| |
|
|
|
|
|
|
|||
|
Prepublished online as a Blood First Edition Paper on May 13, 2002; DOI 10.1182/blood-2002-03-0706.
RED CELLS
From the Department of Biochemistry, University of
Bristol, and International Blood Group Reference Laboratory, Bristol,
United Kingdom; INSERM U473, INSERM, 94276 Le Kremlin-Bicêtre
Cedex, France; Department of Haematology, Imperial College School of
Medicine and Rayne Institute, University College London Medical School,
London, United Kingdom; Department of Integrative Medical Biology,
Histology and Cell Biology, Umeå University, Umeå, Sweden; and INSERM
U473 and Service d'Hématologie, d'Immunologie et de
Cytogénétique, Hôpital de Bicêtre, Assistance
Publique-Hôpitaux de Paris, Le Kremlin-Bicêtre, France.
We present data on a patient of South Asian origin with recessive
hereditary spherocytosis (HS) due to absence of protein 4.2 [4.2 ( Protein 4.2 (pallidin) is a major protein of the
red cell membrane.1,2 It is myristoylated at the
N-terminal glycine residue3 and is also
palmitoylated.4 The protein 4.2 gene, EPB42,
encompasses about 20 kb and contains 13 exons.5,6 Protein
4.2 binds, through its N-terminal region, to the N-terminal cytoplasmic
domain of the band 3 anion exchanger (AE1). This domain of band 3 links
the membrane to the underlying cytoskeleton via ankyrin. Band 3 is
known to associate with many other proteins, glycophorin A (GPA),
carbonic anhydrase, protein 4.1, various glycolytic enzymes, and
hemoglobin (for a recent review, see Tanner7), described
here as the band 3 complex. The presence of protein 4.2 in the red cell
membrane is completely dependent on the presence of band 3 and
reduction in the amount of band 3 causes a corresponding reduction in
protein 4.2.8 Very recently, protein 4.2 has also been
reported to interact with protein p55, which forms part of the
glycophorin C (GPC) complex (GPC, protein 4.1, p55).9
Total or almost total lack of protein 4.2 results in an atypical form
of hereditary spherocytosis [4.2 ( The existence of the Rh protein complex (Rh-associated glycoprotein, Rh
polypeptides, glycophorin B [GPB], CD47, LW) in red cell
membranes was suggested by the absence or deficiency of these proteins
in human red cells with the Rhnull phenotype (for
a review, see Cartron12). The Rh-associated glycoprotein
(RhAG, 45-75 kDa) is sequence-related to the Rh polypeptides (Rh, 30 kDa), but is N-glycosylated.13,14
CD47 (47-52 kDa, also referred to as integrin-associated protein
[IAP]),15-17 is a multispanning membrane protein with
broad tissue distribution (for a review, see Brown and
Frazier18), which is much reduced in Rhnull
red cells.19 CD47 associates with integrins in many cell
types, where it has a role in cell signaling and activation. However,
CD47 does not act by the same mechanism in mature red cells because red
cells lack integrins. Evidence indicates that CD47 may also have
integrin-independent functions in lymphocytes.20
Thrombospondin 1 is a major extracellular soluble ligand for CD47 and
thrombospondin increases the adhesiveness of sickle red cells under
shear stress conditions by a large G protein- and tyrosine
kinase-mediated mechanism.21 CD47 null mouse red cells
have a normal phenotype22 and contain normal amounts of
murine RhAG and Rh polypeptides.23 Recent work indicates that CD47 also acts as a marker of self on murine red cells because CD47 null mouse red cells are rapidly cleared from the circulation in
normal mice by splenic red pulp macrophages, whereas CD47 on normal
mouse red cells prevents this clearance by interacting with the
inhibitory signal regulatory protein Individuals with Rhnull syndrome have hemolytic anemia,
stomatocytosis, and spherocytosis,12 indicating the
presence of a cytoskeleton-associated defect in the red cells.
Biochemical evidence for an interaction of the Rh proteins with the red
cell cytoskeleton25,26 is consistent with this view, which
is further supported by recent micropipette aspiration
studies.27,28 However, the site(s) of linkage between the
cytoskeleton and the Rh complex has not been established.
In this paper we describe a study of the red cells of a patient
with protein 4.2 ( Case history
Morphologic examination of peripheral blood revealed atypia that
included ovalospherocytic and pincered red cells. Mean channel fluorescence intensity of red cells determined by flow cytometry after
labeling with eosin-5-maleimide29 was 41.6 U (reference range 53.9 ± 3.2 U), confirming the presence of HS.29
Additional studies including red cell adenosine triphosphate,
glycolytic intermediates, reduced glutathione and nucleotides, as well
as globin mass spectrometry and expression of
glycosylphosphatidylinositol-linked proteins proved normal. Red cell
glucose-6-phosphate dehydrogenase activity was elevated (16.3 IU/g
hemoglobin) consistent with reticulocytosis. In the face of
hyperbilirubinemia disproportionate to the degree of hemolysis, the
uridine diphosphate-glucuronosyltransferase 1A1 promoter genotype was
determined. The propositus was found to be homozygous for the
(TA)7 allele linked to Gilbert syndrome and increased risk
of cholelithiasis in HS.30 The appearance of the
gallbladder and biliary tract was normal on ultrasonography. Of the
parents, who are consanguineous, the mother exhibited no hematologic
abnormality. The father was not available for study. Informed consent
was sought and given in accordance with the Declaration of Helsinki for
the studies undertaken.
