Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
Prepublished online as a Blood First Edition Paper on May 31, 2002; DOI 10.1182/blood-2002-04-1064.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2002-04-1064v1
100/7/2449    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kundu, M.
Right arrow Articles by Liu, P. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kundu, M.
Right arrow Articles by Liu, P. P.
Related Collections
Right arrow Hematopoiesis and Stem Cells
Right arrow Immunobiology
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, 1 October 2002, Vol. 100, No. 7, pp. 2449-2456

HEMATOPOIESIS

Role of Cbfb in hematopoiesis and perturbations resulting from expression of the leukemogenic fusion gene Cbfb-MYH11

Mondira Kundu, Amy Chen, Stacie Anderson, Martha Kirby, LiPing Xu, Lucio H. Castilla, David Bodine, and Pu Paul Liu

From the Genetics and Molecular Biology Branch and Genetic Disease Research Branch, National Human Genome Research Institute, National Institutes of Health, Bethesda, MD, and Program in Gene Function and Expression, University of Massachusetts Medical School, Worcester.


    Abstract
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Core-binding factor beta  (CBFbeta ) and CBFalpha 2 form a heterodimeric transcription factor that plays an important role in hematopoiesis. The genes encoding either CBFbeta or CBFalpha 2 are involved in chromosomal rearrangements in more than 30% of cases of acute myeloid leukemia (AML), suggesting that CBFbeta and CBFalpha 2 play important roles in leukemogenesis. Inv(16)(p13;q22) is found in almost all cases of AML M4Eo and results in the fusion of CBFB with MYH11, the gene encoding smooth muscle myosin heavy chain. Mouse embryos heterozygous for a Cbfb-MYH11 knock-in gene lack definitive hematopoiesis, a phenotype shared by Cbfb-/- embryos. In this study we generated a Cbfb-GFP knock-in mouse model to characterize the normal expression pattern of Cbfbeta in hematopoietic cells. In midgestation embryos, Cbfbeta was expressed in populations enriched for hematopoietic stem cells and progenitors. This population of stem cells and progenitors was not present in mouse embryos heterozygous for the Cbfb-MYH11 knock-in gene. Together, these data suggest that Cbfb-MYH11 blocks embryonic hematopoiesis at the stem-progenitor cell level and that Cbfb is essential for the generation of hematopoietic stem and progenitor cells. In adult mice, Cbfbeta was expressed in stem and progenitor cells, as well as mature myeloid and lymphoid cells. Although it was expressed in erythroid progenitors, Cbfbeta was not expressed during the terminal stages of erythropoiesis. Our data indicate that Cbfb is required for myeloid and lymphoid differentiation; but does not play a critical role in erythroid differentiation. (Blood. 2002;100:2449-2456)

© 2002 by The American Society of Hematology.

    Introduction
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Core-binding factor beta  (CBFbeta ) is a transcription factor that forms heterodimeric complexes with members of the CBFalpha family of proteins.1 The alpha  subunit includes 3 family members, each encoded by a unique gene: CBFA1 (RUNX2, AML3, PEBP2alpha A), CBFA2 (RUNX1, AML1, PEBP2alpha B), and CBFA3 (RUNX3, AML2, PEBP2alpha C). CBFA1 is required for osteoblast differentiation and bone formation; CBFA2 is required for hematopoiesis; the function of CBFA3 is currently unknown.2-8 The genes are related by virtue of the highly conserved Runt domain, which is responsible for binding DNA and interacting with Cbfbeta .9 CBFbeta is encoded by a single gene, CBFB. It stabilizes the flexible C-terminal loop of the Runt domain (CBFalpha ) that interacts with the minor groove of DNA,10 resulting in a complex that is a more potent transcription factor than CBFalpha alone.11,12

Although CBFbeta interacts with all 3 Cbfalpha family members in vitro, mouse models have only shown evidence for a role for Cbfbeta in hematopoiesis. In mouse embryos, there are 2 stages of hematopoiesis: primitive and definitive.13 The yolk sac is the major site for the generation of primitive hematopoietic cells, which include nucleated red blood cells and primitive macrophages. Primitive erythrocytes are found in the yolk sac beginning at 7 days postcoitus (dpc). Definitive hematopoietic cells, which give rise to mature lineages commonly found in adults, originate in the yolk sac, para-aortic splanchnopleura and in hematopoietic clusters of the aorta-gonad-mesonephros (AGM). By 11 dpc, the fetal liver becomes the major site for definitive hematopoiesis. Homozygous Cbfb knock-out (Cbfb-/-) mice die during midgestation from severe hemorrhages throughout the embryo.14,15 Definitive hematopoiesis is completely absent in these animals, but primitive hematopoiesis appears to be intact. The Cbfb and Cbfa2 homozygous knock-out mice have identical phenotypes, providing genetic evidence of their interaction.6,7

The crucial role of the CBF complex in hematopoiesis is underscored by the observation that CBFB or CBFA2 are targeted by chromosomal rearrangements in nearly 30% of individuals with acute myeloid leukemia (AML).16 The primary chromosomal rearrangement involving CBFB is inv(16)(p13q22). Inv(16) is associated with almost all cases of AML subtype M4Eo and results in the fusion of CBFB with MYH11, the gene for smooth muscle myosin heavy chain.17 Previously, we used a knock-in strategy to generate a mouse model in which Cbfb-MYH11 is expressed under the control of the endogenous mouse Cbfb gene.18 Chimeric mice derived from embryonic stem (ES) cells targeted with the knock-in Cbfb-MYH11 gene were used to assess the leukemogenic potential of the fusion gene.19 Although the Cbfb-MYH11 knock-in chimeras did not develop leukemia naturally in the first year of life, most of the animals developed AML within 3 to 5 months after treatment with the chemical mutagen, N-ethyl-N-nitroso-urea (ENU). The dose of ENU used was not sufficient to induce leukemia in wild-type chimeras. The leukemia in the Cbfb-MYH11 chimeras was characterized by the presence of myelomonocytic blasts and occasional eosinophils, very similar to patients with AML M4Eo. These observations suggested that although expression of Cbfb-MYH11 is not sufficient for leukemogenesis, it is a necessary event in the multistep process that gives rise to leukemias associated with inv(16).

Analysis of the contribution of ES cells with the Cbfb-MYH11 knock-in gene in chimeric animals provided evidence that Cbfb-MYH11 blocks differentiation of the myeloid and lymphoid cells at the level of the c-kit+ progenitors, but does not affect erythroid maturation in adults.19 Expression of the Cbfb-MYH11 knock-in gene in heterozygous embryos results in a severe defect in definitive hematopoiesis, a phenotype similar to that observed in embryos containing homozygous knock-out of either Cbfa2 or Cbfb. In vitro, the CBFB-MYH11 gene product, CBFbeta -SMMHC, sequestered CBFalpha 2 in the cytoplasm.20,21 It also inhibited CBFalpha 2-mediated transactivation and has been shown to increase CBFalpha 2-mediated repression.21,22 Together, these data provide evidence that expression of Cbfb-MYH11 blocks hematopoietic differentiation in a dominant-negative manner by inhibiting the normal function of CBF.

