|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
IMMUNOBIOLOGY
From the Department of Immunology, Erasmus MC,
University Medical Center Rotterdam, Rotterdam, The Netherlands;
Department of Pediatrics, Division of Immunology and Infectious
Diseases, Erasmus MC, University Medical Center Rotterdam, Rotterdam,
The Netherlands; Department of Cell Biology and Genetics, Erasmus MC,
University Medical Center Rotterdam, Rotterdam, The Netherlands;
Department of Pediatrics, Leiden University Medical Center, Leiden, The
Netherlands; and Department of Immunology, The Children's Memorial
Health Institute, Warsaw, Poland.
The protein products of the recombination activating genes
(RAG1 and RAG2) initiate the formation of
immunoglobulin (Ig) and T-cell receptors, which are essential for B-
and T-cell development, respectively. Mutations in the RAG
genes result in severe combined immunodeficiency disease (SCID),
generally characterized by the absence of mature B and T lymphocytes,
but presence of natural killer (NK) cells. Biochemically, mutations in
the RAG genes result either in nonfunctional proteins or in
proteins with partial recombination activity. The mutated RAG
genes of 9 patients from 7 families were analyzed for their
recombination activity using extrachromosomal recombination substrates,
rearrangement of endogenous Ig loci in RAG
gene-transfected nonlymphoid cells, or the presence of Ig gene
rearrangements in bone marrow (BM). Recombination activity was
virtually absent in all 6 patients with mutations in the RAG core
domains, but partial activity was present in the other 3 RAG-deficient
patients, 2 of them having Omenn syndrome with oligoclonal T
lymphocytes. Using 4-color flow cytometry, we could define the exact
stage at which B-cell differentiation was arrested in the BM of 5 RAG-deficient SCID patients. In 4 of 5 patients, the absence of
recombination activity was associated with a complete B-cell differentiation arrest at the transition from cytoplasmic (Cy) Igµ Human severe combined immunodeficiency disease
(SCID) refers to a group of disorders, which can be classified based on
the pattern of inheritance and the immunologic phenotype.1
One type of SCID is characterized by autosomal recessive inheritance, absence of T and B lymphocytes in peripheral blood (PB), but presence of natural killer (NK) cells (non-T non-B SCID). A number of patients suffering from non-T non-B SCID carry mutations in the recombination activating genes (RAG) 1 or 2.2 The 2 human
RAG genes are located in a tail-to-tail orientation on
chromosome 11p13 and are expressed during T- and B-cell development in
the thymus and bone marrow (BM), respectively.3-7 The RAG
proteins are essential to initiate recombination of immunoglobulin (Ig)
and T-cell receptor (TCR) loci.8-10 They introduce
double-strand breaks at the recombination signal sequences (RSSs)
flanking the variable (V), diversity (D), and joining (J) gene
segments, which are then joined to form a V(D)J exon encoding
the antigen-binding part of Ig and TCR molecules.11,12
The RAG1 and RAG2 proteins both contain a core domain, which is
essential for recombination activity.13-16 Although the
N-terminus of RAG1 and the C-terminus of RAG2 seem to be dispensable
for recombination activity, it has been shown that they might be
specifically required for Ig gene recombination.17-21 Most
mutations in the RAG genes causing non-T non-B SCID affect
the core domain and encode nonfunctional proteins ("null"
alleles).2 On the other hand, some RAG
mutations in the core domain are associated with partial VDJ
recombination activity, causing a variant of non-T non-B SCID, called
Omenn syndrome (OS).22 OS is characterized by oligoclonal,
autoreactive T cells with a T-helper 2 phenotype, absence of B
lymphocytes, but high serum IgE levels. The clinical phenotype of OS
resembles the clinical phenotype resulting from maternal-fetal T-cell
engraftment (MFT) in a newborn with non-T non-B SCID.
The absence of T or B lymphocytes (or both) in the PB of patients
suffering from RAG-deficient SCID results from a differentiation arrest
during T- and B-cell development in the thymus and BM, respectively.
The localization of this differentiation arrest has been defined in
murine thymus and BM.23,24 However, no such data are
available in humans. From a theoretical viewpoint, one would expect
that RAG-deficient SCID patients have a complete B-cell differentiation
arrest at the transition from cytoplasmic (Cy) Igµ Cell samples
The BM samples from the 7 SCID patients were subjected to Ficoll-Paque
(density: 1.077 g/mL; Pharmacia, Uppsala, Sweden) density centrifugation. The recovered mononuclear cells (MCs) were frozen and
stored in liquid nitrogen and thawed later for flow cytometric immunophenotyping studies. Granulocytes were used for DNA
extraction.27
We have previously reported on an extensive study concerning the
composition of the precursor B-cell compartment in the BM of 18 healthy
children using triple labelings.28 We repeated our flow
cytometric analyses using quadruple labelings in thawed BM samples from
6 of these healthy children (age range, 1 year 7 months to 5 years 11 months; mean age, 3 years 10 months; 4 boys, 2 girls), who were BM
donors for their siblings.