Red cell membrane protein analysis
Analysis of genomic DNA Genomic DNA was isolated from blood samples by using Isocode Stix (Schleicher and Schull, Dassel, Germany) or buffy coats. The coding regions, exons 2-20 of band 3 and 1-11 of CD47, were analyzed for single-stranded conformational polymorphisms (SSCPs) using exon-specific primers to band 339 and CD47 (cDNA) sequence15 compared to chromosome 3 (Human Genome Draft Sequence, National Center for Biotechnology Information). Exon 11 of protein 4.2 was sequenced in the ABI PRISM 310 Genetic Analyser Automatic Sequencer (Applied Biosystems, Warrington, United Kingdom) using exon-specific primers; forward primer: CCTGAGTCCTTTGTATTGTGT and reverse primer: GGGCCTGGATTCCTTCTGA.Analysis of reticulocyte cDNA Preparation of reticulocyte mRNA from the proband, mother, and healthy control was carried out as described.40 First-strand cDNA was prepared using the RETROscript kit (Ambion, Austin, TX). The entire coding regions of protein 4.2, band 3, and CD47 cDNA were sequenced, in both directions, either manually as described previously32 or automatically (as above) following reverse transcription-polymerase chain reaction (RT-PCR) from the mRNA. The deletion in the protein 4.2 cDNA was found through sequencing the RT-PCR product obtained using the forward and reverse primers GGATGCCCAGATCTCAGTGA and TGTAGCTCCTCTCTCTGTGA, respectively.Quantitative RT-PCR Quantitative (real-time) RT-PCR analysis was carried out using the SYBR Green kit and an ABI Prism 7700 Sequence Detector (Applied Biosystems). First-strand cDNA, (2.5% of a preparation from 4 µg total RNA) was used in a 40-cycle 2-step PCR. PCR cycle parameters were 50°C for 2 minutes, 95°C for 10 minutes, followed by 40 cycles at 95°C for 15 seconds and 58°C for 1 minute. The forward and reverse primers for the band 3 amplicon were ACGCTTCCTCTTTGTGTTGCT and TGTAGGCATCTATGCGGAACA, respectively, and for the protein 4.2 amplicon were TGACTGCATCCAGGCAGAGT and TCCACTTCTCTACCTGCTTGT, respectively. The number of target copies of each gene was interpolated from its detection threshold (CT) value using a control cDNA standard curve included on each plate. Each transcript was assayed 3 times and the median CT values were used for analysis.Cation transport studies Intracellular Na+ and K+ contents of red cells were measured within 1 hour of taking the blood, which was kept at 20°C. K+ influx was measured41 using 86Rb tracer in a solution containing (mM): Na, 145; K, 5; Cl, 150; MOPS (3[N-Morpholino]propanesulphonic acid; pH 7.4 at room temperature), 15; glucose, 5; and ouabain or bumetanide, 0.1, where appropriate.
Protein 4.2 and the band 3 complex in the proband red cells Western blotting and SDS-PAGE of the red cell membrane proteins of the proband showed that protein 4.2 was completely missing but the membranes contained normal amounts of band 3 and GPA, 2 other members of the band 3 complex (Table 2 and Figure 1). The trailing edge of the band 3 in the proband and mother migrated slightly more slowly than in the controls, suggesting it may be more highly glycosylated. Flow cytometric analysis of the red cells of the proband and mother (Table 3) showed normal binding of antiband 3 antibody (BRIC 6) and anti-GPA antibody (R10).
Mutations in band 3 could disrupt the protein 4.2 binding site and
cause protein 4.2 to be absent. We therefore sequenced the entire
coding region of the band 3 and protein 4.2 cDNAs from the reticulocyte
cDNA of the proband. No alterations were found in the band 3 cDNA, but
sequencing showed that the proband was homozygous for a deletion in the
protein 4.2 cDNA. We named this mutant, protein 4.2 Hammersmith. This
41-nucleotide (nt) frameshift deletion (nt 1709-1749; numbering
according to Sung et al2) removes the 5' region of exon 11 (Figure 2C) and introduces a stop codon
(TAG) as the ninth full codon of the frameshifted region following the
deletion (this overlaps codon 593 [AGA
The PCR of the region of protein 4.2 cDNA encompassing exon 11 (nt
1111-1797, numbering as above) produced a single band of 645 nucleotides from the proband and a single band of 686 nucleotides from the control sample (Figure
3). Unexpectedly, the mother gave only
the normal 686 nucleotide band. Sequence analysis of this region of
protein 4.2 cDNA from the mother was normal, indicating that the mother
had at least one normal protein 4.2 allele. Quantitative RT-PCR
analysis of reticulocyte RNA showed that the level of mutant protein
4.2 mRNA in the proband and the mother was 11% and 62%, respectively,
relative to the healthy control. However, the amount of band 3 mRNA in the proband and the mother was found to be 991% and
239%, respectively, of the control, reflecting the hemolytic anemia and reticulocytosis in the proband. When the amount of mutant
protein 4.2 mRNA was normalized to the amount of band 3 mRNA, the
mutant protein 4.2 mRNA in the proband was calculated to be at a level
of only 1.1% of the control, demonstrating that the deletion induced
instability in the mutant protein 4.2 mRNA. Consistent with
this conclusion, the total amount of protein 4.2 mRNA (normal plus
mutant) was also substantially reduced in the mother. The instability
of the mutant mRNA accounts for our inability to detect the PCR product
corresponding to it in the mother's DNA.