Considering the critical role of Cbfb in normal hematopoiesis and leukemogenesis it is important to further characterize its expression in different hematopoietic cell populations. Previous studies indicated that Cbfb is expressed in the central nervous system, cranial nerve and dorsal root ganglia, eyes, limb bud, somites, and ribs of mouse embryos, as assessed by in situ hybridization.1,14 In adults, Cbfb expression is considered to be ubiquitous because it has been detected in most adult tissues and various cell lines by Northern blot analysis.11,12 In this paper we characterize the expression of Cbfb in embryonic and adult hematopoietic tissues and dissect the specific hematopoietic defects associated with CBFB-MYH11 expression, using a newly created Cbfb-GFP knock-in mouse model.


    Materials and methods
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Generation of Cbfb-GFP knock-in mice

The targeting construct was assembled in the plasmid vector, pPNT-Hygro, which includes the positive selection marker, hygromycin, expressed under control of the SV40 promoter. The vector also includes the HSV thymidine kinase gene expressed from the pgk promoter for negative selection. The 5' arm of the targeting vector consists of a 3.5-kb (KpnI-XhoI) fragment of gDNA that contains Cbfb intron 4 and the first 56 bp of exon 5. The gDNA was isolated from a 129J genomic clone, pSKA (gift from N. A. Speck, Dartmouth College, Hanover, NH). Exon 5 sequences were fused in-frame to the SalI-XbaI fragment isolated from the enhanced green fluorescent protein (EGFP) gene (Clontech, Palo Alto, CA). The bovine growth hormone (BGH) polyA sequence was isolated from pCDNA3.1 (Invitrogen, Carlsbad, CA) and inserted 3' to EGFP. The 3' arm of the targeting vector consists of a 4.7-kb (NheI-NheI) fragment of Cbfb intron 5 isolated from a 129J gDNA clone, pSKB (gift from N. A. Speck, Dartmouth College).

The targeting construct was linearized at a unique NotI site and transfected into ES cells by electroporation. Homologous recombinant clones were identified by Southern blot analysis of gDNA isolated from individual G418/FIAU-resistant ES cell colonies. The DNA was digested with either XbaI or NcoI, and the blotted DNA was hybridized with probes, one internal to the targeting DNA vector (Hygro) and one external (probe 0.2C).18 NcoI digestion generates a 15.7-kb band from the wild-type Cbfb allele that is detected with the 0.2C probe. The correctly targeted Cbfb-GFP allele generates a 6.3-kb band detected with the 0.2C probe. XbaI digestion generates a 7.4-kb band from the targeted allele that is detected with the Hygro probe.

Genotype analysis

The presence of Cbfb-GFP was analyzed by polymerase chain reaction (PCR) from DNA isolated from tail biopsies or yolk sac. Fifty nanograms template DNA was amplified by PCR using primers specific for hygromycin (hygro forward 5' CCATCGTCGAGATCCAGACATG 3' and hygro reverse 5' GTATATGCTCCGCATTGGTCTTG 3'). To distinguish heterozygotes from homozygotes, primers detecting the wild-type, but not the targeted allele, were used (intron 4 forward 5' ATAAGCAGCAAATAGGTAGAGTG 3' and mC5 reverse 5' GACCTGTCTCTATCCTCAAATTC-3'). The PCR samples were initially denatured at 94°C for 2 minutes, followed by 30 cycles of amplification (30 seconds each at 94°C, 60°C, and 72°C), and a final extension step at 72°C. The quality of the template DNA was confirmed in parallel amplification with primers specific for the Trp53 gene.18

Western blot analysis

Lysates from adult tissues or ES cells were prepared by resuspending 1 × 106 cells in NuPage lithium dodecyl sulfate (LDS) sample buffer with reducing agent (Invitrogen) and boiling the samples for 15 minutes. The proteins were separated by electrophoresis on NuPage 4% to 12% bis-tris gels in 2-N-morpholino ethane sulfonic acid (MES) running buffer and transferred onto nitrocellulose membranes using the semidry blotting system (Amersham, Piscataway, NJ). Membranes were probed with a 1:10 dilution from a monoclonal antibody specific for Cbfbeta (amino acids 1-141),14 or a 1:5000 dilution from a polyclonal antibody specific for multiple endocrine neoplasia 1 (MEN1; gift from S. C. Chandrasekharappa, National Institutes of Health, Bethesda, MD), followed by a secondary antibody conjugated to horseradish peroxidase (HRP). Enhanced chemiluminescence (ECL; Amersham) was used to detect the antibody complexes.

Ter119+ and Ter119- cells were separated from adult mouse bone marrow using Ter-119 microbeads and the AutoMACS sorting system (Miltenyi Biotech, Auburn, CA). Then, 2.7 × 106 cells from each population were resuspended in LDS buffer and analyzed for Cbfbeta expression by Western blot analysis.

Cell staining and flow cytometry

Peripheral blood was obtained from anesthetized animals by cardiac puncture. Bone marrow was obtained by flushing femur and tibia with fluorescence-activated cell sorter (FACS) buffer (5% fetal calf serum [FCS] in phosphate-buffered saline [PBS]), followed by trituration through a 25-gauge needle. Bone marrow, spleen, and peripheral blood samples were incubated in ACK lysing buffer (Biowhittaker, Walkersville, MD) to lyse the erythrocytes prior to staining with antibodies. Bone marrow and peripheral blood were stained with phycoerythrin (PE)-conjugated antibodies to CD3 (17A2), B220 (RA3-6B2), Mac1 (M1/70), Gr-1 (RB6-8C5), Ter119 (Ly 76), and c-kit (2B8; BD Pharmingen, San Diego, CA). Additional B-cell staining was performed using the following antibodies purchased from BD Pharmingen as described previously23: PE-conjugated anti-human serum albumin (HSA; M1/69), anti-CD-43 (S7); biotinylated anti-HSA (M1/69), anti-BP-1 6C3 and anti-IgM; and allophycocyanin (APC)-conjugated B220 (RA3-6B2). For staining of megakaryocytes, unlysed bone marrow was resuspended in PBS containing 5% donkey serum. Two hundred nanograms sheep anti-human platelet glycoprotein (GP) IIb-IIIa antibody (Affinity Biologicals, Hamilton, ON, Canada) was used for staining 1 × 106 cells. The secondary antibody was PE-conjugated donkey anti-sheep immunoglobulin (1:200 dilution). Cells were isolated from lymph node, thymus, and spleen of 3- to 6-month-old mice by passage through a nylon mesh. Cells were stained with PE-conjugated antibodies to CD4 (RM4-5) and Cy-chrome-conjugated anti-CD8alpha 53-6.7 (BD Pharmingen). Appropriate isotype controls were used in each experiment. Cells were stained for flow cytometric analysis by incubating with 0.2 µg to 1 µg antibody per 1 million cells in ice-cold FACS buffer for 30 minutes. After washing, cells were resuspended in 200 µL FACS buffer. The GFP signal was detected on FL-1 channel of FACScan (BD Biosciences, San Diego, CA) or FACSCalibur (BD Biosciences). PE was detected on FL-2, and Cy-chrome on FL-3 on the FACScan. For 4-color experiments, APC was detected on FL-7 of FACSCalibur.