All cell samples were obtained according to the informed consent
guidelines of the Medical Ethics Committees of the Leiden University
Medical Center and the University Hospital Rotterdam.
DNA extraction, PCR amplification, and analysis of Ig gene
rearrangements
LR-PCR for amplification of RAG genes The entire RAG1 or RAG2 gene was amplified in a single long-range (LR)-PCR reaction (100 µL), using 4 U rTth DNA polymerase XL (Applied Biosystems) for subsequent sequencing analysis of the LR-PCR product or 5 U Pfu enzyme mix (Stratagene, La Jolla, CA) for cloning the LR-PCR product; we used 30 or 14 pmol oligonucleotides, respectively. The sequences of the oligonucleotides used for the LR-PCR were TGAGGCTAATACAATGTGGAA (RAG1 forward), ACAACCTTGGCTTTGATTTAC (RAG1 reverse), TTCGGCTAGTCTTTATTCAC (RAG2 forward), and CTTTGGCACATCATTCA (RAG2 reverse), respectively. Restriction-sites for BamHI and NotI were incorporated into the 5' and 3' oligonucleotides used for cloning, respectively. LR-PCR conditions were 2 minutes, 94°C, followed by 15 seconds, 94°C, 30 seconds, 57°C, and 4 minutes, 68°C for 40 cycles using 10-second autoextension from cycle 21 onward. In case of cloning, the LR-PCR conditions were 45 seconds, 94°C, followed by 45 seconds, 94°C, 45 seconds, 62°C, and 3.5 to 6.5 minutes, 72°C for 30 to 35 cycles using 10-sec autoextension from cycle 21 onward. After the last cycle final extension was performed for 10 minutes at 72°C.Fluorescent sequencing reaction and analysis The LR-PCR products of RAG1 and RAG2 were purified using QIAquick PCR purification kit (Qiagen). Five to 9 µL purified PCR product was sequenced with 5 µL dRhodamine dye terminator mix (Applied Biosystems), using 3.3 pmol internal sequencing primers. All sequencing was performed as described before,32 using an ABI Prism 377 fluorescent sequencer (Applied Biosystems).Cloning of mutated and wild-type RAG genes The LR-PCR products containing the entire RAG1 or RAG2 open reading frame were isolated after digestion with BamHI and NotI and cloned into the BamHI-NotI cut vector pEBB under control of the EF-1 promoter.18 The cloned wild-type and mutated RAG genes were sequenced to exclude the presence of PCR-induced mutations.V(D)J recombination assay using an extrachromosomal recombination substrate Two micrograms pEBB-RAG1 (mutated or wild type) together with 2 µg pEBB-RAG2 (mutated or wild type) and 1 µg of the extrachromosomal recombination substrate (pDVG93) were transfected into Chinese hamster ovary (CHO9) cells using SuperFect Transfection Reagent (Qiagen). Transfected cells were cultured for 2 days before harvesting. Plasmid pDVG93 contains 2 RSS elements with the same orientation. On V(D)J recombination, the sequence in between the 2 RSS elements is inverted, which can be detected by PCR.20 Nontransfected pDVG93 plasmids can be discriminated from transfected plasmids based on digestion of DpnI restriction sites, which become resistant on demethylation after transfection.A real-time quantitative (RQ)-PCR assay was developed to quantify the
recombination activity. For this purpose, we designed primers DG89 and
DG147 and TaqMan probe FM23 for quantitative detection of inversional
rearrangements as well as a set of control primers and TaqMan probe for
quantitative detection of all transfected pDVG93 plasmids with multiple
DpnI restriction sites between the primers.20
DNA recovered from the transfection experiments was DpnI
digested to remove nontransfected plasmids, added to the TaqMan
universal PCR master mix (Applied Biosystems), and equally divided over
4 tubes, 2 tubes for specific amplification and 2 for control
amplification. RQ-PCR was performed as described before using an ABI
Prism 7700 (Applied Biosystems).36 The PCR cycle at which
a fluorescent signal became detectable (threshold cycle or
CT) was comparable in the duplicate tubes
( Transfection of wild-type RAG genes was used as a positive
control for recombination activity. Using these RQ-PCR results, standard curves for the specific and the control amplification were
generated. All standard curves met the following requirements: slopes
between Analysis of V(D)J recombination of endogenous Ig loci following
transfection of cloned RAG genes in combination with E47 in
 hAP-E47 (under control of the human -actin promoter) were