To ascertain the underlying cause of the protein 4.2 Hammersmith cDNA
deletion we sequenced the genomic DNA from the proband and the mother
using exon 11 specific primers (see "Patient, materials, and
methods"). We found that the proband was homozygous, and the mother
heterozygous, for a 1747G>T substitution (cDNA numbering according to
Sung et al2; Figure 4). This
mutation activates a cryptic acceptor splice site within exon 11, which
leads to the deletion product (Figure 4). The PCR experiment in Figure 3 showed that only the mRNA containing the deletion, resulting from
abnormal splicing, was detected in the proband. We were unable to
amplify any normally spliced mRNA product containing the 1747G>T substitution. If any of the mutant mRNA was correctly spliced the
1747G>T substitution would introduce a different premature stop codon
(GAG>TAG, Glu583
CD47 and the Rh complex Western blotting and SDS-PAGE analysis of the red cell membrane proteins showed that the proband had CD47 content massively reduced to only 1% of healthy controls, whereas the mother had 65% of healthy controls (Table 2 and Figure 1). Similar Western blotting results were obtained with 2 anti-CD47 antibodies reactive with different regions of the protein: a monoclonal antibody reactive with the N-terminal extracellular region and a polyclonal antipeptide antibody directed at the C-terminal sequence of CD47. The absence of CD47 from these 4.2 ( ) HS red cells prompted us to examine the CD47
gene in the proband. SSCP of the 11 CD47 exons, using genomic DNA, and
sequencing of the coding region of CD47 cDNA showed no mutations were
present in the CD47 of the proband.
Protein analysis by immunoblotting of the red cell membranes of the proband and mother showed that the RhAG and Rh polypeptides were present in normal amounts (Table 2 and Figure 1). However, RhAG in the membranes of both the proband and mother migrated slightly slower than normal on SDS-PAGE, and this slower migration was much more pronounced at the trailing edges of the RhAG bands (Figure 1). The RhAG bands of both proband and mother showed normal mobility after treatment with PNGase F, showing that the reduced mobility was due to an increase in size of the RhAG N-glycan in the proband and mother's red cells (data not shown). Immunoblotting also showed that the proband and mother had increased levels of LW antigens in comparison with the random red cell samples used as controls (Table 2 and Figure 1). The total amount of GPB was also reduced in the proband's red cells and this was reflected in the reduced dimer-to-monomer ratio in these cells (Table 2). Flow cytometric analysis with 2 different monoclonal anti-CD47 antibodies showed very much reduced reactivity with the proband's red cells and a less marked reduction in reactivity with the mother's red cells (Table 3). The proband's red cells also showed a reduction in reactivity with BRIC 69, a monoclonal antibody reactive with the Rh polypeptides, even though the immunoblotting studies suggest there are normal levels of Rh polypeptides in the membranes. A less significant reduction was observed in the mother's red cells. This probably results from the altered presentation or accessibility of the Rh epitope at the changed cell surface of the proband's and mother's red cells, most likely as a result of the altered glycosylation of RhAG. This altered glycosylation may also affect the binding of anti-RhAG antibody to the red cells of the mother (Table 3). These effects, together with the intrinsic nonlinearity of the fluorescence signals, interfere with quantitative analysis by flow cytometry, and the immunoblotting data (Table 2) more accurately reflect the amount of the proteins present in the red cell membranes. Protein p55 and the GPC complex Kuchay et al9 recently reported that an association exists between protein p55 and the C-terminal region of protein 4.2. We therefore investigated protein p55, GPC, and protein 4.1, which are all part of the GPC complex,42 by Western blotting of the mutant red cells. These 3 proteins were present at normal levels in the proband's red cells (Table 2).Cation transport studies Because protein 4.2 null mouse red cells show altered cation content and cation fluxes,11 we measured the cation content and potassium fluxes in the freshly drawn red cells of the proband and mother. Table 4 shows that these were all in the normal range, and, in particular, did not show the large changes in bumetanide-sensitive Na+-K+-2Cl cotransport observed
in the mouse protein 4.2 null red cells. The proband and mother did not
show any abnormality in the temperature dependence of ouabain plus
bumetanide resistant K+ influx (data not shown).