Lineage depletion and cell sorting of bone marrow was performed as described previously24 using purified antibodies to CD4, CD8, B220, Mac1, GR1, and Ter119 (Caltag Laboratories, Burlingame, CA). Biotinylated c-kit (ACK4-biotin) antibody and streptavidin-PE (BD Pharmingen) were used to stain bone marrow cells after lineage depletion. Fetal liver and AGM were dissected from 11.5- and 12.5-dpc embryos using standard techniques. The tissues were dissociated by trituration using a 25-gauge needle and passed through a nylon mesh.

Methylcellulose colony-forming assays

Adult bone marrow and 11.5-dpc fetal liver cells were washed and resuspended in Iscove modified Dulbecco medium (IMDM; Invitrogen) with 10% fetal bovine serum (FBS; Stem Cell Technologies, Vancouver, BC, Canada). Cells were incubated in 35-mm suspension dishes in IMDM containing 0.9% methylcellulose, 15% FBS, 1% bovine serum albumin, 10 µg/mL bovine pancreatic insulin, 200 µg/mL human transferring, 10-4 M 2-mercaptoethanol, 2 mM L-glutamine, 50 ng/mL recombinant murine stem cell factor (rmSCF), 10 ng/mL recombinant murine interleukin 3 (rmIL-3), 10 ng/mL rmIL-6, and 3 U/mL recombinant human erythropoietin (MethoCult GF M3434; Stem Cell Technologies). Colonies were visualized and counted after 10 days in culture.


    Results
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Generation of the Cbfb-GFP knock-in mouse model

We previously demonstrated that Cbfb-MYH11 blocks differentiation of hematopoietic cells and promotes the development of AML in mice.18,19 To elucidate the normal role of Cbfb in hematopoiesis, and characterize the defect caused by Cbfb-MYH11, we generated mice expressing Cbfbeta tagged with the GFP. The knock-in targeting construct that contains Cbfb exon 5 (amino acids 1-151) fused in-frame to GFP cDNA is shown in Figure 1A. The fusion protein generated by this construct maintained the ability to interact with Cbfalpha 2 in vitro and exhibited a subcellular localization pattern that was identical to wild-type Cbfbeta in cultured cells (data not shown). We anticipated that Cbfbeta -GFP should function normally, at least with respect to hematopoiesis, because a Cbfb (amino acids 1-141) expression construct can rescue the hematopoietic defect in a Cbfb null ES cell line.25 Southern blot analysis demonstrated a 15% targeting efficiency and allowed identification of several correctly targeted ES cell clones exhibiting a 6.3-kb NcoI-digested band detected with the external probe 0.2C (Figure 1B). To verify that the targeting vector was integrated only once, we used a probe directed against the hygromycin gene that is unique to the targeting vector to demonstrate a single 7.4-kb band (Figure 1C). Western blot analysis demonstrated expression of both the endogenous 25-kDa Cbfbeta and the 47-kDa Cbfbeta -GFP fusion protein in targeted ES cells (Figure 1D). Three targeted ES cell clones (nos. 44, 52, and 74) heterozygous for the knocked-in allele were injected into C57BL/6-derived host blastocysts. Injection of ES cell clone 44 gave rise to low percentage chimeras. Chimeric male mice from ES clones 52 and 74 were crossed with 129/Sv females and passed the targeted Cbfb-GFP allele through the germline. All phenotypes were identical in adults and embryos derived from either of the independently targeted clones. Mice derived from both clones were used in these studies. There was no significant difference in cell number or percentage of any hematopoietic lineage in Cbfb+/GFP compared with wild-type adults (data not shown). The studies in adult mice were performed using heterozygous animals, whereas those in embryos were done using both heterozygous and homozygous embryos. Homozygous embryos died shortly after birth. The reason for the neonatal lethality is unclear, but apparently unrelated to hematopoiesis. The presence of functional stem/progenitor cells in CbfbGFP/GFP embryos was confirmed by flow cytometric analysis and methylcellulose colony assays of stem/progenitor cells (Figure 4 and Table 2) and long-term repopulation assays using 14.5-dpc fetal liver (data not shown). The presence and normal distribution of all mature lineages was confirmed by flow cytometric analysis of 16.5-dpc fetal liver and peripheral blood smear of newborn CbfbGFP/GFP pups (data not shown). These data suggest that hematopoiesis is relatively normal and does not account for the lethality of the newborn pups.


View larger version (34K):
[in this window]
[in a new window]
 
Figure 1. Generation of knock-in ES cells expressing Cbfb-GFP. (A) Targeting scheme used to generate Cbfb+/GFP ES cells. The construct contains exon 5 (e5) of Cbfb fused in frame to GFP. The positive selection marker is SV40-Hygro; the negative selection marker is PGK-TK. Exon 4 (e4) is in the genomic sequence 5' to the targeting vector. Correctly targeted ES cell clones express Cbfb-GFP under the control of the endogenous Cbfb promoter. (B,C) Southern blot analysis of DNA isolated from 3 independently targeted ES cell lines. DNA was digested with either NcoI (B) or XbaI (C). The external probe (0.2C) hybridized to a 3' genomic fragment and detected a 15.7-kb NcoI band from the wild-type allele and a 6.3-kb NcoI band from the targeted allele (B). The internal probe (Hygro) hybridized to the hygromycin gene and detected a single 7.4-kb band in the targeted allele (C). (D) Western blot analysis using a monoclonal antibody against Cbfbeta (1-141) demonstrated expression of endogenous Cbfbeta (22 kDa) or the Cbfbeta fusion proteins in 3 ES cell lines. TC-1 is the wild-type ES cell line (lane 1); Cbfb-MYH11 KI no. 55 is an ES cell clone that expresses Cbfbeta -SMMHC (lane 2); Cbfb-GFP no. 52 is one of the correctly targeted ES cell clones expressing Cbfbeta -GFP (lane 3).

