Prepublished online as a Blood First Edition Paper on May 17, 2002; DOI 10.1182/blood-2002-03-0742.
 Previous Article | Table of Contents | Next Article 
Blood, 15 September 2002, Vol. 100, No. 6, pp. 2253-2256
BRIEF REPORT
DNB: a partial D with anti-D frequent in Central Europe
Franz F. Wagner,
Nicole I. Eicher,
Jan R. Jørgensen,
Cornelie B. Lonicer, and
Willy A. Flegel
From the Department of Transfusion Medicine, University
of Ulm, DRK (German Red Cross) Blood Donation Service Baden
Württemberg Hessen, Institute Ulm, Germany; Blood Transfusion
Service, SRC (Swiss Red Cross) Bern, Switzerland; Regional Blood
Transfusion Center, Department of Clinical Immunology, Skejby Sygehus,
Aarhus University Hospital, Denmark; and the Blood Donation Service of
the BRK (Bavarian Red Cross), München, Germany.
 |
Abstract |
To improve routine D typing and define transfusion strategy, it is
important to establish the frequency of partial D alleles and their
susceptibility to anti-D alloimmunization due to transfusion or
pregnancy. We identified the partial D DNB that was caused by an
RHD(G355S) allele associated with a CDe
haplotype and whose phenotype presented a normal D in routine typing.
The antigen density was about 6000 D antigens per red blood cell, and
the Rhesus index was 0.02. Five anti-D immunization events with
allo-anti-D titers up to 128 were observed. Twelve carriers of DNB
were whites of Central Europe; the only Danish proband had Austrian
ancestry. DNB was the most frequent partial D recognized so far in
whites, occurring with frequencies of up to 1:292 in Switzerland. DNB was the underlying partial D phenotype in a relevant fraction of anti-D
immunizations occurring in whites.
(Blood. 2002;100:2253-2256)
© 2002 by The American Society of Hematology.
| |
Introduction |
Anti-D immunizations may occur in "partial D"
carriers. This designation relates to more than 30 alleles differing in
molecular structure, phenotype, population frequency, and lenience to
anti-D production.1 The molecular bases were gene
conversions,2 single missense mutations in the exofacial
protein segments,3 and multiple missense mutations
dispersed throughout the RhD protein.4 A partial D needs
to be considered for transfusion strategies if its carriers are
frequent, easily anti-D immunized, and likely to receive D-positive
units in the case of transfusion. D category VI 5 is the
classical example. In several countries, typing methods6 were introduced that assured D-negative
transfusion and anti-D prophylaxis for DVI mothers to prevent anti-D
immunizations. Despite the large number of known partial D alleles, a
relevant portion of anti-D immunizations is still occurring in
individuals who did not carry any known partial D.7-9
Thus, the characterization of the unknown alleles underlying such case
reports is remaining important.
| |
Study design |
Blood samples with anti-D
Two D-positive samples (RIR-2 from Bern, Switzerland;
RIR-3 from Bavaria, Germany) with anti-D were referred to our
laboratory to elucidate the cause of anti-D immunization. Later, 1 additional blood sample (RIR-41 from Denmark) and 2 DNA samples (RIR-7,
RIR-8 from Austria) were referred to the Rhesus Immunization Registry (RIR) because of anti-D in these D-positive probands. The Danish proband RIR-41 had an Austrian grandfather.
RHD nucleotide sequencing
DNA was handled as described previously.10 The 10 RHD exons were sequenced by an RHD
allele-specific method11 in the 2 index samples (RIR-2,
RIR-3). In the remaining samples, exon 7 was sequenced only.
PCR-SSP
A polymerase chain reaction with sequence-specific priming
(PCR-SSP) to confirm or detect the 1063G>A substitution in DNB was
devised as modular extension of a PCR-SSP system previously developed
for RHD typing.10,12 Specific primers were re77
(TCTCCACAGCTCCATCATGGG) and DNBb (CAGTGACCCACATGCCATTACT) at a
concentration of 3.5 µmol; HGH control primers were used
at 0.75 µmol.