This new case of 4.2 ( The marked reduction of CD47 polypeptide in protein 4.2 Hammersmith red cell membranes suggests that, in human red cells, the presence of CD47 is dependent on its interaction with protein 4.2 in the membrane. No mutations were found in the coding region of the CD47 mRNA and no SSCP abnormality was found in the exons of the CD47 genomic DNA, so that it is reasonable to assume that the primary absence of protein 4.2 leads to the nearly total disappearance of CD47 in the proband's red cells. This assumption was strengthened by the very low level of CD47 found in 2 other cases of missing protein 4.246 due to different protein 4.2 mutations, each in the homozygous state and inducing premature stop codons.10,47 It is well known that the primary loss of a component of a complex can lead to the secondary lack, in varying degree, of one or more components of the complex. The relative abundance of the component(s) and the strength of their association with other sites are important determinants for their secondary disappearance. For example, in human red cell membranes the primary absence of protein 4.2 has no influence on the amount of band 3 present, whereas the primary absence of band 3 results in the complete loss of protein 4.2 and the reduction of other proteins.8 Our results also show that, although the C-terminal region of protein 4.2 is reported to interact with protein p55,9 the absence of protein 4.2 had no impact on the levels of p55, protein 4.1, or GPC. This suggests that the interaction between protein 4.2 and p55 may not be physiologically relevant in the red cell membrane and contrasts with the situation when GPC or protein 4.1 are missing, because protein p55 is then completely absent.42 Although the primary absence of protein 4.2 affects the level of red cell CD47, the primary absence of CD47 (which has not been described in humans) would be expected to have little effect on the level of protein 4.2. Consistent with this, CD47 null mouse red cell membranes retain normal levels of protein 4.2 (data not shown). Immunoblotting studies also showed that CD47 null mouse red cells have unaltered RhAG and Rh polypeptides (data not shown) confirming a previous abstract that this is the case.23 It is interesting that the protein 4.2 null condition has rather
different effects on human and mouse red cells. Although the red cells
of protein 4.2 null mice, like the human analogue, exhibit
spherocytosis, the mouse red cells have band 3 content reduced to 70%
of normal and altered cation content and activity of cation
transporters and channels.11 Most striking is the recent
report that protein 4.2 null mouse red cells have normal CD47
levels.46 In contrast the human protein 4.2 null red cells examined in this study have normal band 3, cation content,
Na+-K+-2Cl The other changes observed in the human protein 4.2 null cells are in
proteins associated with the Rh complex. The RhAG in the protein 4.2 null red cells had a lower mobility on SDS-PAGE as a result of an
increase in size of the N-glycan chain. RhAG carries N-glycan chains of
the erythroglycan type containing repeating N-acetyllactosamine
units.14 A similar reduction in RhAG mobility is observed
in human GPB null red cells and reflects an increase in the size of the
N-glycan chain because of a greater number of N-acetyllactosamine
repeats on the variant RhAG protein.14 This was attributed
to the absence of GPB causing a longer residence time of RhAG within
the late Golgi system during the biosynthesis of the Rh complex. The
lower mobility of RhAG on SDS-PAGE in the protein 4.2 null red cells
also reflects an increase in the size of the N-glycan chain arising
from perturbations in the biosynthesis of the Rh complex. The protein
4.2 null membranes also contain reduced amounts of GPB. Both these
effects most probably stem from the CD47 deficiency rather than the
absence of protein 4.2, because immunoblots of GPB null
(S Our evidence suggests that protein 4.2 associates with both the band 3 protein complex and the Rh complex, and comparison of the stoichiometry
of these complexes in red cell membranes is of interest. Protein 4.2 is
thought to be part of the band 3-cytoskeleton
linkage,51,52 and associates with both band 3 and
ankyrin.53 Although more than 106 copies of
band 3 are present in red cells, only a fraction of these
(4 × 105) are present in the ankyrin-associated band 3 tetramers that are linked to the cytoskeleton. The 105 band
3 tetramers complex with 105 ankyrin molecules and
105 protein 4.2 dimers and probably 2 × 105
GPA dimers.54 There are also 105 copies of the
Rh complex per red cell, which are comprised of heterotetramers of RhAG
and the Rh polypeptides associated with GPB dimers. All the Rh
complexes could associate with CD47 (2-5 × 104
copies/cell) if each CD47 associated with 2 RhAG/Rh core
heterotetramers, or up to half of the Rh complexes could be associated
with CD47 if the RhAG/Rh heterotetramers bound CD47 with a 1:1
stoichiometry. A small fraction (< 5%) of the Rh complexes associate
with the LW glycoprotein (2.8-4.4 × 103 copies/cell).
Other studies have suggested that the Rh and band 3 complexes interact
directly through a band 3-RhAG/Rh interaction. Coexpression of band 3 enhances the expression of Rh antigens at the surface of K562
erythroleukemic cells.33,34 The relatively minor effect of
the absence of protein 4.2 on RhAG and the Rh polypeptides, in contrast
to its major effect on CD47, is also consistent with alternative
interacting sites for RhAG/Rh. It is well known that GPA and GPB,
associated with the band 3 and Rh complexes, respectively, form
heterodimers on SDS-PAGE of erythrocyte membranes. Although it is not
proven that these glycophorins also heterodimerize in the intact red
cell membrane, interactions between these 2 proteins form an additional
potential contribution to associations between the 2 protein complexes.
From these observations we draw the tentative conclusion that in the
membrane the Rh complexes are associated with the subset of band 3 complexes that are tetrameric and associated with ankyrin and the
cytoskeleton, and these all form a macrocomplex (shown schematically in
Figure 5.) The interaction between the 2 complexes is maintained by protein 4.2-CD47 interactions, direct band
3-RhAG/Rh interactions and very likely also GPA-GPB interactions. The
present results explain earlier findings that indicate an association
of the Rh antigen complex with the red cell skeleton, and suggest this
association occurs by the multiple interactions between the Rh complex
and the tetrameric band 3 complexes, ultimately mediated by the band
3-ankyrin-protein 4.2 attachment to the spectrin cytoskeleton.
