and 849A>G.9,15 We used an allele-specific
strategy that amplifies only GTGT-containing DNA (ie, NCF-1
and the Type II pseudogene) and sequenced the appropriate regions of
introns 1 and 2; we also sequenced exons 2 (to confirm the absence of
GT), 4, 6, and 9 in their entirety. As expected, in 9 unaffected controls with GT/GTGT ratios of 2:1, only
NCF-1 sequence was detected at all these positions. In
contrast, in the 2 control individuals with GT/GTGT ratios of 1:2,
both functional gene and pseudogene sequences were observed at each of
the markers except the C/T transition in intron 1 (where only C was
detected). These results demonstrate that the Type II pseudogene has
undergone multiple mutations identical to those seen in Type I and
suggest that it is unlikely to represent a newer duplication of
NCF-1.
Although it is not possible to conclusively distinguish between
the mechanisms by which the Type II pseudogene has arisen, based on our
analysis of these gene/pseudogene markers, we believe that it most
likely represents the product of a reciprocal crossover of a DNA
fragment between NCF-1 and one copy of NCF-1.
Figure 8 illustrates one possible
crossover mechanism. As a result of this crossover event, one
pseudogene acquires a GTGT-containing fragment from NCF-1
(shown in green) to generate a Type II pseudogene. Concurrently, the
previously functional NCF-1 acquires the GT mutation
originating in the corresponding fragment of pseudogene (shown in red),
thereby generating the common A47°CGD allele. In the 2 1:2 control
subjects studied, only functional gene sequence was observed at the C/T
transition in intron 1, suggesting that the 5' crossover site is
upstream of this position. This is consistent with previous reports
regarding the most common crossover sites within
NCF-1/NCF-1.7,9 Given the reported variation
in size of recombination fragments in A47° patients,7,9
it is likely that a similar heterogeneity will be seen in the size of
the NCF-1 fragment inserted to form the Type II pseudogene.
View larger version (26K):
[in this window]
[in a new window]
| Figure 8.
Model of a possible crossover mechanism giving rise to
the GTGT-containing NCF-1 and the prevalent A47°CGD
allele.
In the top part of the figure, 2 chromosomes, each of the more
common 2:1 extended haplotype, are misaligned. This event is probably
most likely to occur between chromatids during meiosis. Dashed lines
indicate possible sites of a double, reciprocal crossover event.
NCF-1 is shown in green and its pseudogenes in red. The
sequence at the start of exon 2 (GTGT or GT) is shown above each
gene, and the informative sequence differences (C/T in intron 1;
269G>A; 496A>G; 849A>G) are shown below (558A>G is omitted for the
sake of clarity). The presence of the single (NCF-1) or
duplicate (NCF-1) 20-bp stretch in intron 2 is indicated
by bands in the body of the gene. The products of the crossover are
shown in the bottom part of the figure, below the arrow. In the
uppermost of these chromosomes, NCF-1 has acquired a
pseudogene fragment containing GT, resulting in the prevalent
A47°CGD haplotype. One copy of NCF-1 on the lower
chromosome has acquired a GTGT-containing fragment from
NCF-1 to form the Type II pseudogene (1:2 haplotype). In
this model, the 3' crossover site is based on data from subject P, but
published data suggest that it is likely to vary. The exact position of
the 5' site is unknown, except that it is upstream of the C/T
transition in intron 1 (see "Results and discussion").
|
|
Besides the C/T transition, only one additional marker has been
described that is 5' of the start of exon 2 and distinguishes between
NCF-1 and its pseudogenes. Görlach et
al15 reported that all pseudogene clones analyzed
contained a single 30-bp stretch of sequence in intron 1 that was
present as a tandem duplication in the functional gene clones. We
analyzed this region in genomic DNA to determine whether it was a
potentially useful marker to identify the upstream site of
recombination. Using allele-specific PCR, we amplified and sequenced
the fragment from exon 1 to the start of exon 2 in 10 control
individuals (all with GT/GTGT ratios of 2:1) and confirmed in each
case that only GTGT-containing sequence was present. DNA from 5 persons
contained only the 30-bp duplication as expected, but 3 individuals
were heterozygous at this position and in 2 persons, both alleles
contained only a single copy of the 30-bp stretch. Therefore, it does
not reliably distinguish between gene and pseudogene and is not likely
to be a good marker to map crossover sites.
One advantage of our model is that it explains the intriguing
anomaly that although there is a pool within the population of
additional DNA fragments containing GT (in GT/GT patients and
carriers of the mutation), no corresponding fragment had been identified that contains GTGT. Because crossover events between NCF-1 and NCF-1 most commonly account for the
insertion of GT in NCF-17,9 and crossovers
are reciprocal in nature, it was puzzling that a GTGT-bearing fragment
had not been located in the genome. The Type II pseudogene identified
here appears to carry this missing fragment. Although the crossover
mechanism shown in Figure 8 would generate an equal number of CGD and
1:2 extended haplotypes, negative selection pressure would tend to remove the CGD haplotype from the population. This has apparently resulted in approximately a 50-fold excess within the population of the
1:2 haplotype (with an incidence of 1 in 10) compared with the CGD
haplotype (1 in 500).