Cbfbeta is expressed in all of the major hematopoietic tissues in adult mice

Previous studies have suggested that Cbfb transcripts are expressed ubiquitously in adult mice.11,12 To evaluate the expression of Cbfbeta in various hematopoietic cell populations in adult mice, cells were harvested from several hematopoietic tissues in Cbfb-GFP heterozygous animals and analyzed for GFP expression by flow cytometry. FACS analysis showed a single peak of GFP-expressing cells in the thymus, lymph nodes, spleen, and peripheral blood, suggesting that most of the cells in these tissues express Cbfbeta (Figure 2A). By contrast, in the bone marrow there were consistently 3 populations of nucleated cells that expressed different levels of Cbfbeta -GFP, ranging from no expression to high levels of expression (Figure 2B, left panel). This was the first indication that Cbfbeta may not be expressed in all hematopoietic cell populations.


View larger version (43K):
[in this window]
[in a new window]
 
Figure 2. Cbfbeta is expressed at uniform levels in most hematopoietic tissues of Cbfb+/GFP mice, but shows differential expression in hematopoietic lineages isolated from bone marrow. Cells were isolated from adult (6-month-old) Cbfb+/GFP and Cbfb+/+ mice and analyzed by FACS. Representative histograms show the distribution of cells with respect to GFP fluorescence. Dashed line (- -) represents Cbfb+/+ autofluorescence; solid line (___) represents fluorescence from Cbfb+/GFP animals. (A) Expression of Cbfbeta -GFP in the indicated tissues. (B) Cells were isolated from bone marrow (BM) of adult Cbfb+/+and Cbfb+/GFP mice, enucleated cells were lysed, and the remaining cells were analyzed for GFP expression (left panel). Bone marrow cells were also stained with PE-conjugated antibodies against Mac1, GR1, or GPIIb/IIIa. The positively stained cells were gated and analyzed for GFP expression. (C) Cells were isolated from bone marrow of adult Cbfb+/+and Cbfb+/GFP mice, lysed in ACK lysing buffer, and stained with APC-conjugated anti-c-kit and PE-conjugated anti-TER119. A representative contour plot (c-kit-APC versus Ter119-PE) is shown. Cells from both wild-type and heterozygous mice were gated into the following populations and analyzed for GFP expression: c-kit+/Ter119- (R2 = 2.3%), c-kit+/Ter119+ (R3 = 0.2%), c-kit-/Ter119lo (R4 = 0.6%), c-kit-/Ter119hi (R5 = 2.4%). (D) Nucleated cells from Cbfb+/GFP and Cbfb+/+ bone marrow were separated into Ter119-enriched and Ter119-depleted populations by magnetic sorting using Ter119 microbeads. Cells from each population were analyzed by Western blot: Ter119-depleted cells from Cbfb+/GFP (lane 1) and Cbfb+/+ (lane 2) bone marrow, and the Ter119-enriched population from Cbfb+/+ bone marrow (lane 3). MEN1 indicates multiple endocrine neoplasia 1; *, nonspecific bands. (E) Cells were isolated from bone marrow of adult Cbfb+/+ and Cbfb+/GFP mice and stained with APC-conjugated anti-B220 and the markers indicated above each histogram. The particular B-cell population being examined is also indicated in the upper right hand corner of the graphs. Cells from wild-type and heterozygotes were gated appropriately and analyzed for GFP expression.

Cbfbeta expression is uniformly expressed in myeloid cells, but decreases during erythroid and B-lymphocyte maturation

To more closely examine the significance of the different GFP-expressing populations in the bone marrow, we analyzed Cbfbeta -GFP expression in various lineages by flow cytometry. Analysis of GFP expression in monocytes and granulocytes (Mac1+ or GR1+ or both) in bone marrow (Figure 2B, middle panels) and peripheral blood (data not shown) revealed single peaks of GFP-expressing cells, indicating uniform expression of Cbfbeta -GFP. Megakaryocytes (GP IIb-IIIa+) also expressed a uniform level of Cbfbeta -GFP (Figure 2B, right panel). Nucleated Ter119+ erythroblasts in the bone marrow did not express Cbfbeta -GFP. However, as shown in Figure 2C, as erythroid cells matured from c-kit+ progenitors (R2) to Ter119hi erythroblasts (R5), there was a progressive loss of Cbfbeta -GFP expression. The majority of Ter119+ cells in the bone marrow did not express Cbfbeta -GFP. We confirmed that the Cbfbeta -GFP signal was representative of the normal distribution of Cbfbeta by examining endogenous Cbfbeta expression in Ter119-enriched and Ter119-depleted populations by Western blot analysis (Figure 2D, lanes 2 and 3). In a population that contained approximately 90% Ter119+ cells, we were unable to detect endogenous Cbfbeta by Western blot analysis. By contrast, there was abundant Cbfbeta expression in the Ter119- population, as predicted by FACS analysis. In addition, the levels of wild-type Cbfbeta and Cbfbeta -GFP were comparable in the Ter119-depleted population from adult Cbfb+/GFP bone marrow as assessed by Western blot analysis (Figure 2D, lane 1).

The analysis of GFP expression in B220+ B lymphocytes in the bone marrow revealed 2 populations (Figure 2E, left panel). The various stages of B-cell differentiation in the bone marrow and corresponding markers are reviewed by Hendriks et al.23 Figure 2E demonstrates that Cbfbeta was expressed at high levels in pro-B (B220+/HSA-/CD43+; B220+/HASdull/BP1-) and large pre-B cells (B220+/CD43+/BP1+), and decreased in small pre-B cells (B220+/CD43-/IgM-). Mature B cells (B220+/IgM+/IgD+) in bone marrow (Figure 2E) and spleen (data not shown) expressed only low levels of Cbfbeta , whereas B220+ cells in peripheral blood expressed slightly higher levels (data not shown).

The number and percentage of CD4/8 T cells were normal in the thymus, lymph nodes, and spleen of heterozygote Cbfb-GFP animals, as was the percentage of CD3+ T lymphocytes in the peripheral blood (data not shown). All of the populations expressed uniform levels of GFP, suggesting that T lymphocytes express Cbfbeta -GFP (data not shown).