Immunohematology
Routine D typing was done in tube tests using commercial
monoclonal anti-D (Seraclone anti-D 226, clone BS226; and Seraclone anti-D [232], clone BS232; Biotest, Dreieich, Germany; and ImmuClone anti-Dfast, clone D1-4E11; and ImmuClone anti-Drapid, clone RUM-1; Immucor, Norcross, GA). A commercial panel of monoclonal anti-D (D-Screen; Diagast, Loos, France) was tested in gel matrix technique (LISS-Coombs 37°C, DiaMed-ID Micro Typing System; DiaMed, Cressier sur Morat, Switzerland). D epitopes were determined by agglutination, and antigen density and Rhesus index were determined by flow cytometry as previously described.13 DIV type III 13
and DNU14 controls derived from donors in
Baden-Württemberg, Germany.
Population screens for DNB
Ethylenediaminetetraacetic acid (EDTA)- or
citrate-anticoagulated blood samples were collected from blood donors
in Baden-Württemberg (Germany, 1118 donors of CcDee phenotype,
1010 donors of ccDEe phenotype), Ticino (Italian-speaking Switzerland,
500 D-positive donors), Bern region (German-speaking Switzerland, 693 donors of CcDee phenotype), and Denmark (768 donors of CcDee
phenotype). The donors were tested with the immunoglobulin G (IgG)
monoclonal anti-D LOR17-6C7 (Germany and Denmark) or HIRO-7
(Switzerland).15 Suspected DNB samples were confirmed by
sequencing of exon 7 or by PCR-SSP. Haplotype frequencies used for
calculation of DNB allele frequencies were CDe 0.431, cde 0.394, cDe
0.021, and Cde 0.011 in Germans16; 0.4236, 0.3792, 0.0145, and 0.0059 in Danes17; and 0.4442, 0.3617, 0.0232, 0.0113, and cdE 0.049 in Swiss.17 Phenotype frequencies for CcDee
were compared using the Fisher exact test for a 4 × 2 contingency
table; for this calculation the 500 D-positive samples in Ticino were
inferred to comprise 187 CcDee samples.
Nomenclature
The name DNB derived from DNU-like and
Bayern (Bavaria, Germany) or Bern, because DNB
was similar to DNU,14 whose point mutations were
closely adjacent.
| |
Results and discussion |
Molecular structure
The molecular structure of 2 D-positive samples with anti-D
(RIR-2, RIR-3) was determined by RHD-specific sequencing
from genomic DNA. In RHD exon 7, a single G to A exchange at
position 1063 was detected that resulted in a Gly to Ser substitution
at codon 355. The affected amino acid was located in the exofacial loop
6, adjacent to the mutations observed in DII (Ala to Asp at position
354)14 and DNU (Gly to Arg at position
353).14 The nucleic acid and amino acid sequence data
were deposited in EMBL/GenBank/DDBJ under accession number AJ417868.
Immunohematology
In routine D typing, both DNB samples typed as CcDee without
noticeable weakening of the antigen D. All 9 monoclonal anti-Ds of a
commercial partial D classification kit (D-Screen) were reactive. An
antigen density of 5908 antigens per cell and a Rhesus
index13,18 (RI) of 0.02 were determined in RIR-2. These
results were comparable to those obtained with a DNU sample (8073 antigens per cell, RI 0.06) and a CcDee DIV type 3 sample (4544 antigens per cell, RI 0). The D epitope pattern was determined
for both index samples and was unique (Table
1): 6 of 83 anti-Ds tested did not
agglutinate DNB, indicating a loss of epitopes epD6 and epD31 as well
as part of epD18 and epD23. The crossmatch with DNU red cells was
faintly positive; there are no DII red cells available
anymore.