Type II "pseudogene" may be functional
The 5' regulatory regions of the p47-phox
pseudogenes are almost identical to the equivalent region of the
functional gene, and the pseudogenes are known to be transcriptionally
active.15,19 With GT deleted at the start of exon 2, the
predicted translation product of the Type I pseudogene is 50 amino
acids in length, with only the first 25 being identical to the
corresponding region of p47-phox. This altered, truncated
polypeptide is unlikely to be functional and, to our knowledge, it has
never been detected. Of the other well-characterized differences that
distinguish between the gene and its pseudogenes, 2 are intronic and
unlikely to affect transcription and splicing, and those that are
exonic are single-nucleotide changes that are mostly silent. Only 2 predict amino acid substitutions, 269G>A and 496A>G predicting
Arg90His and Asn166Asp, respectively, and these changes may or may not
lead to a loss of function. Based on our relatively small sample, 17%
(9 of 53) of the healthy population has at least one copy of Type II
NCF-1. Sequencing of allele-specific RT-PCR products from
subject P revealed heterozygosity at the same exonic gene/pseudogene
markers as found in GTGT-containing genomic DNA, confirming that Type
II NCF-1 is transcribed. With a paucity of mutations
within the coding region, it is feasible that it produces intact
protein, but the analysis required to show this conclusively is beyond
the scope of this study.
In conclusion, we have provided evidence for the presence in the
general population of a previously undetected NCF-1
pseudogene/gene chimera. In contrast to the predominant A47°CGD
allele, which arises from the insertion of GT into NCF-1,
rendering it nonfunctional, this new fusion allele appears to represent
the insertion of a GTGT-bearing fragment into a nonfunctional
pseudogene. Whether the resulting gene is functional remains to be
determined, but in either case, it is likely to be innocuous because,
to date, we have found it only in combination with functional
NCF-1. However, the presence of at least 2 NCF-1/NCF-1 extended haplotypes in the population further
complicates the detection of GT carriers because approximately 1 in
10 will have GT/GTGT ratios of 2:1 and be indistinguishable from the
majority of unaffected individuals.
| |
Acknowledgments |
We are grateful to all family members who provided blood samples
for this study. This is manuscript 14865-MEM of The Scripps Research Institute.
| |
Footnotes |
Submitted March 9, 2002; accepted April 11, 2002.
Prepublished online
as Blood First Edition Paper, May 13, 2002; DOI
10.1182/blood-2002-03-0861.
Supported by grants CA68276 (P.G.H.), AI24838 (A.R.C.), and RR00833 (to
the General Clinical Research Center at The Scripps Research
Institute) from the National Institutes of Health; and by the
Stein Endowment Fund.
The publication costs of this
article were defrayed in part by
page charge payment. Therefore,
and solely to indicate this fact,
this article is hereby marked
"advertisement"
in accordance with 18 U.S.C.
section 1734.
Reprints: Paul G. Heyworth, MEM-241, Department of Molecular
and Experimental Medicine, The Scripps Research Institute, 10550 North
Torrey Pines Rd, La Jolla, CA 92037; e-mail: heyworth{at}scripps.edu.
| |
References |
1.
Roos D, Curnutte JT.
Chronic granulomatous disease. In:
Ochs HD,Smith CIE,Puck JM, eds.
Primary Immunodeficiency Diseases, a Molecular and Genetic Approach. New York, NY: Oxford University Press; 1999:353-374.
2.
Segal BH, Leto TL, Gallin JI, Malech HL, Holland SM.
Genetic, biochemical, and clinical features of chronic granulomatous disease.
Medicine (Baltimore).
2000;79:170-200[CrossRef][Medline]
[Order article via Infotrieve].
3.
Casimir CM, Bu-Ghanim HN, Rodaway ARF, Bentley DL, Rowe P, Segal AW.
Autosomal recessive chronic granulomatous disease caused by deletion at a dinucleotide repeat.
Proc Natl Acad Sci U S A.
1991;88:2753-2757[Abstract/Free Full Text].
4.
Volpp BD, Lin Y.
In vitro molecular reconstitution of the respiratory burst in B lymphoblasts from p47-phox-deficient chronic granulomatous disease.
J Clin Invest.
1993;91:201-207[Medline]
[Order article via Infotrieve].
5.
Iwata M, Nunoi H, Yamazaki H, et al.
Homologous dinucleotide (GT or TG) deletion in Japanese patients with chronic granulomatous disease with p47-phox deficiency.
Biochem Biophys Res Commun.
1994;199:1372-1377[CrossRef][Medline]
[Order article via Infotrieve].
6.
Roos D, De Boer M, Kuribayashi F, et al.
Mutations in the X-linked and autosomal recessive forms of chronic granulomatous disease.