Cbfbeta is expressed in hematopoietic stem cells and progenitors

Because the absence of definitive hematopoiesis in the fetal livers of Cbfb homozygous knock-out embryos suggests an early defect in hematopoietic differentiation, we wanted to determine whether or not Cbfbeta is expressed in hematopoietic stem cells and progenitors. Previous studies have demonstrated that the lineage-negative (Lin-) c-kithi population of cells in adult mice is significantly enriched for stem cells that can support long-term repopulation of lethally irradiated animals, whereas the Lin-/c-kitlo population contains only hematopoietic progenitors.24 Cbfb+/GFP mice had comparable numbers of Lin- cells as wild-type animals. Lineage depletion enriched for GFP+ cells as evidenced by the increased ratio of GFP+ to GFP- cells in the Lin- population (3:1) compared to that in total bone marrow (2:1; Figure 3A). Closer examination revealed that the entire population of Lin-/c-kithi and Lin-/c-kitlo cells expressed Cbfbeta -GFP (Figure 3A, right panel). This suggests that a population enriched for long-term repopulating hematopoietic stem cells and hematopoietic progenitors expresses Cbfbeta . A methylcellulose colony assay was used as an additional method of examining the expression of Cbfbeta -GFP in progenitors. Bone marrow cells from heterozygous animals were sorted into GFP+ and GFP- populations (Figure 3B). Equal numbers of cells (5 × 104) from each population were plated in methylcellulose cultures containing SCF, IL-3, IL-6, and erythropoietin. There was a more than 10-fold enrichment in erythroid burst-forming units (BFU-Es), granulocyte-macrophage colony-forming units (CFU-GMs) and granulocyte-erythrocyte-macrophage colony-forming units (CFU-GEMs) in the GFP+ population compared with the GFP- population, suggesting that most, if not all, of the hematopoietic progenitor cells express Cbfbeta (Table 1). It is interesting to note that the greatest enrichment was observed in the CFU-GEMs, which originate from a more immature progenitor that gives rise to both erythroid and myeloid cells.


View larger version (43K):
[in this window]
[in a new window]
 
Figure 3. Cbfbeta is expressed in adult hematopoietic stem cells and progenitors. (A) Cells were isolated from bone marrow of adult Cbfb+/+ (left panel, WT) and Cbfb+/GFP (right panel, GFP) mice and depleted of cells expressing lineage markers (CD3, CD4, CD8, B220, Mac1, GR1, Ter119). Lin- bone marrow cells were stained for c-kit and analyzed by flow cytometry. Representative contour plots (left and right panels) show the distribution of cells with respect to GFP and c-kit PE fluorescence. The c-kit+ (c-kitlo and c-kithi) cells from wild-type and heterozygotes were gated and plotted on a histogram to allow comparison of the GFP fluorescence in the 2 populations (middle panel). (B) Bone marrow cells from Cbfb+/GFP adults were incubated in ACK lysis buffer to eliminate the enucleated erythrocytes and were assessed for GFP expression. The cells were sorted into GFP+ and GFP- populations by FACS. Representative contour plots show forward scatter versus GFP profiles of unsorted bone marrow (left panel), and sorted populations (middle and right panels). Progenitors in all 3 populations (unsorted heterozygous bone marrow, GFP+, and GFP-) were assessed by methylcellulose colony assay. The results are shown in Table 1.


                              
View this table:
[in this window]
[in a new window]
 
Table 1. Methylcellulose colony assay using adult bone marrow

Cbfbeta is expressed in the c-kithi cells in the embryonic sites of definitive hematopoiesis

To examine the expression of Cbfbeta in embryonic hematopoietic cells, we dissected the major sites of hematopoiesis including the AGM, fetal liver, and yolk sac from 11.5-dpc embryos. The GFP signal in wild-type yolk sac cells was indistinguishable from heterozygous and homozygous embryos (data not shown). In the AGM and fetal liver, c-kit marks the hematopoietic stem-progenitor cells. The c-kithi cells in the AGM at 11.5 dpc comprise 1% to 2% of cells in the AGM, and all of them expressed Cbfbeta -GFP (Figure 4A). In the fetal liver, the c-kithi cells included 30% to 40% of the cells, and again, all expressed Cbfbeta -GFP, although in heterozygous animals, the distinction between GFP+ and GFP- was not as clear as in the homozygous animals (Figure 4B). Nevertheless, sorting the c-kithi cells from a heterozygous embryo into GFP+ and GFP- populations (Figure 4C) resulted in a significant enrichment of erythroid (6- to 7-fold), myeloid (3- to 4-fold), and mixed (4- to 5-fold) CFUs, suggesting that myeloid and erythroid progenitor cells express high amounts of Cbfbeta (Table 2).


View larger version (58K):
[in this window]
[in a new window]
 
Figure 4. Cbfbeta is expressed in c-kithi cells in AGM and fetal liver embryos. Cells were isolated from 11.5-dpc AGM (A) and fetal liver (B) of Cbfb+/+ (+/+), Cbfb+/GFP (+/GFP), and CbfbGFP/GFP (GFP/GFP) embryos and stained with c-kit PE. Representative contour plots show the distribution of cells with respect to GFP and c-kit fluorescence. (C) Cells were isolated from fetal liver of 14.5 dpc Cbfb+/GFP embryos and sorted into c-kit+/GFP- and c-kit+/GFP+ populations by FACS. Progenitors in each of these populations (sorted and unsorted) were assessed by methylcellulose colony assay. The data from the methylcellulose colony assays are shown in Table 2.


                              
View this table:
[in this window]
[in a new window]
 
Table 2. Methylcellulose colony assay using 14.5-dpc fetal liver

There was no significant difference in the percentage of c-kithi cells in the fetal liver and AGM of wild-type, heterozygous, and homozygous embryos (Figure 4A,B) nor was there any significant difference in the colony-forming potential of the fetal livers isolated from these animals (Table 2), suggesting that the hematopoietic stem cells and progenitors in homozygous embryos are intact.

The c-kithi population of cells is absent from AGM and fetal liver of embryos expressing Cbfb-MYH11

Previous studies revealed that heterozygous (Cbfb+/MYH11) embryos expressing Cbfb-MYH11 exhibited a complete absence of definitive hematopoiesis in the fetal liver. To further characterize the defect in these embryos, we examined the expression of c-kit and Cbfbeta -GFP in the Cbfb+/MYH11 embryos. In the fetal liver at 11.5 dpc, we found a complete absence of the c-kithi (CD34+ and CD34-) population suggesting that expression of Cbfb-MYH11 prevented the formation or migration of the stem-progenitor cells (Figure 5A,B). There were very few cells expressing Cbfbeta -GFP in the CbfbGFP/MYH11 embryos, confirming the absence of cells expressing Cbfb (and presumably Cbfb-MYH11). In the AGM, the c-kithi population represents the cells in the hematopoietic clusters that give rise to the hematopoietic stem cells and progenitors.26 This population of cells was also absent from embryos expressing Cbfb-MYH11 (Figure 5C), suggesting that the defect occurs very early in hematopoietic differentiation, prior to migration of hematopoietic stem cells and progenitors from the AGM to the fetal liver.