transfected into confluent  NX-WTA human kidney epithelial cells
using the calcium-phosphate method.37 Transfected cells
were cultured for 3 days before harvesting. DNA was isolated and
analyzed for rearrangement of endogenous loci, such as
DH4-JH, V 1-J, and
V 3-J1/2/3. These rearrangements were
earlier shown to be specifically induced on transfection of E47 and
RAG1 and RAG2.37
Flow cytometric analysis of BM samples from healthy children and SCID patients Fifty-microliter aliquots of thawed BMMCs (10 × 106 cells/mL) were incubated for 10 minutes at room temperature with combinations of optimally titrated monoclonal antibody (mAb): 50 µL fluorescein isothiocyanate (FITC)-conjugated mAb, 50 µL phycoerythrin (PE)-conjugated mAb, 50 µL peridinin chlorophyl protein-cyanin 5.5 (PerCP-Cy5.5)-conjugated mAb, and 50 µL allophycocyanin (APC)-conjugated mAb were used to detect membrane-bound antigens. After incubation, the cells were washed and further processed depending on the type of quadruple labeling. The 14 applied quadruple labelings are summarized on a Web page (http://www.eur.nl/fgg/immu/tables/Table1.htm).Quadruple labelings for membrane-bound antigens (labelings 1-7) were directly analyzed by flow cytometry using FACSCalibur (Becton Dickinson, San Jose, CA). For quadruple labelings involving intracellular staining of Cy CD79a, CyIgµ, and CyVpreB,38 and intranuclear staining of terminal deoxynucleotidyl transferase (TdT) (labelings 8-14), we first performed the membrane labelings, followed by permeabilization of the BM cells using IntraPrep Permeabilization Reagent (Immunotech, Marseille, France), and subsequent intracellular staining.39,40
Patient characteristics and mutations in the RAG genes Based on clinical characteristics and immunophenotyping results of PB, 9 patients from 7 families were diagnosed as having B cell-negative SCID (Table 1). SCID-1 was studied extensively and published before.20 MFT in patients diagnosed with OS (SCID-1 and SCID-5) was excluded by HLA typing and by detection of a homozygous RAG gene mutation in PBMC DNA.
We detected mutations in the RAG1 or RAG2 genes in all 9 B cell-negative SCID patients (Table 1). The RAG1 genes contained 4 different mutations, including one novel. Two of the 4 mutations (Arg249His and Lys820Arg) represented polymorphisms. The Arg249His mutation has been shown to be a functionally intact polymorphism by recombination activity studies,2 whereas the Lys820Arg mutation was interpreted as a polymorphism based on its allelic frequency.41 In this study, we show that the Lys820Arg mutation indeed retained intact recombination activity (see below). The other 2 RAG1 mutations (codon 199 stop in SCID-1 and Arg404Gln in SCID-7), were shown by recombination activity studies (see below) to have a disease-causing effect. We detected 4 different mutations in the RAG2 genes, including 3 novel mutations (Table 1). The disease-causing effect of the 3 novel mutations (codon 247 stop in SCID-2 and SCID-4, His481Pro in SCID-3, and Gln16 stop in SCID-6) was shown by recombination activity studies (see below). It has been shown before that the Trp453Arg mutation in SCID-5 retained partial RSS nicking and hairpin formation function, as well as a reduced capacity to form signal and coding joints, compatible with the clinical diagnosis of OS in SCID-5 (Table 1).42 For this reason, we did not clone the Trp453Arg mutation for recombination studies. According to the information obtained by the clinicians, families SCID-2 and SCID-4 were unrelated. Nevertheless, we identified the same disease-causing mutation in RAG2 (codon 247 stop) and the same polymorphism in RAG1 (Lys820Arg) in both families. V(D)J recombination activity After transfection, plasmid pDVG93 was used as template for PCR and subsequent hybridization with a radioactive probe (results not shown), as well as for RQ-PCR reaction after digestion with the restriction enzyme DpnI. The results of the RQ-PCR reaction are shown in Table 2. Transfection of the wild-type RAG1 gene or the Lys820Arg mutation resulted in identical amplification curves. After correction for transfection efficiency and the amount of pDVG93 added to the RQ-PCR reaction, the relative recombination activities were comparable, indicating that the Lys820Arg mutation represents a functional polymorphism.