Population frequencies
We screened random samples of CcDee blood donors in 4 European
populations (Table 2). With the exception
of Danes, DNB was found frequently. The highest frequency was observed
in the Ticino population. DNB was the most frequent partial D
in whites described so far; its frequency even exceeded that of
DVII.19 Further testing of other populations may be of
potential benefit.
Including the probands with anti-D, we presented 12 unrelated carriers
of DNB who were whites of Central Europe; the only Danish proband had
an Austrian grandfather, from whom he may have inherited the
DNB allele. All DNB probands were of CcDee phenotype. The
CDe haplotype association was further corroborated by
testing the parents of the Danish proband RIR-41, who inherited his DNB allele from his CCDee father.
Anti-D immunization
Including the 2 index probands, 5 cases of allo-anti-D
immunization submitted to the Rhesus Immunization Registry
occurred in DNB probands (RIR-2, RIR-3, RIR-7, RIR-8, and
RIR-41).20 These cases represented a sizable fraction of
the 32 confirmed allo-anti-D immunizations reported to this registry
until February 2002. Although any Rhesus-positive blood sample with
anti-Dwith or without known Rhesus variantmay be sent to the
registry for analysis, no other RHD allele was involved in a
similar number of cases. Two additional carriers of DNB with anti-D
were from Slovakia (Dr Martin Pisacka, personal communication,
1999) and from Germany (submitted as RIR-49 after we had
finished the data analysis).
Anti-D titers ranged from 4 to 128, indicating that DNB carriers were
generally able to produce strong anti-D. However, no clinical data like
signs of transfusion reactions or hemolytic disease of the newborn were
reported. In concordance with the assumption that these anti-Ds were
triggered by transfusion or pregnancies, 4 of the probands were female;
the male and at least 2 of the female probands were transfused prior to
the detection of the anti-D. The anti-D was still detectable up to 8 years following the latest possible anti-D immunization event.
Impact on typing strategies
The repeated observations of anti-D immunizations probably
reflected the combination of a high population frequency with a phenotype that triggered D-positive transfusions and with a
moderate anti-D immunization potential. Hence, we recommended
D-negative transfusions if a recipient is known to carry a DNB phenotype.
A serologic recognition of DNB would be demanding because it has a
normal antigen density and is agglutinated by most anti-Ds, including
almost all commercial anti-D typing reagents. All tested high-affinity
monoclonal IgM anti-Ds that did not bind DVI but that agglutinated most
weak D phenotypes13,21 agglutinated DNB also (Table 1).
Therefore, a serologic strategy for detecting DNB would have to rely on
a separate anti-D especially introduced to discriminate DNB from normal
D. By careful selection of this third antibody (eg, HIRO-7 or HIRO-8),
the strategy could be tuned to discriminate also DII, DIV, and
R from normal D.21 Such a
major change in D typing would be costly and might induce uncertainties
that outweigh the benefit by far. The anti-D immunization risk in DNB
carriers may safely be estimated to be lower than 1% per D-positive
transfusion. This immunization index was less than known for anti-K and
anti-c 22 but may be comparable to that of
anti-Fy(a) and anti-Jk(a).
Genotyping strategies are increasingly utilized for blood
grouping23 and may be devised to meet predefined
specificity criteria. For example, RHD PCR in whites may be
tuned to a specificity of greater 0.9999 and allows the identification
of D-positive units missed by routine serology.10
Likewise, DNB or DIIIa alleles may be detected
specifically without any limitations imposed by the lack of suitable
monoclonal anti-D. Because the frequency of partial D with relevant
anti-D immunization risk is low in whites, their D-negative transfusion
would not compromise the D-negative blood supply. Hence, a specific
recognition and D-negative transfusion strategy for DNB may be
perceived advantageous and become feasible with genotyping strategies
in the future.