Blood.
1996;87:1663-1681[Free Full Text].
7.
Roesler J, Curnutte JT, Rae J, et al.
Recombination events between the p47-phox gene and its highly homologous pseudogenes are the main cause of autosomal recessive chronic granulomatous disease.
Blood.
2000;95:2150-2156[Abstract/Free Full Text].
8.
Noack D, Rae J, Cross AR, et al.
Autosomal recessive chronic granulomatous disease caused by defects in NCF-1, the gene encoding the phagocyte p47-phox: mutations not arising in the NCF-1 pseudogenes.
Blood.
2001;97:305-311[Abstract/Free Full Text].
9.
Vázquez N, Lehrnbecher T, Chen R, et al.
Mutational analysis of patients with p47-phox-deficient chronic granulomatous disease: the significance of recombination events between the p47-phox gene (NCF1) and its highly homologous pseudogenes.
Exp Hematol.
2001;29:234-243[CrossRef][Medline]
[Order article via Infotrieve].
10.
Vihinen M, Arredondo-Vega FX, Casanova J-L, et al.
Primary immunodeficiency mutation databases. In:
Hall JC,Dunlap JC,Friedmann T,Giannelli F, eds.
Advances in Genetics. Vol 43. San Diego, CA: Academic Press; 2001:103-188.
11.
Cross AR, Noack D, Rae J, Curnutte JT, Heyworth PG.
Hematologically important mutations: the autosomal recessive forms of chronic granulomatous disease (first update).
Blood Cells Mol Dis.
2000;26:561-565[CrossRef][Medline]
[Order article via Infotrieve].
12.
Heyworth PG, Curnutte JT, Rae J, et al.
Hematologically important mutations: X-linked chronic granulomatous diseasesecond update.
Blood Cells Mol Dis.
2001;27:16-26[CrossRef][Medline]
[Order article via Infotrieve].
13.
Winkelstein JA, Marino MC, Johnston RB Jr, et al.
Chronic granulomatous diseasereport on a national registry of 368 patients.
Medicine (Baltimore).
2000;79:155-169[CrossRef][Medline]
[Order article via Infotrieve].
14.
Francke U, Hsieh C-L, Foellmer BE, Lomax KJ, Malech HL, Leto TL.
Genes for two autosomal recessive forms of chronic granulomatous disease assigned to 1q25 (NCF-2) and 7q11.23 (NCF-1).
Am J Hum Genet.
1990;47:483-492[Medline]
[Order article via Infotrieve].
15.
Görlach A, Lee PL, Roesler J, et al.
A p47-phox pseudogene carries the most common mutation causing p47-phox-deficient chronic granulomatous disease.
J Clin Invest.
1997;100:1907-1918[Medline]
[Order article via Infotrieve].
16.
Hockenhull EL, Carette MJ, Metcalfe K, Donnai D, Read AP, Tassabehji M.
A complete physical contig and partial transcript map of the Williams syndrome critical region.
Genomics.
1999;58:138-145[CrossRef][Medline]
[Order article via Infotrieve].
17.
DeSilva U, Massa H, Trask BJ, Green ED.
Comparative mapping of the region of human chromosome 7 deleted in Williams syndrome.
Genome Res.
1999;9:428-436[Abstract/Free Full Text].
18.
Osborne LR, Li M, Pober B, et al.
A 1.5 million-base pair inversion polymorphism in families with Williams-Beuren syndrome.
Nat Genet.
2001;29:321-325[CrossRef][Medline]
[Order article via Infotrieve].
19.
Chanock SJ, Roesler J, Zhan S, et al.
Genomic structure of the human p47-phox (NCF1) gene.
Blood Cells Mol Dis.
2000;26:37-46[CrossRef][Medline]
[Order article via Infotrieve].
20.
Ewart AK, Morris CA, Atkinson D, et al.
Hemizygosity at the elastin locus in a developmental disorder, Williams syndrome.
Nat Genet.
1993;5:11-16[CrossRef][Medline]
[Order article via Infotrieve].
21.
Dekker J, De Boer M, Roos D.
Gene-scan method for the recognition of carriers and patients with p47phox-deficient autosomal recessive chronic granulomatous disease.
Exp Hematol.
2001;29:1319-1325[CrossRef][Medline]
[Order article via Infotrieve].
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
Related Letter in Blood Online:
-
Association between p47phox pseudogenes and inflammatory bowel disease
- Marcus Harbord, Andrea Hankin, Stuart Bloom, and Hannah Mitchison
Blood 2003 101: 3337.
[Full Text]
[PDF]
This article has been cited by other articles:
|
|
|
|
 
M. Harbord, A. Hankin, S. Bloom, and H. Mitchison
Association between p47phox pseudogenes and inflammatory bowel disease
Blood,
April 15, 2003;
101(8):
3337 - 3337.
[Full Text]
[PDF]
|
|
|
|
|
Top
Abstract
Introduction