After correction for transfection efficiency and the amount of pDVG93
added to the RQ-PCR reaction, the mutated RAG genes of
SCID-1 and SCID-3 showed the highest residual recombination activities
(Table 2). SCID-1 suffered from an OS-like
T+/B Rearrangement of endogenous Ig loci after transfection of
NX-WTA cells.
NX-WTA cells are human kidney epithelial cells that do not express
RAG proteins and for this reason provide a good model system to study
the effect of cloned RAG mutations. Transfection of E47
together with wild-type RAG genes was shown to specifically
induce DH4-JH,
V1-J, and
V3-J rearrangements.37
Therefore, we analyzed the occurrence of these rearrangements in our
transfection assay (Table 2). Transfection of E47 without wt RAG
genes did not result in rearrangements.
The mutated RAG genes of SCID-1 and SCID-3 with the highest
relative recombination activity in the extrachromosomal recombination assay were also able to perform V Ig gene rearrangements in BMMCs To study the in vivo capacity of mutated RAG genes to rearrange Ig loci during human B-cell differentiation, DNA was isolated from BMMCs of several RAG-deficient SCID patients and investigated for the occurrence of incomplete DH-JH and complete VH-JH rearrangements. IGH rearrangements were detected in only 2 of 7 RAG-deficient SCID patients studied (Table 3), the same patients (SCID-1 and SCID-3) who were shown to harbor partial recombination activity (Table 2). The 2 patients with IGH rearrangements were also analyzed for the presence of IGK and IGL rearrangements. As expected in patients suffering from RAG-deficient SCID, no somatic mutations could be detected (Table 3).
Patients SCID-7.1 and 7.2 were 2 sisters suffering from the same RAG1 mutation. This Arg404Gln mutation was shown to cause a complete loss of function (Table 2). The EBV-transformed B-cell lines of both patients were reported to have germline IGH, IGK, and IGL genes, as assessed by Southern blotting.26 Composition of the BM lymphocyte gate and design of an optimal B-cell gate As shown previously, the composition of the BM lymphocyte gate in healthy children is highly variable, because of "contamination" with T lymphocytes, NK cells, myeloid precursors, and normoblasts.28 Therefore, reliable comparison of B-cell subpopulations in BM samples from healthy children and RAG-deficient SCID patients requires analysis within a well-defined and "purified" B-cell gate (Figures 1 and 2).
During our initial flow cytometric analyses of SCID BM samples, we detected coexpression of CD36 and the pan B-cell markers CD22, CyCD79a, and CD19 in SCID patients and virtually not in healthy controls. CD36 is expressed on platelets, mature monocytes, and macrophages, during stages of erythroid cell development and on some macrophage-derived dendritic cells. Therefore, we added CD36 as exclusion marker to some essential labelings (labelings 5, 10, and 14; see http://www.eur.nl/fgg/immu/tables/Table1.htm), resulting in increased purity of the B-cell gates. We have shown previously that CD22 is a reliable pan B-cell marker,
which is rarely expressed on CD3+ T cells,
CD33+ myeloid cells, or CD16+ NK
cells.28 We identified the entire B-cell compartment as being CD22+. In healthy children the CyCD79a+
and the CD19+ fractions within the CD22+ B-cell
compartment were very large (labelings 5 and 14; see Web page), that
is, 98.7% and 97.6%, respectively. The percentages of the different
subpopulations within the CyCD79a+ or CD19+
gates were recalculated into percentages of the CD22+
population, by multiplying with 0.987 and 0.976, respectively. The same
approach was followed for SCID patients, who contained a substantially
larger fraction of CD22+/CyCD79 B-cell subsets in BM from healthy donors Based on detailed triple flow cytometric labelings, we previously presented the composition of the precursor B-cell compartment in healthy children and found that its composition is stable during childhood.28,44 Because we now extended our flow cytometric protocol to 14 quadruple labelings, we have repeated our flow cytometric analyses on thawed BM samples from 6 of the previously studied healthy children, resulting in the recognition of 9 consecutive stages. We have previously compared the composition of the precursor B-cell compartment in fresh BM and thawed BMMCs from healthy children and we could not detect major selective loss of particular precursor B-cell subsets.28The mature B-cell population in BM varied between healthy children
mainly because of blood contamination with
CD10
Flow cytometric analysis of precursor B cells in BM of SCID patients The BM samples from 7 RAG-deficient SCID patients were available, but BM samples from OS patients SCID-1 and SCID-5 could not be analyzed using flow cytometry due to the very low percentage of precursor B cells (< 2% CD22+/CD36 precursor B cells
within the lymphocyte gate).