View larger version (60K):
[in this window]
[in a new window]
 
Figure 5. The c-kithi population is absent from the fetal liver and AGM of embryos heterozygous for the knock-in Cbfb-MYH11 (Cbfb+/MYH11). (A) Cells were isolated from 11.5-dpc fetal liver of Cbfb+/+ (+/+), Cbfb+/MYH11 (+/MYH11), and CbfbGFP/MYH11 (GFP/MYH11) embryos and stained with anti-c-kit PE. Representative contour plots show the distribution of cells with respect to GFP and c-kit fluorescence. Cells were isolated from (B) fetal liver and (C) AGM of Cbfb+/+, and Cbfb+/MYH11 11.5-dpc embryos and stained with PE-conjugated anti-c-kit and FITC-conjugated anti-CD34. Representative contour plots show the distribution of cells with respect to FITC and c-kit fluorescence.


    Discussion
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

The importance of Cbfb in hematopoiesis and leukemogenesis prompted us to investigate the expression pattern of Cbfbeta in hematopoietic cells. Analysis of hematopoietic cells is simplified due to the ease of analysis by flow cytometry and the extensive array of well-established cell surface markers available for characterization. To take advantage of this feature of hematopoietic cells, we developed a knock-in mouse model in which Cbfb expression is marked by GFP, which is easily detected by FACS. To preserve the normal function of Cbfb, while tagging it with GFP, exon 5 of Cbfb was fused in-frame to GFP. Previous studies using in vitro differentiation of ES cells demonstrated that amino acids 1-141 (exon 1-4 plus 8 amino acids of exon 5) are sufficient to rescue the defect in definitive myeloid and erythroid differentiation in vitro in cells lacking Cbfb, suggesting that most of exon 5 and all of exon 6 are dispensable for the normal function of Cbfb in hematopoiesis.25 Because the CbfbGFP/GFP embryos have no apparent defect in hematopoiesis, it appears that Cbfbeta -GFP is able to function in a manner similar to endogenous Cbfbeta . However, the early lethality of homozygous pups suggests that in other tissues the function of Cbfbeta may be partially disrupted by fusion with GFP.

In this study, adult Cbfb-GFP heterozygotes were used to analyze the expression of Cbfbeta in various populations of hematopoietic cells. Our data, especially the comparable expression pattern and levels of Cbfbeta and Cbfbeta -GFP in Ter119+ and Ter119- cells by FACS and Western blot, suggest that analysis of Cbfbeta -GFP by FACS provides an accurate reflection of endogenous Cbfbeta expression. We cannot, however, rule out the possibility that there is a difference in the half-life of the proteins, which may influence interpretation of our FACS results. With this potential caveat in mind, we found that Cbfbeta is expressed in hematopoietic stem cells and progenitors, megakaryocytes, and in mature myeloid and lymphoid cells. Cbfbeta is expressed in all myeloid cells and T lymphocytes, but exhibits a biphasic expression pattern in B lymphocytes. In adult bone marrow, the pro-B and large pre-B cells express more Cbfbeta than the small pre-B and mature B cells. These results suggest that although a low level of Cbfbeta expression is maintained in all adult B cells, its expression decreases as B lymphocytes differentiate. In adult chimeric animals, ES cells targeted with the dominant-negative Cbfb-MYH11 gene contribute to the population of cells containing erythroid and myeloid progenitors, but do not contribute to differentiated myeloid and lymphoid cells, suggesting that Cbfb-MYH11 blocks hematopoiesis at the level or upstream of the c-kit+ progenitors. Together, our results suggest that Cbfb is required for early steps of hematopoietic differentiation. The continued expression of Cbfbeta in mature myeloid and lymphoid cells suggests that it may also be required for later stages of myeloid and lymphoid differentiation.

The importance of Cbfalpha 2 and Cbfbeta in megakaryocyte development has been suspected because of the linkage between heterozygous mutations in the CBFA2 gene and a human disease that is characterized by thrombocytopenia.27 The observation that Cbfbeta -GFP is expressed in megakaryocytes, however, is the first evidence that Cbfbeta may play a direct role in megakaryocyte development.

The only hematopoietic cells that do not express Cbfbeta are erythroid cells starting from the c-kit-/Ter119+ erythroblast stage. Cbfbeta is expressed in the erythroid progenitors that give rise to BFU-Es in methylcellulose colony assays and in c-kit+/Ter119+ cells, but not in c-kit-/Ter119+ erythroblasts and enucleated red cells. A previous study demonstrated the absence of any Runt domain-containing proteins in Ter119+ cells by Western blot analysis.28 Together, these results demonstrate that expression of the CBF complex decreases during erythroid maturation and suggest that CBF is not required for terminal differentiation of erythroid cells. Even in c-kit+/Ter119+ progenitors, CBF function is probably not critical: Cbfb-MYH11-targeted ES cells contribute to the c-kit+/Ter119+, c-kit-/Ter119+, and terminally differentiated erythrocyte populations in chimeric animals.19 Because Cbfb-MYH11 functions in a dominant-negative manner, the CBF complex is probably not required for differentiation of erythroid cells at the c-kit+/Ter119+ stage.

In heterozygous embryos expressing knocked-in Cbfb-MYH11, histologic analysis of fetal liver prior to death of the embryos by hemorrhaging revealed an absence of definitive hematopoiesis. In vitro differentiation of fetal liver from these animals resulted in a 30- to 100-fold reduction in the number of myeloid and erythroid colonies.18 In this study, we demonstrated that the entire population of c-kithi hematopoietic stem cells and progenitors in the AGM and fetal liver expresses Cbfbeta and that both of these populations are absent in heterozygous embryos expressing Cbfb-MYH11. The c-kithi cells in the AGM have been shown to express Cbfa2 and form intra-aortic hematopoietic clusters, which contain the hematopoietic stem cells that are capable of repopulating lethally irradiated recipients long-term. The absence of these cells in Cbfb-MYH11 heterozygotes suggests that the defect in hematopoiesis occurs at the level of the hematopoietic stem cell. A similar defect is observed in Cbfa2-/- embryos, which appear to lack the c-kit+ (and Cbfalpha <UP><SUB>2</SUB><SUP>+</SUP></UP>) hematopoietic clusters.26 In adult Cbfb-MYH11 chimeras, it appears that at least some hematopoietic stem cells are able to survive, perhaps as a result of the microenvironment provided by the normal cells. These cells, which are arrested early in myeloid differentiation, can then be targeted by additional mutations and give rise to leukemia.19

This study provides a detailed analysis of Cbfbeta expression in hematopoietic cells from stem cells and progenitors to mature cells of all lineages. In addition to providing supporting evidence of a role for Cbfbeta in the development of hematopoietic stem cells and progenitors in adults and during embryogenesis, it provides the first evidence of a role for Cbfbeta in later stages of myeloid and lymphoid differentiation, and in megakaryocytes. Flow cytometric assays have allowed us to isolate small populations of cells and detect variations in Cbfbeta -GFP expression through maturation of different lineages, as observed in erythroid cells and B cells. The Cbfb-GFP ES cells and animals presented in this study should continue to provide a valuable resource for furthering our knowledge of Cbfb expression and function in hematopoiesis as well as other organ systems.


