SEARCH:   Advanced

Prepublished online as a Blood First Edition Paper on May 17, 2002; DOI 10.1182/blood-2002-03-0742. This Article Abstract Full Text (PDF) All Versions of this Article: 2002-03-0742v1 100/6/2253    most recent Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Wagner, F. F. Articles by Flegel, W. A. Search for Related Content PubMed PubMed Citation Articles by Wagner, F. F. Articles by Flegel, W. A. Related Collections Transfusion Medicine Brief Reports Social Bookmarking                   What's this?  Previous Article  |  Table of Contents  |  Next Article  Blood, 15 September 2002, Vol. 100, No. 6, pp. 2253-2256 BRIEF REPORT DNB: a partial D with anti-D frequent in Central Europe Franz F. Wagner, Nicole I. Eicher, Jan R. Jørgensen, Cornelie B. Lonicer, and Willy A. Flegel From the Department of Transfusion Medicine, University of Ulm, DRK (German Red Cross) Blood Donation Service Baden WürttembergHessen, Institute Ulm, Germany; Blood Transfusion Service, SRC (Swiss Red Cross) Bern, Switzerland; Regional Blood Transfusion Center, Department of Clinical Immunology, Skejby Sygehus, Aarhus University Hospital, Denmark; and the Blood Donation Service of the BRK (Bavarian Red Cross), München, Germany.     Abstract Top Abstract Introduction Study design Results and discussion References To improve routine D typing and define transfusion strategy, it is important to establish the frequency of partial D alleles and their susceptibility to anti-D alloimmunization due to transfusion or pregnancy. We identified the partial D DNB that was caused by an RHD(G355S) allele associated with a CDe haplotype and whose phenotype presented a normal D in routine typing. The antigen density was about 6000 D antigens per red blood cell, and the Rhesus index was 0.02. Five anti-D immunization events with allo-anti-D titers up to 128 were observed. Twelve carriers of DNB were whites of Central Europe; the only Danish proband had Austrian ancestry. DNB was the most frequent partial D recognized so far in whites, occurring with frequencies of up to 1:292 in Switzerland. DNB was the underlying partial D phenotype in a relevant fraction of anti-D immunizations occurring in whites. (Blood. 2002;100:2253-2256) © 2002 by The American Society of Hematology.     Introduction Top Abstract Introduction Study design Results and discussion References Anti-D immunizations may occur in "partial D" carriers. This designation relates to more than 30 alleles differing in molecular structure, phenotype, population frequency, and lenience to anti-D production.1 The molecular bases were gene conversions,2 single missense mutations in the exofacial protein segments,3 and multiple missense mutations dispersed throughout the RhD protein.4 A partial D needs to be considered for transfusion strategies if its carriers are frequent, easily anti-D immunized, and likely to receive D-positive units in the case of transfusion. D category VI 5 is the classical example. In several countries, typing methods6 were introduced that assured D-negative transfusion and anti-D prophylaxis for DVI mothers to prevent anti-D immunizations. Despite the large number of known partial D alleles, a relevant portion of anti-D immunizations is still occurring in individuals who did not carry any known partial D.7-9 Thus, the characterization of the unknown alleles underlying such case reports is remaining important.     