In BM from healthy children, approximately 15% of the precursor B-cell
compartment consisted of CyIgµ
We have identified 9 patients from 7 families with B
cell-deficient SCID due to RAG mutations. The mutations in
the RAG genes of SCID-2, SCID-4, SCID-6, and SCID-7 affected
the core domains of the RAG proteins and were shown to abrogate
recombination activity (almost) completely. The other 3 RAG
mutations were located outside the core domain (SCID-1, SCID-3, and
SCID-5) and were all associated with partial recombination activity
(Table 4). The partial recombination activity was reported previously for the Trp453Arg RAG2 mutation of OS
patient SCID-5,42 whereas the mutated RAG genes
of SCID-1 and SCID-3 were shown to have partial recombination activity
in our extrachromosomal recombination assay. In line with some
remaining recombination activity of the C-terminal mutated RAG2 protein in SCID-3, some SmIgM+ immature B cells were detectable in
the BM of this patient (Figures 2 and 3). Consequently, complete and
in-frame IGH and IGL rearrangements were
detectable in the BM precursor B cells (Table 3). The amino acid
substitution in the C-terminus of the RAG2 protein in SCID-3 was
located outside the functionally important core domain, but this
mutation might result in diminished protein stability, thereby explaining the strongly reduced recombination activity.
We found that approximately 99% (97%-100%) of the precursor B-cell
compartment in the SCID patients consisted of CyIgµ As was observed earlier, a small subpopulation of CD34+/CD20+ precursor B cells was detectable within the CD19+ gate in BM from healthy children.28 However, in BM from most SCID patients a substantial CD34+/CD20+/CD19+ population could be identified. We observed that the CD34+/CD20+ population is also relatively large in the precursor B-cell compartment of XLA patients, suggesting that down-regulation of CD34 is normally associated with pre-BCR signaling.28 We observed that CD36 coexpressed with the pan B-cell markers CD22, CyCD79a, and CD19 on BM cells in SCID patients, but virtually not in healthy controls. We also detected coexpression of these markers on BM cells of XLA patients. The CD36+/CD22+ cells might represent early myeloid-lymphoid precursor cells, which are detectable in BM of SCID and XLA patients due to the relative increase in early precursor B cells. However, so far we have no explanation for the coexpression of CD36 and the slightly later expressed pan B-cell markers CyCD79a and CD19. Although it has been shown that OS is caused by mutated RAG
genes with partial recombination activity,22 it is not
understood why these patients present with oligoclonal T lymphocytes,
in the absence of B lymphocytes. The presence of high serum IgE levels suggests that Ig-producing plasma cells might be present in patients with OS. However, in BM samples from 2 patients with OS (SCID-1 and
SCID-5), flow cytometric analysis was impossible because the percentage
CD22+/CD36 In conclusion, we observed a complete B-cell differentiation arrest at the pre-BCR checkpoint in the BM of RAG-deficient SCID patients with absence of recombination activity. One patient (SCID-3) showed some SmIgM+ immature B cells, which corresponded with partial recombination activity of the mutated RAG2 protein and the presence of in-frame Ig gene rearrangements. The partial recombination activity in 2 other patients was associated with OS and oligoclonal T cells.
The authors thank Dr H. Karasuyama for making available the monoclonal antibody HSL96 directed against the human VpreB protein, and Miss G. van der Linden and Miss K. Wiertz for technical assistance.
Submitted August 16, 2001; accepted May 3, 2002.
Supported by Revolving Fund project of the University Hospital Rotterdam, The Netherlands.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Jacques J. M. van Dongen, Department of Immunology, Erasmus MC, University Medical Center Rotterdam, dr. Molewaterplein 50, 3015 GE Rotterdam, The Netherlands; e-mail: vandongen{at}immu.fgg.eur.nl.
1. Buckley RH, Schiff RI, Schiff SE, et al. Human severe combined immunodeficiency: genetic, phenotypic, and functional diversity in one hundred eight infants. J Pediatr. 1997;130:378-387[CrossRef][Medline] [Order article via Infotrieve].
2.
Schwarz K, Gauss GH, Ludwig L, et al.
RAG mutations in human B cell-negative SCID.
Science.