    Note added in proof

Two articles recently described mouse Runx 3 (Cbfa3) knock-out models.29,30 The data showed that Runx 3 may regulate proliferation and apoptosis of gastric epithelial cells, and may also act as a tumor suppressor in human gastric cancer. In addition, Runx 3 plays a critical role in the development of neurons in the cranial and dorsal root ganglia.


    Acknowledgments

The authors would like to thank Darryl Leja for his help in formatting the figures.


    Footnotes

Submitted April 8, 2002; accepted May 16, 2002.

Prepublished online as Blood First Edition Paper, May 31, 2002; DOI 10.1182/blood-2002-04-1064.

Supported by the Cancer Research Fund of the Damon Runyon-Walter Winchell Foundation (M.K.) and The Leukemia and Lymphoma Society (L.H.C.).

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: Pu Paul Liu, Room 3A18, Building 49, National Institutes of Health, 49 Convent Dr, Bethesda, MD 20892; e-mail: pliu{at}nhgri.nih.gov.


    References
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

1. Adya N, Castilla LH, Liu PP. Function of CBFbeta/Bro proteins. Semin Cell Dev Biol. 2000;11:361-368[CrossRef][Medline] [Order article via Infotrieve].

2. Komori T, Yagi H, Nomura S, et al. Targeted disruption of Cbfa1 results in a complete lack of bone formation owing to maturational arrest of osteoblasts. Cell. 1997;89:755-764[CrossRef][Medline] [Order article via Infotrieve].

3. Otto F, Thornell AP, Crompton T, et al. Cbfa1, a candidate gene for cleidocranial dysplasia syndrome, is essential for osteoblast differentiation and bone development. Cell. 1997;89:765-771[CrossRef][Medline] [Order article via Infotrieve].

4. Mundlos S, Otto F, Mundlos C, et al. Mutations involving the transcription factor CBFA1 cause cleidocranial dysplasia. Cell. 1997;89:773-779[CrossRef][Medline] [Order article via Infotrieve].

5. Lee B, Thirunavukkarasu K, Zhou L, et al. Missense mutations abolishing DNA binding of the osteoblast-specific transcription factor OSF2/CBFA1 in cleidocranial dysplasia. Nat Genet. 1997;16:307-310[CrossRef][Medline] [Order article via Infotrieve].

6. Okuda T, van Deursen J, Hiebert SW, Grosveld G, Downing JR. AML1, the target of multiple chromosomal translocations in human leukemia, is essential for normal fetal liver hematopoiesis. Cell. 1996;84:321-330[CrossRef][Medline] [Order article via Infotrieve].

7. Wang Q, Stacy T, Binder M, et al. Disruption of the Cbfa2 gene causes necrosis and hemorrhaging in the central nervous system and blocks definitive hematopoiesis. Proc Natl Acad Sci U S A. 1996;93:3444-3449[Abstract/Free Full Text].

8. Levanon D, Brenner O, Negreanu V, et al. Spatial and temporal expression pattern of Runx3 (Aml2) and Runx1 (Aml1) indicates non-redundant functions during mouse embryogenesis. Mech Dev. 2001;109:413-417[CrossRef][Medline] [Order article via Infotrieve].

9. Speck NA, Terryl S. A new transcription factor family associated with human leukemias. Crit Rev Eukaryot Gene Expr. 1995;5:337-364[Medline] [Order article via Infotrieve].

10. Tahirov TH, Inoue-Bungo T, Morii H, et al. Structural analyses of DNA recognition by the AML1/Runx-1 Runt domain and its allosteric control by CBFbeta. Cell. 2001;104:755-767[CrossRef][Medline] [Order article via Infotrieve].

11. Wang S, Wang Q, Crute BE, et al. Cloning and characterization of subunits of the T-cell receptor and murine leukemia virus enhancer core-binding factor. Mol Cell Biol. 1993;13:3324-3339[Abstract/Free Full Text].

12. Ogawa E, Inuzuka M, Maruyama M, et al. Molecular cloning and characterization of PEBP2 beta, the heterodimeric partner of a novel Drosophila runt-related DNA binding protein PEBP2 alpha. Virology. 1993;194:314-331[CrossRef][Medline] [Order article via Infotrieve].

13. Ling KW, Dzierzak E. Ontogeny and genetics of the hemato/lymphopoietic system. Curr Opin Immunol. 2002;14:186-191[CrossRef][Medline] [Order article via Infotrieve].

14. Wang Q, Stacy T, Miller JD, et al. The CBFbeta subunit is essential for CBFalpha2 (AML1) function in vivo. Cell. 1996;87:697-708[CrossRef][Medline] [Order article via Infotrieve].

15. Sasaki K, Yagi H, Bronson RT, et al. Absence of fetal liver hematopoiesis in mice deficient in transcriptional coactivator core binding factor beta. Proc Natl Acad Sci U S A. 1996;93:12359-12363[Abstract/Free Full Text].

16. Look AT. Oncogenic transcription factors in the human acute leukemias. Science. 1997;278:1059-1064[Abstract/Free Full Text].

17. Liu P, Tarlie SA, Hajra A, et al. Fusion between transcription factor CBF beta/PEBP2 beta and a myosin heavy chain in acute myeloid leukemia. Science. 1993;261:1041-1044[Abstract/Free Full Text].

18. Castilla LH, Wijmenga C, Wang Q, et al. Failure of embryonic hematopoiesis and lethal hemorrhages in mouse embryos heterozygous for a knocked-in leukemia gene CBFB-MYH11. Cell. 1996;87:687-696[CrossRef][Medline] [Order article via Infotrieve].

19. Castilla LH, Garrett L, Adya N, et al. The fusion gene Cbfb-MYH11 blocks myeloid differentiation and predisposes mice to acute myelomonocytic leukaemia. Nat Genet. 1999;23:144-146[CrossRef][Medline] [Order article via Infotrieve].

20. Adya N, Stacy T, Speck NA, Liu PP. The leukemic protein core binding factor beta (CBFbeta)-smooth-muscle myosin heavy chain sequesters CBFalpha2 into cytoskeletal filaments and aggregates. Mol Cell Biol. 1998;18:7432-7443[Abstract/Free Full Text].

21. Kanno Y, Kanno T, Sakakura C, Bae SC, Ito Y. Cytoplasmic sequestration of the polyomavirus enhancer binding protein 2 (PEBP2)/core binding factor alpha (CBFalpha) subunit by the leukemia-related PEBP2/CBFbeta-SMMHC fusion protein inhibits PEBP2/CBF-mediated transactivation. Mol Cell Biol. 1998;18:4252-4261[Abstract/Free Full Text].