CD47 is present on early hematopoietic cells and remains expressed on cells throughout human erythropoeisis.19,55 RhAG and Rh are expressed before or around the time of band 3 expression, respectively.55 In contrast, protein 4.2 is expressed very late in erythroid maturation, after band 3 and protein 4.1, at a point suggested to be after the assembly of the cytoskeleton on the membrane.56 Our results show that normal protein 4.2 mRNA levels are much reduced in the reticulocytes of the proband's mother. Surprisingly, although the red cells of the proband's mother have a normal complement of protein 4.2, these cells have CD47 content reduced to about half normal and also show altered glycosylation of RhAG. Thus, there are protein 4.2 gene dosage effects on the amount of CD47 and the altered glycosylation of RhAG, but not on the level of protein 4.2 expressed in the mother's red cells. This can be explained if there was a short window during protein 4.2 mRNA expression and translation in which CD47-protein 4.2 associated with Rh complexes can be incorporated into the membrane, and the amount of incorporation during this time is rate-limited by the amount of protein 4.2 synthesized by the cells. This temporal window could be initiated by the start of protein 4.2 mRNA expression and terminated by the cessation of expression of either CD47 itself or any of the major components of the Rh complex (RhAG, Rh, or GPB). Continued expression of protein 4.2 mRNA after this period would allow protein 4.2 from the transcripts of just one protein 4.2 allele to accumulate further and saturate its binding sites on band 3. Murine CD47 null red cells, when transfused into normal mice, are
rapidly cleared from the circulation by splenic red pulp macrophages
due to the absence of inhibitory CD47-SIRP The absence of CD47 from protein 4.2 null red cells suggests a specific association exists between the 2 proteins in the red cell. We can infer from this that CD47 has a functional role in the mature red cell and is not simply a "leftover" that participated in earlier events during erythroid maturation. The nature of this function in red cells has not been established but we can speculate on possible roles of CD47 based on its activity in other cells. In nonerythroid cells CD47 acts to initiate intracellular signaling pathways as a result of interactions with other cells and with matrix components in both integrin-dependent and integrin-independent fashions.18 The interaction with protein 4.2 gives CD47 the potential to signal between the extracellular environment and the red cell skeleton and thus modulate the mechanical and other properties of the red cell. One situation during which this system may operate is during the passage of red cells through the microcapillary system, where red cells need to be readily deformable to enter and travel through the microcapillaries. Interactions of red cell CD47 with the capillary endothelial cells or matrix, perhaps mediated by a member of the thrombospondin gene family, may act to signal the changes in the cytoskeleton required to adapt the mechanical properties of the red cell to this environment, and perhaps also regulate the other functional and transport properties of the cell.
We thank Prof David Anstee for monoclonal antibodies, Joyce Poole for Rh phenotyping, and Dr Kirstin Finning for advice with real-time PCR. We thank David Roper, Brian Green, Margaret Chetty, and Dr Barbara Wild for biochemical studies and mass spectrometry, Alexis Proust for help with DNA sequencing, and Dr Susan Kelly for referring the patient.
Submitted March 6, 2001; accepted April 27, 2002.
Prepublished online as Blood First Edition Paper, May 13, 2002; DOI 10.1182/blood-2002-03-0706.
Supported in part by grants from the Wellcome Trust, the Indo-French Center for the Promotion of Advanced Research (IFCPAR Project 1903.1, New Delhi, India), the Institut National de la Santé et de la Recherche Médicale (Unité 473), the Institut National de la Santé et de la Recherche Médicale jointly with the Association Française contre les Myopathies ('Réseaux de Recherche sur les Maladies Rares', Project 4MR09F), the Assistance Publique-Hôpitaux de Paris, the Faculté de Médecine Paris-Sud, the Swedish Medical Research Council (31X-14286, 06P-14098), the Swedish Society of Medicine, and The Sir Jules Thorn Trust.
Correspondence: Michael J. A. Tanner, Department of Biochemistry, School of Medical Sciences, University of Bristol, Bristol, BS8 1TD, United Kingdom; e-mail: m.tanner{at}bristol.ac.uk.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Presented at the 43rd Annual Meeting of the American Society of Hematology, Orlando, FL, December 7-11, 2001, and abstract published in Blood. 2001;98:(suppl1):10a.
1.
Korsgren C, Lawler J, Lambert S, Speicher D, Cohen CM.
Complete amino acid sequence and homologies of human erythrocyte membrane protein band 4.2.
Proc Natl Acad Sci U S A.
1990;87:613-617
2.
Sung LA, Chien S, Chang LS, et al.
Molecular cloning of human protein 4.2: a major component of the erythrocyte membrane.
Proc Natl Acad Sci U S A.
1990;87:955-959
3.
Risinger MA, Dotimas EM, Cohen CM.
Human erythrocyte protein 4.2, a high copy number membrane protein, is N-myristylated.
J Biol Chem.
1992;267:5680-5685 4. Das AK, Bhattacharya R, Kundu M, Chakrabarti P, Basu J. Human erythrocyte membrane protein 4.2 is palmitoylated. Eur J Biochem. 1994;224:575-580[Medline] [Order article via Infotrieve].
5.
Sung LA, Chien S, Fan YS, et al.
Human erythrocyte protein 4.2: isoform expression, differential splicing, and chromosomal assignment.
Blood.
1992;79:2763-2770
6.
Korsgren C, Cohen CM.
Organization of the gene for human erythrocyte membrane protein 4.2: structural similarities with the gene for the a subunit of factor XIII.
Proc Natl Acad Sci U S A.
1991;88:4840-4844 7. Tanner MJA. Band 3 anion exchanger and its involvement in erythrocyte and kidney disorders. Curr Opin Hematol. 2002;9:133-139[CrossRef][Medline] [Order article via Infotrieve].
8.
Ribeiro L, Alloisio N, Almeida H, et al.
Near lethal hereditary spherocytosis and distal tubular acidosis associated with the total absence of band 3.
Blood.
2000;96:1602-1604 9. Kuchay SM, Azam M, Chishti AH. The guanylate kinase-like domain of human erythrocyte membrane p55 interacts with the carboxyl-terminus of protein 4.2 [abstract]. Blood. 2001;98:9a.
10.
Beauchamp-Nicoud A, Morlé L, Lutz HU, et al.