1996;274:97-99 3. Schatz DG, Oettinger MA, Baltimore D. The V(D)J recombination activating gene, RAG-1. Cell. 1989;59:1035-1048[CrossRef][Medline] [Order article via Infotrieve]. 4. Oettinger MA, Stanger B, Schatz DG, et al. The recombination activating genes, RAG 1 and RAG 2, are on chromosome 11p in humans and chromosome 2p in mice. Immunogenetics. 1992;35:97-101[Medline] [Order article via Infotrieve]. 5. Ichihara Y, Hirai M, Kurosawa Y. Sequence and chromosome assignment to 11p13-p12 of human RAG genes. Immunol Lett. 1992;33:277-284[CrossRef][Medline] [Order article via Infotrieve]. 6. Huppi K, Siwarski D, Shaughnessy J Jr, et al. Genes associated with immunoglobulin V(D)J recombination are linked on mouse chromosome 2 and human chromosome 11. Immunogenetics. 1993;37:288-291[Medline] [Order article via Infotrieve]. 7. Schwarz K, Hameister H, Gessler M, Grzeschik KH, Hansen-Hagge TE, Bartram CR. Confirmation of the localization of the human recombination activating gene 1 (RAG1) to chromosome 11p13. Hum Genet. 1994;93:215-217[Medline] [Order article via Infotrieve].
8.
Oettinger MA, Schatz DG, Gorka C, Baltimore D.
RAG-1 and RAG-2, adjacent genes that synergistically activate V(D)J recombination.
Science.
1990;248:1517-1523 9. McBlane JF, Van Gent DC, Ramsden DA, et al. Cleavage at a V(D)J recombination signal requires only RAG1 and RAG2 proteins and occurs in two steps. Cell. 1995;83:387-395[CrossRef][Medline] [Order article via Infotrieve]. 10. Van Gent DC, McBlane JF, Ramsden DA, Sadofsky MJ, Hesse JE, Gellert M. Initiation of V(D)J recombination in a cell-free system. Cell. 1995;81:925-934[CrossRef][Medline] [Order article via Infotrieve]. 11. Van Gent DC, Ramsden DA, Gellert M. The RAG1 and RAG2 proteins establish the 12/23 rule in V(D)J recombination. Cell. 1996;85:107-113[CrossRef][Medline] [Order article via Infotrieve]. 12. Eastman QM, Leu TM, Schatz DG. Initiation of V(D)J recombination in vitro obeying the 12/23 rule. Nature. 1996;380:85-88[CrossRef][Medline] [Order article via Infotrieve].
13.
Sadofsky MJ, Hesse JE, McBlane JF, Gellert M.
Expression and V(D)J recombination activity of mutated RAG-1 proteins.
Nucleic Acids Res.
1993;21:5644-5650
14.
Sadofsky MJ, Hesse JE, Van Gent DC, Gellert M.
RAG-1 mutations that affect the target specificity of V(D)J recombination: a possible direct role of RAG-1 in site recognition.
Genes Dev.
1995;9:2193-2199 15. Kirch SA, Sudarsanam P, Oettinger MA. Regions of RAG1 protein critical for V(D)J recombination. Eur J Immunol. 1996;26:886-891[Medline] [Order article via Infotrieve].
16.
Steen SB, Han JO, Mundy C, Oettinger MA, Roth DB.
Roles of the "dispensable" portions of RAG-1 and RAG-2 in V(D)J recombination.
Mol Cell Biol.
1999;19:3010-3017 17. McMahan CJ, Difilippantonio MJ, Rao N, Spanopoulou E, Schatz DG. A basic motif in the Nterminal region of RAG1 enhances V(D)J recombination activity. Mol Cell Biol. 1997;17:4544-4552[Abstract].
18.
Roman CAJ, Cherry SR, Baltimore D.
Complementation of V(D)J recombination deficiency in RAG-1 19. Kirch SA, Rathbun GA, Oettinger MA. Dual role of RAG2 in V(D)J recombination: catalysis and regulation of ordered Ig gene assembly. EMBO J. 1998;17:4881-4886[CrossRef][Medline] [Order article via Infotrieve].
20.
Noordzij JG, Verkaik NS, Hartwig NG, De Groot R, Van Gent DC, Van Dongen JJM.
N-terminal truncated human RAG1 proteins can direct T-cell receptor but not immunoglobulin gene rearrangements.
Blood.