Study design Top Abstract Introduction Study design Results and discussion References Blood samples with anti-D Two D-positive samples (RIR-2 from Bern, Switzerland; RIR-3 from Bavaria, Germany) with anti-D were referred to our laboratory to elucidate the cause of anti-D immunization. Later, 1 additional blood sample (RIR-41 from Denmark) and 2 DNA samples (RIR-7, RIR-8 from Austria) were referred to the Rhesus Immunization Registry (RIR) because of anti-D in these D-positive probands. The Danish proband RIR-41 had an Austrian grandfather. RHD nucleotide sequencing DNA was handled as described previously.10 The 10 RHD exons were sequenced by an RHD allele-specific method11 in the 2 index samples (RIR-2, RIR-3). In the remaining samples, exon 7 was sequenced only. PCR-SSP A polymerase chain reaction with sequence-specific priming (PCR-SSP) to confirm or detect the 1063G>A substitution in DNB was devised as modular extension of a PCR-SSP system previously developed for RHD typing.10,12 Specific primers were re77 (TCTCCACAGCTCCATCATGGG) and DNBb (CAGTGACCCACATGCCATTACT) at a concentration of 3.5 µmol; HGH control primers were used at 0.75 µmol. Immunohematology Routine D typing was done in tube tests using commercial monoclonal anti-D (Seraclone anti-D 226, clone BS226; and Seraclone anti-D [232], clone BS232; Biotest, Dreieich, Germany; and ImmuClone anti-Dfast, clone D1-4E11; and ImmuClone anti-Drapid, clone RUM-1; Immucor, Norcross, GA). A commercial panel of monoclonal anti-D (D-Screen; Diagast, Loos, France) was tested in gel matrix technique (LISS-Coombs 37°C, DiaMed-ID Micro Typing System; DiaMed, Cressier sur Morat, Switzerland). D epitopes were determined by agglutination, and antigen density and Rhesus index were determined by flow cytometry as previously described.13 DIV type III 13 and DNU14 controls derived from donors in Baden-Württemberg, Germany. Population screens for DNB Ethylenediaminetetraacetic acid (EDTA)- or citrate-anticoagulated blood samples were collected from blood donors in Baden-Württemberg (Germany, 1118 donors of CcDee phenotype, 1010 donors of ccDEe phenotype), Ticino (Italian-speaking Switzerland, 500 D-positive donors), Bern region (German-speaking Switzerland, 693 donors of CcDee phenotype), and Denmark (768 donors of CcDee phenotype). The donors were tested with the immunoglobulin G (IgG) monoclonal anti-D LOR17-6C7 (Germany and Denmark) or HIRO-7 (Switzerland).15 Suspected DNB samples were confirmed by sequencing of exon 7 or by PCR-SSP. Haplotype frequencies used for calculation of DNB allele frequencies were CDe 0.431, cde 0.394, cDe 0.021, and Cde 0.011 in Germans16; 0.4236, 0.3792, 0.0145, and 0.0059 in Danes17; and 0.4442, 0.3617, 0.0232, 0.0113, and cdE 0.049 in Swiss.17 Phenotype frequencies for CcDee were compared using the Fisher exact test for a 4 × 2 contingency table; for this calculation the 500 D-positive samples in Ticino were inferred to comprise 187 CcDee samples. Nomenclature The name DNB derived from DNU-like and Bayern (Bavaria, Germany) or Bern, because DNB was similar to DNU,14 whose point mutations were closely adjacent.     Results and discussion Top Abstract Introduction Study design Results and discussion References Molecular structure The molecular structure of 2 D-positive samples with anti-D (RIR-2, RIR-3) was determined by RHD-specific sequencing from genomic DNA. In RHD exon 7, a single G to A exchange at position 1063 was detected that resulted in a Gly to Ser substitution at codon 355. The affected amino acid was located in the exofacial loop 6, adjacent to the mutations observed in DII (Ala to Asp at position 354)14 and DNU (Gly to Arg at position 353).14 The nucleic acid and amino acid sequence data were deposited in EMBL/GenBank/DDBJ under accession number AJ417868. Immunohematology In routine D typing, both DNB samples typed as CcDee without noticeable weakening of the antigen D. All 9 monoclonal anti-Ds of a commercial partial D classification kit (D-Screen) were reactive. An antigen density of 5908 antigens per cell and a Rhesus index13,18 (RI) of 0.02 were determined in RIR-2. These results were comparable to those obtained with a DNU sample (8073 antigens per cell, RI 0.06) and a CcDee DIV type 3 sample (4544 antigens per cell, RI 0). The D epitope pattern was determined for both index samples and was unique (Table 1): 6 of 83 anti-Ds tested did not agglutinate DNB, indicating a loss of epitopes epD6 and epD31 as well as part of epD18 and epD23. The crossmatch with DNU red cells was faintly positive; there are no DII red cells available anymore.                                