Heavy transfusions and presence of an anti-protein 4.2 antibody in 4.2 ( 11. Peters LL, Jindel HK, Gwynn B, et al. Mild spherocytosis and altered red cell ion transport in protein 4.2-null mice. J Clin Invest. 1999;103:1527-1537[Medline] [Order article via Infotrieve]. 12. Cartron JP. RH blood group system and molecular basis of Rh-deficiency. Baillières Best Pract Res Clin Haematol. 1999;12:655-689[Medline] [Order article via Infotrieve]. 13. Ridgwell K, Spurr NK, Laguda B, MacGeoch C, Avent ND, Tanner MJA. Isolation of cDNA clones for a 50 kDa glycoprotein of the human erythrocyte membrane associated with Rh (rhesus) blood-group antigen expression. Biochem J. 1992;287:223-228.
14.
Ridgwell K, Eyers SA, Mawby WJ, Anstee DJ, Tanner MJA.
Studies on the glycoprotein associated with Rh (rhesus) blood group antigen expression in the human red blood cell membrane.
J Biol Chem.
1994;269:6410-6416
15.
Campbell IG, Freemont PS, Foulkes W, Trowsdale J.
An ovarian tumor marker with homology to vaccinia virus contains an IgV-like region and multiple transmembrane domains.
Cancer Res.
1992;52:5416-5420 16. Mawby WJ, Holmes CH, Anstee DJ, Spring FA, Tanner MJA. Isolation and characterization of CD47 glycoprotein: a multispanning membrane protein which is the same as integrin-associated protein (IAP) and the ovarian tumour marker OA3. Biochem J. 1994;304:525-530.
17.
Lindberg FP, Lublin DM, Telen MJ, et al.
Rh-related antigen CD47 is the signal transducer integrin-associated protein.
J Biol Chem.
1994;269:1567-1570 18. Brown EG, Frazier WA. Integrin-associated protein and its ligands. Trends Cell Biol. 2001;11:130-135[CrossRef][Medline] [Order article via Infotrieve]. 19. Avent N, Judson PA, Parsons SF, et al. Monoclonal antibodies that recognize different membrane proteins that are deficient in Rhnull human erythrocytes. Biochem J. 1988;251:499-505[Medline] [Order article via Infotrieve]. 20. Brown E. Integrin-associated protein (CD47): an unusual activator of G protein signaling. J Clin Invest. 2001;107:1499-1500[Medline] [Order article via Infotrieve]. 21. Brittain JE, Mlinar KJ, Anderson CS, Orringer EP, Parise LV. Activation of sickle red blood cell adhesion via integrin-associated protein/CD47-induced signal transduction. J Clin Invest. 2001;107:1555-1562[Medline] [Order article via Infotrieve].
22.
Lindberg FP, Bullard DC, Caver TE, Gresham HD, Beaudet AL, Brown EJ.
Decreased resistance to bacterial infection and granulocyte defects in IAP-deficient mice.
Science.
1996;274:795-798 23. Mouro-Chanteloup I, Johansen M, Brown EJ, Cartron JP, Colin Y. Normal red cell membrane expression of Rh and RhAG polypeptides in CD47-deficient mice [abstract]. Vox Sang. 2000;78:P030.
24.
Oldenberg P-A, Zheleznyak A, Fang Y-F, Lagenaur CF, Gresham HD, Lindberg FP.
Role of CD47 as a marker of self on red blood cells.
Science.
2000;288:2051-2054 25. Gahmberg CG, Karhi KK. Association of the Rh(D) polypeptides with the membrane skeleton in Rh(D) positive red cells. J Immunol. 1984;133:334-337[Abstract]. 26. Ridgwell K, Tanner MJA, Anstee DJ. The Rhesus D polypeptide is linked to human erythrocyte cytoskeleton. FEBS Lett. 1984;174:7-10[CrossRef][Medline] [Order article via Infotrieve]. 27. Gimm A, Mouro I, Lambin P, Mohandas N, Cartron JP. Direct evidence for in situ interaction between RH complex and membrane skeleton in intact red cells [abstract]. Vox Sang. 2000;78:0014. 28. Dahl KN, Westoff C, Discher DE. Attachment of CD47 (IAP) to the erythrocyte cytoskeleton and visual colocalisation with the Rh complex [abstract]. Mol Biol Cell. 2001;12:205a. 29. King MJ, Behrens J, Rogers C, Flynn C, Greenwood D, Chambers K. Rapid flow cytometric test for the diagnosis of membrane cytoskeleton-associated haemolytic anaemia. Br J Haematol. 2000;111:924-933[CrossRef][Medline] [Order article via Infotrieve].
30.
del Giudice EM, Perrotta S, Nobili B, Specchia C, d'Urzo G, Iolascon A.
Coinheritance of Gilbert syndrome increases the risk of developing gallstones in patients with hereditary spherocytosis.
Blood.
1999;94:2259-2262 31. Wainwright SD, Tanner MJA, Martin GEM, Yendle JE, Holmes C. Monoclonal antibodies to the membrane domain of the human erythrocyte anion transport protein. Biochem J. 1989;258:211-220[Medline] [Order article via Infotrieve]. 32. Bruce LJ, Cope DL, Jones GK, et al. Familial renal tubular acidosis is associated with mutations in the red cell anion exchanger (band 3, AE1) gene. J Clin Invest. 1997;100:1693-1707[Medline] [Order article via Infotrieve].
33.
Beckmann R, Smythe JS, Anstee DJ, Tanner MJA.
Functional cell surface expression of band 3, the human red blood cell anion exchanger protein (AE1), in K562 erythroleukemia cells: band 3 enhances the cell surface reactivity of Rh antigens.