2000;96:203-209 21. Roth DB, Roth SY. Unequal access: regulating V(D)J recombination through chromatin remodeling. Cell. 2000;103:699-702[CrossRef][Medline] [Order article via Infotrieve]. 22. Villa A, Santagata S, Bozzi F, et al. Partial V(D)J recombination activity leads to Omenn syndrome. Cell. 1998;93:885-896[CrossRef][Medline] [Order article via Infotrieve]. 23. Shinkai Y, Rathbun G, Lam KP, et al. RAG-2-deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement. Cell. 1992;68:855-867[CrossRef][Medline] [Order article via Infotrieve]. 24. Mombaerts P, Iacomini J, Johnson RS, Herrup K, Tonegawa S, Papaioannou VE. RAG-1-deficient mice have no mature B and T lymphocytes. Cell. 1992;68:869-877[CrossRef][Medline] [Order article via Infotrieve]. 25. Gaspar HB, Conley ME. Early B cell defects. Clin Exp Immunol. 2000;119:383-389[CrossRef][Medline] [Order article via Infotrieve]. 26. Thompson A, Hendriks RW, Kraakman ME, et al. Severe combined immunodeficiency in man with an absence of immunoglobulin gene rearrangements but normal T cell receptor assembly. Eur J Immunol. 1990;20:2051-2056[Medline] [Order article via Infotrieve]. 27. Van Dongen JJM, Wolvers-Tettero ILM. Analysis of immunoglobulin and T cell receptor genes. Part I: basic and technical aspects. Clin Chim Acta. 1991;198:1-91[CrossRef][Medline] [Order article via Infotrieve]. 28. Noordzij JG, De Bruin-Versteeg S, Comans-Bitter WM, et al. Composition of the precursor B-cell compartment in bone marrow from patients with X-linked agammaglobulinemia compared to healthy children. Pediatr Res. 2002;51:159-168[Medline] [Order article via Infotrieve]. 29. Verhagen OJHM, Wijkhuis AJM, Van der Sluijs-Gelling AJ, et al. Suitable DNA isolation method for the detection of minimal residual disease by PCR techniques. Leukemia. 1999;13:1298-1299[CrossRef][Medline] [Order article via Infotrieve]. 30. Van Dongen JJM, Macintyre EA, Gabert JA, et al. Standardized RT-PCR analysis of fusion gene transcripts from chromosome aberrations in acute leukemia for detection of minimal residual disease. Report of the BIOMED-1 Concerted Action: investigation of minimal residual disease in acute leukemia. Leukemia. 1999;13:1901-1928[CrossRef][Medline] [Order article via Infotrieve]. 31. Beishuizen A, De Bruijn MA, Pongers-Willemse MJ, et al. Heterogeneity in junctional regions of immunoglobulin kappa deleting element rearrangements in B cell leukemias: a new molecular target for detection of minimal residual disease. Leukemia. 1997;11:2200-2207[CrossRef][Medline] [Order article via Infotrieve].
32.
Szczepanski T, Pongers-Willemse MJ, Langerak AW, et al.
Ig heavy chain gene rearrangements in T-cell acute lymphoblastic leukemia exhibit predominant DH6-19 and DH7-27 gene usage, can result in complete V-D-J rearrangements, and are rare in T-cell receptor alpha beta lineage.
Blood.
1999;93:4079-4085 33. Pongers-Willemse MJ, Seriu T, Stolz F, et al. Primers and protocols for standardized detection of minimal residual disease in acute lymphoblastic leukemia using immunoglobulin and T cell receptor gene rearrangements and TAL1 deletions as PCR targets. Report of the BIOMED-1 Concerted Action: investigation of minimal residual disease in acute leukemia. Leukemia. 1999;13:110-118[CrossRef][Medline] [Order article via Infotrieve].
34.
Van der Burg M, Tumkaya T, Boerma M, De Bruin-Versteeg S, Langerak AW, Van Dongen JJM.
Ordered recombination of immunoglobulin light chain genes occurs at the IGK locus but seems less strict at the IGL locus.
Blood.
2001;97:1001-1008
35.
Lefranc MP, Giudicelli V, Ginestoux C, et al.
IMGT, the international ImMunoGeneTics database.
Nucleic Acids Res.
1999;27:209-212 36. Pongers-Willemse MJ, Verhagen OJ, Tibbe GJ, et al. Real-time quantitative PCR for the detection of minimal residual disease in acute lymphoblastic leukemia using junctional region specific TaqMan probes. Leukemia. 1998;12:2006-2014[CrossRef][Medline] [Order article via Infotrieve]. 37. Romanow WJ, Langerak AW, Goebel P, et al. E2A and EBF act in synergy with the V(D)J recombinase to generate a diverse immunoglobulin repertoire in nonlymphoid cells. Mol Cell. 2000;5:343-353[CrossRef][Medline] [Order article via Infotrieve].