View this table: [in this window] [in a new window]   Table 1. Reactivity patterns of monoclonal anti-D Population frequencies We screened random samples of CcDee blood donors in 4 European populations (Table 2). With the exception of Danes, DNB was found frequently. The highest frequency was observed in the Ticino population. DNB was the most frequent partial D in whites described so far; its frequency even exceeded that of DVII.19 Further testing of other populations may be of potential benefit.                                View this table: [in this window] [in a new window]   Table 2. Population frequencies of DNB Including the probands with anti-D, we presented 12 unrelated carriers of DNB who were whites of Central Europe; the only Danish proband had an Austrian grandfather, from whom he may have inherited the DNB allele. All DNB probands were of CcDee phenotype. The CDe haplotype association was further corroborated by testing the parents of the Danish proband RIR-41, who inherited his DNB allele from his CCDee father. Anti-D immunization Including the 2 index probands, 5 cases of allo-anti-D immunization submitted to the Rhesus Immunization Registry occurred in DNB probands (RIR-2, RIR-3, RIR-7, RIR-8, and RIR-41).20 These cases represented a sizable fraction of the 32 confirmed allo-anti-D immunizations reported to this registry until February 2002. Although any Rhesus-positive blood sample with anti-Dwith or without known Rhesus variantmay be sent to the registry for analysis, no other RHD allele was involved in a similar number of cases. Two additional carriers of DNB with anti-D were from Slovakia (Dr Martin Pisacka, personal communication, 1999) and from Germany (submitted as RIR-49 after we had finished the data analysis). Anti-D titers ranged from 4 to 128, indicating that DNB carriers were generally able to produce strong anti-D. However, no clinical data like signs of transfusion reactions or hemolytic disease of the newborn were reported. In concordance with the assumption that these anti-Ds were triggered by transfusion or pregnancies, 4 of the probands were female; the male and at least 2 of the female probands were transfused prior to the detection of the anti-D. The anti-D was still detectable up to 8 years following the latest possible anti-D immunization event. Impact on typing strategies The repeated observations of anti-D immunizations probably reflected the combination of a high population frequency with a phenotype that triggered D-positive transfusions and with a moderate anti-D immunization potential. Hence, we recommended D-negative transfusions if a recipient is known to carry a DNB phenotype. A serologic recognition of DNB would be demanding because it has a normal antigen density and is agglutinated by most anti-Ds, including almost all commercial anti-D typing reagents. All tested high-affinity monoclonal IgM anti-Ds that did not bind DVI but that agglutinated most weak D phenotypes13,21 agglutinated DNB also (Table 1). Therefore, a serologic strategy for detecting DNB would have to rely on a separate anti-D especially introduced to discriminate DNB from normal D. By careful selection of this third antibody (eg, HIRO-7 or HIRO-8), the strategy could be tuned to discriminate also DII, DIV, and R from normal D.21 Such a major change in D typing would be costly and might induce uncertainties that outweigh the benefit by far. The anti-D immunization risk in DNB carriers may safely be estimated to be lower than 1% per D-positive transfusion. This immunization index was less than known for anti-K and anti-c 22 but may be comparable to that of anti-Fy(a) and anti-Jk(a). Genotyping strategies are increasingly utilized for blood grouping23 and may be devised to meet predefined specificity criteria. For example, RHD PCR in whites may be tuned to a specificity of greater 0.9999 and allows the identification of D-positive units missed by routine serology.10 Likewise, DNB or DIIIa alleles may be detected specifically without any limitations imposed by the lack of suitable monoclonal anti-D. Because the frequency of partial D with relevant anti-D immunization risk is low in whites, their D-negative transfusion would not compromise the D-negative blood supply. Hence, a specific recognition and D-negative transfusion strategy for DNB may be perceived advantageous and become feasible with genotyping strategies in the future.     