Blood.
1998;92:4428-4438
34.
Beckmann R, Smythe JS, Anstee DJ, Tanner MJA.
Coexpression of band 3 mutants and Rh polypeptides: differential effects of band 3 on the expression of the Rh complex containing D polypeptide and the Rh complex containing CcEe polypeptide.
Blood.
2001;97:2496-2505
35.
Avent ND, Butcher SK, Liu W, et al.
Localisation of the C-termini of the Rh (Rhesus) polypeptides to the cytoplasmic face of the human erythrocyte membrane.
J Biol Chem.
1992;267:15134-15139
36.
Hemming NJ, Ansteee DJ, Staricoff MA, Tanner MJA, Mohandas N.
Identification of the membrane attachment site for protein 4.1 in the human erythrocyte.
J Biol Chem.
1995;270:5360-5366 37. Hayette S, Morlé L, Bozon M, et al. A point mutation in the protein 4.2 gene (allele 4.2 Tozeur) associated with hereditary haemolytic anaemia. Br J Haematol. 1995;89:762-770[Medline] [Order article via Infotrieve]. 38. Langlois RG, Bigbee WL, Jenson RH. Flow cytometric characterization of normal and variant red cells with monoclonal antibodies specific for glycophorin A. J Immunol. 1985;134:4009-4017[Abstract].
39.
Schofield AE, Martin PG, Spillet D, Tanner MJA.
The structure of the human red blood cell anion exchanger (EPB3, AE1, band 3) gene.
Blood.
1994;84:2000-2012
40.
Temple GF, Chang JC, Kan YW.
Authentic 41. Coles SE, Ho MM, Chetty MC, Nicolaou A, Stewart GW. Hereditary stomatocytosis with marked pseudohyperkalaemia. Br J Haematol. 1999;104:275-283[CrossRef][Medline] [Order article via Infotrieve].
42.
Alloisio N, Dalla Venezia N, Rana A, et al.
Evidence that red blood cell protein p55 may participate in the skeleton-membrane linkage that involves protein 4.1 and glycophorin C.
Blood.
1993;82:1323-1327 43. Delaunay J, Toye AM, Ghosh S, et al. Protein 4.2 enhances band 3-induced anion transport in Xenopus oocytes: effects of several natural protein 4.2 mutations [abstract]. Blood. 2001;98:9a. 44. Benz EJ Jr, Forget BG, Hillman DG, et al. Variability in the amount of beta-globin mRNA in beta0 thalassemia. Cell. 1978;14:299-312[CrossRef][Medline] [Order article via Infotrieve]. 45. Maquat LE. When cells stop making sense: effects of nonsense codons on RNA metabolism in vertebrate cells. RNA. 1995;5:453-465. 46. Colin Y, Mouro-Chanteloup I, Peters L, et al. Analysis of protein 4.2 deficient red cells suggests an interaction between the Rh complex members CD47 and RhCcEe and the skeletal protein 4.2 [abstract]. Blood. 2001;98:10a.
47.
Hayette S, Dhermy D, dos Santos ME, et al.
A deletional frameshift mutation in protein 4.2 gene (allele 4.2 Lisboa) associated with hereditary hemolytic anemia.
Blood.
1995;85:250-256
48.
Armsby CC, Brugnara C, Alper SL.
Cation transport in mouse erythrocytes: role of K(+)-Cl-cotransport in regulatory volume decrease.
Am J Physiol.
1995;268:C894-C902 49. Coles S, Stewart G. Temperature effects on cation transport across the red cell membrane in the hereditary stomatocytosis syndromes. Int J Exp Pathol. 1999;80:251-258[CrossRef][Medline] [Order article via Infotrieve]. 50. Mallinson G, Martin PG, Anstee DJ, et al. Identification and partial characterization of the human erythrocyte membrane component(s) that express the antigens of the LW blood group system. Biochem J. 1986;234:649-652[Medline] [Order article via Infotrieve].
51.
Rybicki AC, Schwartz RS, Hustedt EJ, Cobb CE.
Increased rotational mobility and extractability of band 3 from protein 4.2-deficient erythrocyte membranes: evidence for a role for protein 4.2 in strengthening the band 3-cytoskeleton linkage.
Blood.
1996;88:2745-2753 52. Golan DE, Corbett JD, Korsgren C, et al. Control of band 3 lateral and rotational mobility by band 4.2 in intact erythrocytes: release of band 3 oligomers from low affinity binding sites. Biophys J. 1996;70:1534-1542[Medline] [Order article via Infotrieve].
53.
Korsgren C, Cohen CM.
Associations of human erythrocyte protein 4.2: binding to ankyrin and the cytoplasmic domain of band 3.
J Biol Chem.
1988;263:10212-10218 54. Lux SE, Palek J. Disorders of the red cell membrane. In: Handin RI,Lux SE,Stossel TP, eds. Blood Principles and Practice of Hematology. Philadelphia, PA: Lippincott; 1995:1701-1818.
55.
Southcott MJG, Tanner MJA, Anstee DJ.
The expression of human blood group antigens during erythropoiesis in a cell culture system.
Blood.
1999;93:4425-4435 56. Wada H, Kanzaki A, Yawata A, et al. Late expression of red cell membrane protein 4.2 in normal human erythroid maturation with seven isoforms of the protein 4.2 gene. Exp Hematol. 1999;27:54-62[CrossRef][Medline] [Order article via Infotrieve].