38.
Tsuganezawa K, Kiyokawa N, Matsuo Y, et al.
Flow cytometric diagnosis of the cell lineage and developmental stage of acute lymphoblastic leukemia by novel monoclonal antibodies specific to human pre-B-cell receptor.
Blood.
1998;92:4317-4324 39. Groeneveld K, Te Marvelde JG, Van den Beemd MW, Hooijkaas H, Van Dongen JJM. Flow cytometric detection of intracellular antigens for immunophenotyping of normal and malignant leukocytes. Leukemia. 1996;10:1383-1389[Medline] [Order article via Infotrieve]. 40. Van Lochem EG, Groeneveld K, Te Marvelde JG, Van den Beemd MW, Hooijkaas H, Van Dongen JJM. Flow cytometric detection of intracellular antigens for immunophenotyping of normal and malignant leukocytes: testing of a new fixation-permeabilization solution. Leukemia. 1997;11:2208-2210[CrossRef][Medline] [Order article via Infotrieve]. 41. Wada T, Takei K, Kudo M, et al. Characterization of immune function and analysis of RAG gene mutations in Omenn syndrome and related disorders. Clin Exp Immunol. 2000;119:148-155[CrossRef][Medline] [Order article via Infotrieve].
42.
Gomez CA, Ptaszek LM, Villa A, et al.
Mutations in conserved regions of the predicted RAG2 kelch repeats block initiation of V(D)J recombination and result in primary immunodeficiencies.
Mol Cell Biol.
2000;20:5653-5664
43.
Corneo B, Moshous D, Gungor T, et al.
Identical mutations in RAG1 or RAG2 genes leading to defective V(D)J recombinase activity can cause either T-B-severe combined immune deficiency or Omenn syndrome.
Blood.
2001;97:2772-2776 44. Lucio P, Parreira A, Van den Beemd MW, et al. Flow cytometric analysis of normal B cell differentiation: a frame of reference for the detection of minimal residual disease in precursor-B-ALL. Leukemia. 1999;13:419-427[CrossRef][Medline] [Order article via Infotrieve].
45.
Nomura K, Kanegane H, Karasuyama H, et al.
Genetic defect in human X-linked agammaglobulinemia impedes a maturational evolution of pro-B cells into a later stage of pre-B cells in the B-cell differentiation pathway.
Blood.
2000;96:610-617
© 2002 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  S. Ramon-Maiques, A. J. Kuo, D. Carney, A. G. W. Matthews, M. A. Oettinger, O. Gozani, and W. Yang The plant homeodomain finger of RAG2 recognizes histone H3 methylated at both lysine-4 and arginine-2 PNAS, November 27, 2007; 104(48): 18993 - 18998. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. C. van Zelm, I. Reisli, M. van der Burg, D. Castano, C. J.M. van Noesel, M. J.D. van Tol, C. Woellner, B. Grimbacher, P. J. Patino, J. J.M. van Dongen, et al. An antibody-deficiency syndrome due to mutations in the CD19 gene. N. Engl. J. Med., May 4, 2006; 354(18): 1901 - 1912. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. K. Elkin, D. Ivanov, M. Ewalt, C. G. Ferguson, S. G. Hyberts, Z.-Y. J. Sun, G. D. Prestwich, J. Yuan, G. Wagner, M. A. Oettinger, et al. A PHD Finger Motif in the C Terminus of RAG2 Modulates Recombination Activity J. Biol. Chem., August 5, 2005; 280(31): 28701 - 28710. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Ege, Y. Ma, B. Manfras, K. Kalwak, H. Lu, M. R. Lieber, K. Schwarz, and U. Pannicke Omenn syndrome due to ARTEMIS mutations Blood, June 1, 2005; 105(11): 4179 - 4186. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. G. Noordzij, N. S. Verkaik, M. van der Burg, L. R. van Veelen, S. de Bruin-Versteeg, W. Wiegant, J. M. J. J. Vossen, C. M. R. Weemaes, R. de Groot, M. Z. Zdzienicka, et al. Radiosensitive SCID patients with Artemis gene mutations show a complete B-cell differentiation arrest at the pre-B-cell receptor checkpoint in bone marrow Blood, February 15, 2003; 101(4): 1446 - 1452. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2002 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
CT < 1.0). The level of recombination activity of the
mutated RAG genes was compared to that of wild-type
RAG genes. All RQ-PCR experiments were performed multiple
times, showing virtually identical results.
3.3 and 