Acknowledgments We are indebted to the contributors of the Workshop on Monoclonal Antibodies against Human Red Blood Cells and Related Antigens in Nantes in 1996,15 who provided most of the monoclonal anti-Ds used in this study. The authors thank Letizia Caramazza, Servizio Trasfusionale della Svizzera italiana, fondazione CRS, Lugano, Switzerland, for performing the population survey in Ticino; Drs Christoph Gassner and Diether Schönitzer, Innsbruck, Austria, for supplying RIR-7 and RIR-8 DNA samples; Dr Ernst-Markus Quenzel, Hagen, Germany, for supplying the RIR-49 sample; and Drs Martin Pisacka (supported by grant IGA MZ CR NM/5952-3), Reference Laboratory for Immunohaematology, Praha, Czech Republic, and Daniela Cupanikova, Clinic of Haematology and Blood Transfusion, Bratislava, Slovak Republic, for communicating one independent observation of DNB. We acknowledge the expert technical assistance of Marianne Lotsch, Anita Hacker, Katharina Schmid, and Sabine Zahn in Ulm as well as of Lene Christiansen in Aarhus.     Footnotes Submitted March 8, 2002; accepted April 16, 2002. Prepublished online as Blood First Edition Paper, May 17, 2002; DOI 10.1182/blood-2002-03-0742. Further information for this RHD allele and the Rhesus Immunization Registry [RIR] is available online at http://www.uni-ulm.de/~wflegel/RH/ and with Internet links therein. The RIR is sponsored by the German Society for Transfusion Medicine and Immunohematology (DGTI) and by the German Red Cross (DRK) Blutspendedienst Baden-WürttembergHessen gGmbH. The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734. Reprints: Willy A. Flegel, Abteilung Transfusionsmedizin, Universitätsklinikum Ulm, and DRK-Blutspendedienst Baden-WürttembergHessen, Institut Ulm; Helmholtzstrasse 10; D-89081 Ulm, Germany; email: waf{at}ucsd.edu.     References Top Abstract Introduction Study design Results and discussion References 1. Avent ND, Reid ME. The Rh blood group system: a review. Blood. 2000;95:375-387[Abstract/Free Full Text]. 2. Mouro I, Le Van Kim C, Rouillac C, et al. Rearrangements of the blood group RhD gene associated with the DVI category phenotype. Blood. 1994;83:1129-1135[Abstract/Free Full Text]. 3. Rouillac C, Le Van Kim C, Beolet M, Cartron JP, Colin Y. Leu110Pro substitution in the RhD polypeptide is responsible for the DVII category blood group phenotype. Am J Hematol. 1995;49:87-88[Medline] [Order article via Infotrieve]. 4. Huang CH, Chen Y, Reid M. Human D(IIIa) erythrocytes: RhD protein is associated with multiple dispersed amino acid variations. Am J Hematol. 1997;55:139-145[CrossRef][Medline] [Order article via Infotrieve]. 5. Tippett P, Sanger R. Observations on subdivisions of Rh antigen D. Vox Sang. 1962;7:9-13[Medline] [Order article via Infotrieve]. 6. Wissenschaftlicher Beirat der Bundesärztekammer, Paul-Ehrlich-Institut. Richtlinien zur Gewinnung von Blut und Blutbestandteilen und zur Anwendung von Blutprodukten (Hämotherapie). Köln: Deutscher Ärzte-Verlag; 2000. 7. Jones J, Scott ML, Voak D. Monoclonal anti-D specificity and Rh D structure: criteria for selection of monoclonal anti-D reagents for routine typing of patients and donors. Transfus Med. 1995;5:171-184[Medline] [Order article via Infotrieve]. 8. Domen RE. Policies and procedures related to weak D phenotype testing and Rh immune globulin administration. Arch Pathol Lab Med. 2000;124:1118-1121[Medline] [Order article via Infotrieve]. 