© 2002 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
C. Korsgren, L. L. Peters, and S. E. Lux Protein 4.2 Binds to the Carboxyl-terminal EF-hands of Erythroid {alpha}-Spectrin in a Calcium- and Calmodulin-dependent Manner J. Biol. Chem., February 12, 2010; 285(7): 4757 - 4770. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. P. Jeremy, Z. E. Plummer, D. J. Head, T. E. Madgett, K. L. Sanders, A. Wallington, J. R. Storry, F. Gilsanz, J. Delaunay, and N. D. Avent 4.1R-deficient human red blood cells have altered phosphatidylserine exposure pathways and are deficient in CD44 and CD47 glycoproteins Haematologica, October 1, 2009; 94(10): 1354 - 1361. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. A. Anong, T. Franco, H. Chu, T. L. Weis, E. E. Devlin, D. M. Bodine, X. An, N. Mohandas, and P. S. Low Adducin forms a bridge between the erythrocyte membrane and its cytoskeleton and regulates membrane cohesion Blood, August 27, 2009; 114(9): 1904 - 1912. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Iismaa, B. M. Mearns, L. Lorand, and R. M. Graham Transglutaminases and Disease: Lessons From Genetically Engineered Mouse Models and Inherited Disorders Physiol Rev, July 1, 2009; 89(3): 991 - 1023. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. C. Kodippili, J. Spector, C. Sullivan, F. A. Kuypers, R. Labotka, P. G. Gallagher, K. Ritchie, and P. S. Low Imaging of the diffusion of single band 3 molecules on normal and mutant erythrocytes Blood, June 11, 2009; 113(24): 6237 - 6245. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Stefanovic, N. O. Markham, E. M. Parry, L. J. Garrett-Beal, A. P. Cline, P. G. Gallagher, P. S. Low, and D. M. Bodine An 11-amino acid beta-hairpin loop in the cytoplasmic domain of band 3 is responsible for ankyrin binding in mouse erythrocytes PNAS, August 28, 2007; 104(35): 13972 - 13977. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Perrotta, A. Borriello, A. Scaloni, L. De Franceschi, A. M. Brunati, F. Turrini, V. Nigro, E. Miraglia del Giudice, B. Nobili, M. L. Conte, et al. The N-terminal 11 amino acids of human erythrocyte band 3 are critical for aldolase binding and protein phosphorylation: implications for band 3 function Blood, December 15, 2005; 106(13): 4359 - 4366. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kralovicova, M. B. Christensen, and I. Vorechovsky Biased exon/intron distribution of cryptic and de novo 3' splice sites Nucleic Acids Res., September 1, 2005; 33(15): 4882 - 4898. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. S. Bowman, J. D. Morrow, D. J. Jollow, and D. C. McMillan Primaquine-Induced Hemolytic Anemia: Role of Membrane Lipid Peroxidation and Cytoskeletal Protein Alterations in the Hemotoxicity of 5-Hydroxyprimaquine J. Pharmacol. Exp. Ther., August 1, 2005; 314(2): 838 - 845. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Toye, S. Ghosh, M. T. Young, G. K. Jones, R. B. Sessions, M. Ramauge, P. Leclerc, J. Basu, J. Delaunay, and M. J. A. Tanner Protein-4.2 association with band 3 (AE1, SLCA4) in Xenopus oocytes: effects of three natural protein-4.2 mutations associated with hemolytic anemia Blood, May 15, 2005; 105(10): 4088 - 4095. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Ripoche, O. Bertrand, P. Gane, C. Birkenmeier, Y. Colin, and J.-P. Cartron Human Rhesus-associated glycoprotein mediates facilitated transport of NH3 into red blood cells PNAS, December 7, 2004; 101(49): 17222 - 17227. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. J. Prud'homme Altering immune tolerance therapeutically: the power of negative thinking J. Leukoc. Biol., April 1, 2004; 75(4): 586 - 599. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Lahlil, E. Lecuyer, S. Herblot, and T. Hoang SCL Assembles a Multifactorial Complex That Determines Glycophorin A Expression Mol. Cell. Biol., February 15, 2004; 24(4): 1439 - 1452. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. N. Dahl, R. Parthasarathy, C. M. Westhoff, D. M. Layton, and D. E. Discher Protein 4.2 is critical to CD47-membrane skeleton attachment in human red cells Blood, February 1, 2004; 103(3): 1131 - 1136. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. K. Dahl, L. Jiang, M. N. Chernova, A. K. Stuart-Tilley, B. E. Shmukler, and S. L. Alper Deficient HCO3- Transport in an AE1 Mutant with Normal Cl- Transport Can be Rescued by Carbonic Anhydrase II Presented on an Adjacent AE1 Protomer J. Biol. Chem., November 7, 2003; 278(45): 44949 - 44958. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Nicolas, C. Le Van Kim, P. Gane, C. Birkenmeier, J.-P. Cartron, Y. Colin, and I. Mouro-Chanteloup Rh-RhAG/Ankyrin-R, a New Interaction Site between the Membrane Bilayer and the Red Cell Skeleton, Is Impaired by Rhnull-associated Mutation J. Biol. Chem., July 3, 2003; 278(28): 25526 - 25533. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. J. Bruce, R. Beckmann, M. L. Ribeiro, L. L. Peters, J. A. Chasis, J. Delaunay, N. Mohandas, D. J. Anstee, and M. J.A. Tanner A band 3-based macrocomplex of integral and peripheral proteins in the RBC membrane Blood, May 15, 2003; 101(10): 4180 - 4188. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2002 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||