| |
Acknowledgments |
We are indebted to the contributors of the Workshop on Monoclonal
Antibodies against Human Red Blood Cells and Related Antigens in Nantes
in 1996,15 who provided most of the monoclonal anti-Ds used in this study. The authors thank Letizia Caramazza, Servizio Trasfusionale della Svizzera italiana, fondazione CRS, Lugano, Switzerland, for performing the population survey in Ticino; Drs Christoph Gassner and Diether Schönitzer, Innsbruck, Austria, for
supplying RIR-7 and RIR-8 DNA samples; Dr Ernst-Markus Quenzel, Hagen,
Germany, for supplying the RIR-49 sample; and Drs Martin Pisacka
(supported by grant IGA MZ CR NM/5952-3), Reference Laboratory for
Immunohaematology, Praha, Czech Republic, and Daniela Cupanikova, Clinic of Haematology and Blood Transfusion, Bratislava, Slovak Republic, for communicating one independent observation of DNB. We
acknowledge the expert technical assistance of Marianne Lotsch, Anita
Hacker, Katharina Schmid, and Sabine Zahn in Ulm as well as of Lene
Christiansen in Aarhus.
| |
Footnotes |
Submitted March 8, 2002; accepted April 16, 2002.
Prepublished online
as Blood First Edition Paper, May 17, 2002; DOI
10.1182/blood-2002-03-0742.
Further information for this RHD allele and the Rhesus
Immunization Registry [RIR] is available online at
http://www.uni-ulm.de/~wflegel/RH/ and with Internet links therein.
The RIR is sponsored by the German Society for Transfusion Medicine and
Immunohematology (DGTI) and by the German Red Cross (DRK)
Blutspendedienst Baden-WürttembergHessen gGmbH.
The publication costs of this
article were defrayed in part by
page charge payment. Therefore,
and solely to indicate this fact,
this article is hereby marked
"advertisement"
in accordance with 18 U.S.C.
section 1734.
Reprints: Willy A. Flegel, Abteilung Transfusionsmedizin,
Universitätsklinikum Ulm, and DRK-Blutspendedienst
Baden-WürttembergHessen, Institut Ulm; Helmholtzstrasse 10;
D-89081 Ulm, Germany; email: waf{at}ucsd.edu.
| |
References |
1.
Avent ND, Reid ME.
The Rh blood group system: a review.
Blood.
2000;95:375-387[Abstract/Free Full Text].
2.
Mouro I, Le Van Kim C, Rouillac C, et al.
Rearrangements of the blood group RhD gene associated with the DVI category phenotype.
Blood.
1994;83:1129-1135[Abstract/Free Full Text].
3.
Rouillac C, Le Van Kim C, Beolet M, Cartron JP, Colin Y.
Leu110Pro substitution in the RhD polypeptide is responsible for the DVII category blood group phenotype.
Am J Hematol.
1995;49:87-88[Medline]
[Order article via Infotrieve].
4.
Huang CH, Chen Y, Reid M.
Human D(IIIa) erythrocytes: RhD protein is associated with multiple dispersed amino acid variations.
Am J Hematol.
1997;55:139-145[CrossRef][Medline]
[Order article via Infotrieve].
5.
Tippett P, Sanger R.
Observations on subdivisions of Rh antigen D.
Vox Sang.
1962;7:9-13[Medline]
[Order article via Infotrieve].
6.
Wissenschaftlicher Beirat der Bundesärztekammer, Paul-Ehrlich-Institut.
Richtlinien zur Gewinnung von Blut und Blutbestandteilen und zur Anwendung von Blutprodukten (Hämotherapie). Köln: Deutscher Ärzte-Verlag; 2000.
7.
Jones J, Scott ML, Voak D.
Monoclonal anti-D specificity and Rh D structure: criteria for selection of monoclonal anti-D reagents for routine typing of patients and donors.
Transfus Med.
1995;5:171-184[Medline]
[Order article via Infotrieve].
8.
Domen RE.
Policies and procedures related to weak D phenotype testing and Rh immune globulin administration.
Arch Pathol Lab Med.
2000;124:1118-1121[Medline]
[Order article via Infotrieve].
9.
Mayne KM, Allen DL, Bowell PJ.
`Partial D' women with anti-D alloimmunization in pregnancy.