9. Mayne KM, Allen DL, Bowell PJ. `Partial D' women with anti-D alloimmunization in pregnancy. Clin Lab Haematol. 1991;13:239-244[Medline] [Order article via Infotrieve]. 10. Wagner FF, Frohmajer A, Flegel WA. RHD positive haplotypes in D negative Europeans. BMC Genet. 2001;2:10[CrossRef][Medline] [Order article via Infotrieve]. 11. Wagner FF, Gassner C, Müller TH, Schönitzer D, Schunter F, Flegel WA. Molecular basis of weak D phenotypes. Blood. 1999;93:385-393[Abstract/Free Full Text]. 12. Wagner FF, Gassner C, Müller TH, Schönitzer D, Schunter F, Flegel WA. Three molecular structures cause Rhesus D category VI phenotypes with distinct immunohematologic features. Blood. 1998;91:2157-2168[Abstract/Free Full Text]. 13. Wagner FF, Frohmajer A, Ladewig B, et al. Weak D alleles express distinct phenotypes. Blood. 2000;95:2699-2708[Abstract/Free Full Text]. 14. Avent ND, Jones JW, Liu W, et al. Molecular basis of the D variant phenotypes DNU and DII allows localization of critical amino acids required for expression of Rh D epitopes epD3, 4 and 9 to the sixth external domain of the Rh D protein. Br J Haematol. 1997;97:366-371[CrossRef][Medline] [Order article via Infotrieve]. 15. Proceedings of the 3rd International Workshop and Symposium on Monoclonal Antibodies against Red Blood Cells and Related Antigens. Nantes, 25-27 September 1996. Transfus Clin Biol. 1996;3:329-541[CrossRef][Medline] [Order article via Infotrieve]. 16. Wagner FF, Kasulke D, Kerowgan M, Flegel WA. Frequencies of the blood groups ABO, Rhesus, D category VI, Kell, and of clinically relevant high-frequency antigens in south-western Germany. Infusionsther Transfusionsmed. 1995;22:285-290[Medline] [Order article via Infotrieve]. 17. Mourant AE, Kopec AC, Domaniewska-Sobczak K. The distribution of the human blood groups and other polymorphisms. London United Kingdom: Oxford University Press; 1976. 18. Flegel WA, Curin-Serbec V, Delamaire M, et al. Section 1B: Rh flow cytometry. Coordinator's report. Rhesus index and antigen density: an analysis of the reproducibility of flow cytometric determination. Transfus Clin Biol. 2002;9:33-42[CrossRef][Medline] [Order article via Infotrieve]. 19. Flegel WA, Wagner FF. The frequency of RHD protein variants in Caucasians [abstract]. Transfus Clin Biol. 1996;3:10s. 20. Flegel WA, Wagner FF. Rhesus Immunisierungsregister (RIR) [The Rhesus Immunization Surveillance]. Ulm: DRK-Blutspendedienst Baden-Württemberg; 1998. Available at: http://www.uni-ulm.de/~wflegel/RH/RIR/. Accessed February 28, 2002. 21. Scott M. Rh serologycoordinator's report. Transfus Clin Biol. 1996;3:333-337[CrossRef][Medline] [Order article via Infotrieve]. 22. Winters JL, Pineda AA, Gorden LD, et al. RBC alloantibody specificity and antigen potency in Olmsted County, Minnesota. Transfusion. 2001;41:1413-1420[Medline] [Order article via Infotrieve]. 23. Legler TJ, Kroll H, Wagner FF, Flegel WA, Hallensleben M. Indikation und Durchführung einer Genotypisierung erythrozytärer Antigene [Indication and method of red cell antigen genotyping]. Infusionsther Transfusionsmed. 2000;27:215-216. 24. Lomas C, McColl K, Tippett P. Further complexities of the Rh antigen D disclosed by testing category DII cells with monoclonal anti-D. Transfus Med. 1993;3:67-69[Medline] [Order article via Infotrieve]. © 2002 by The American Society of Hematology.   CiteULike    Connotea    Del.icio.us    Digg    Reddit    Technorati    What's this? This Article Abstract Full Text (PDF) All Versions of this Article: 2002-03-0742v1 100/6/2253    most recent Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Wagner, F. F. Articles by Flegel, W. A. Search for Related Content PubMed PubMed Citation Articles by Wagner, F. F. Articles by Flegel, W. A. Related Collections Transfusion Medicine Brief Reports Social Bookmarking                   What's this?

	Copyright © 2002 by American Society of Hematology         Online ISSN: 1528-0020