Clin Lab Haematol.
1991;13:239-244[Medline]
[Order article via Infotrieve].
10.
Wagner FF, Frohmajer A, Flegel WA.
RHD positive haplotypes in D negative Europeans.
BMC Genet.
2001;2:10[CrossRef][Medline]
[Order article via Infotrieve].
11.
Wagner FF, Gassner C, Müller TH, Schönitzer D, Schunter F, Flegel WA.
Molecular basis of weak D phenotypes.
Blood.
1999;93:385-393[Abstract/Free Full Text].
12.
Wagner FF, Gassner C, Müller TH, Schönitzer D, Schunter F, Flegel WA.
Three molecular structures cause Rhesus D category VI phenotypes with distinct immunohematologic features.
Blood.
1998;91:2157-2168[Abstract/Free Full Text].
13.
Wagner FF, Frohmajer A, Ladewig B, et al.
Weak D alleles express distinct phenotypes.
Blood.
2000;95:2699-2708[Abstract/Free Full Text].
14.
Avent ND, Jones JW, Liu W, et al.
Molecular basis of the D variant phenotypes DNU and DII allows localization of critical amino acids required for expression of Rh D epitopes epD3, 4 and 9 to the sixth external domain of the Rh D protein.
Br J Haematol.
1997;97:366-371[CrossRef][Medline]
[Order article via Infotrieve].
15.
Proceedings of the 3rd International Workshop and Symposium on Monoclonal Antibodies against Red Blood Cells and Related Antigens. Nantes, 25-27 September 1996.
Transfus Clin Biol.
1996;3:329-541[CrossRef][Medline]
[Order article via Infotrieve].
16.
Wagner FF, Kasulke D, Kerowgan M, Flegel WA.
Frequencies of the blood groups ABO, Rhesus, D category VI, Kell, and of clinically relevant high-frequency antigens in south-western Germany.
Infusionsther Transfusionsmed.
1995;22:285-290[Medline]
[Order article via Infotrieve].
17.
Mourant AE, Kopec AC, Domaniewska-Sobczak K.
The distribution of the human blood groups and other polymorphisms. London United Kingdom: Oxford University Press; 1976.
18.
Flegel WA, Curin-Serbec V, Delamaire M, et al.
Section 1B: Rh flow cytometry. Coordinator's report. Rhesus index and antigen density: an analysis of the reproducibility of flow cytometric determination.
Transfus Clin Biol.
2002;9:33-42[CrossRef][Medline]
[Order article via Infotrieve].
19.
Flegel WA, Wagner FF.
The frequency of RHD protein variants in Caucasians [abstract].
Transfus Clin Biol.
1996;3:10s.
20. Flegel WA, Wagner FF. Rhesus Immunisierungsregister (RIR) [The
Rhesus Immunization Surveillance]. Ulm: DRK-Blutspendedienst
Baden-Württemberg; 1998. Available at:
http://www.uni-ulm.de/~wflegel/RH/RIR/. Accessed February 28, 2002.
21.
Scott M.
Rh serologycoordinator's report.
Transfus Clin Biol.
1996;3:333-337[CrossRef][Medline]
[Order article via Infotrieve].
22.
Winters JL, Pineda AA, Gorden LD, et al.
RBC alloantibody specificity and antigen potency in Olmsted County, Minnesota.
Transfusion.
2001;41:1413-1420[Medline]
[Order article via Infotrieve].
23.
Legler TJ, Kroll H, Wagner FF, Flegel WA, Hallensleben M.
Indikation und Durchführung einer Genotypisierung erythrozytärer Antigene [Indication and method of red cell antigen genotyping].
Infusionsther Transfusionsmed.
2000;27:215-216.
24.
Lomas C, McColl K, Tippett P.
Further complexities of the Rh antigen D disclosed by testing category DII cells with monoclonal anti-D.
Transfus Med.
1993;3:67-69[Medline]
[Order article via Infotrieve].
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
|
|
Top
Abstract
Introduction