22. Lutterbach B, Hou Y, Durst KL, Hiebert SW. The inv(16) encodes an acute myeloid leukemia 1 transcriptional corepressor. Proc Natl Acad Sci U S A. 1999;96:12822-12827[Abstract/Free Full Text].

23. Hendriks RW, de Bruijn MF, Maas A, et al. Inactivation of Btk by insertion of lacZ reveals defects in B cell development only past the pre-B cell stage. EMBO J. 1996;15:4862-4872[Medline] [Order article via Infotrieve].

24. Orlic D, Fischer R, Nishikawa S, Nienhuis AW, Bodine DM. Purification and characterization of heterogeneous pluripotent hematopoietic stem cell populations expressing high levels of c-kit receptor. Blood. 1993;82:762-770[Abstract/Free Full Text].

25. Miller JD, Stacy T, Liu PP, Speck NA. Core-binding factor beta (CBFbeta), but not CBFbeta-smooth muscle myosin heavy chain, rescues definitive hematopoiesis in CBFbeta-deficient embryonic stem cells. Blood. 2001;97:2248-2256[Abstract/Free Full Text].

26. North T, Gu TL, Stacy T, et al. Cbfa2 is required for the formation of intra-aortic hematopoietic clusters. Development. 1999;126:2563-2575[Abstract].

27. Song WJ, Sullivan MG, Legare RD, et al. Haploinsufficiency of CBFA2 causes familial thrombocytopenia with propensity to develop acute myelogenous leukaemia. Nat Genet. 1999;23:166-175[CrossRef][Medline] [Order article via Infotrieve].

28. Corsetti MT, Calabi F. Lineage- and stage-specific expression of runt box polypeptides in primitive and definitive hematopoiesis. Blood. 1997;89:2359-2368[Abstract/Free Full Text].

29. Li QL, Ito K, Sakakura C, et al. Causal relationship between the loss of RUNX3 expression and gastric cancer. Cell. 2002;109:113-124[CrossRef][Medline] [Order article via Infotrieve].

30. Levanon D, Bettoun D, Harris-Cerruti C, et al. The Runx3 transcription factor regulates development and survival of TrkC dorsal root ganglia neurons. EMBO J. 2002;21:3454-3463[CrossRef][Medline] [Order article via Infotrieve].

© 2002 by The American Society of Hematology.
 

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
haematolHome page
A. Pulsoni, S. Iacobelli, M. Bernardi, M. Borgia, A. Camera, N. Cantore, F. Di Raimondo, P. Fazi, F. Ferrara, F. Leoni, et al.
M4 acute myeloid leukemia: the role of eosinophilia and cytogenetics in treatment response and survival. The GIMEMA experience
Haematologica, July 1, 2008; 93(7): 1025 - 1032.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Y.-H. Kuo, R. M. Gerstein, and L. H. Castilla
Cbf{beta}-SMMHC impairs differentiation of common lymphoid progenitors and reveals an essential role for RUNX in early B-cell development
Blood, February 1, 2008; 111(3): 1543 - 1551.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. Zhao, J. L. Cannons, S. Anderson, M. Kirby, L. Xu, L. H. Castilla, P. L. Schwartzberg, R. Bosselut, and P. P. Liu
CBFB-MYH11 hinders early T-cell development and induces massive cell death in the thymus
Blood, April 15, 2007; 109(8): 3432 - 3440.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. Markus, M. T. Garin, J. Bies, N. Galili, A. Raza, M. J. Thirman, M. M. Le Beau, J. D. Rowley, P. P. Liu, and L. Wolff
Methylation-Independent Silencing of the Tumor Suppressor INK4b (p15) by CBF{beta}-SMMHC in Acute Myelogenous Leukemia with inv(16)
Cancer Res., February 1, 2007; 67(3): 992 - 1000.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. Talebian, Z. Li, Y. Guo, J. Gaudet, M. E. Speck, D. Sugiyama, P. Kaur, W. S. Pear, I. Maillard, and N. A. Speck
T-lymphoid, megakaryocyte, and granulocyte development are sensitive to decreases in CBF{beta} dosage.
Blood, January 1, 2007; 109(1): 11 - 21.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Wunderlich, O. Krejci, J. Wei, and J. C. Mulloy
Human CD34+ cells expressing the inv(16) fusion protein exhibit a myelomonocytic phenotype with greatly enhanced proliferative ability
Blood, September 1, 2006; 108(5): 1690 - 1697.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. D. Growney, H. Shigematsu, Z. Li, B. H. Lee, J. Adelsperger, R. Rowan, D. P. Curley, J. L. Kutok, K. Akashi, I. R. Williams, et al.
Loss of Runx1 perturbs adult hematopoiesis and is associated with a myeloproliferative phenotype
Blood, July 15, 2005; 106(2): 494 - 504.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
T. M. Doherty, L. A. Fitzpatrick, D. Inoue, J.-H. Qiao, M. C. Fishbein, R. C. Detrano, P. K. Shah, and T. B. Rajavashisth
Molecular, Endocrine, and Genetic Mechanisms of Arterial Calcification
Endocr. Rev., August 1, 2004; 25(4): 629 - 672.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. B. Lorsbach, J. Moore, S. O. Ang, W. Sun, N. Lenny, and J. R. Downing
Role of RUNX1 in adult hematopoiesis: analysis of RUNX1-IRES-GFP knock-in mice reveals differential lineage expression
Blood, April 1, 2004; 103(7): 2522 - 2529.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
T. E. North, T. Stacy, C. J. Matheny, N. A. Speck, and M. F.T.R. de Bruijn
Runx1 Is Expressed in Adult Mouse Hematopoietic Stem Cells and Differentiating Myeloid and Lymphoid Cells, But Not in Maturing Erythroid Cells
Stem Cells, March 1, 2004; 22(2): 158 - 168.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F.-Q. Li, R. E. Person, K.-I. Takemaru, K. Williams, K. Meade-White, A. H. Ozsahin, T. Gungor, R. T. Moon, and M. Horwitz
Lymphoid Enhancer Factor-1 Links Two Hereditary Leukemia Syndromes through Core-binding Factor {alpha} Regulation of ELA2
J. Biol. Chem., January 23, 2004; 279(4): 2873 - 2884.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. E. Elagib, F. K. Racke, M. Mogass, R. Khetawat, L. L. Delehanty, and A. N. Goldfarb
RUNX1 and GATA-1 coexpression and cooperation in megakaryocytic differentiation
Blood, June 1, 2003; 101(11): 4333 - 4341.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2002-04-1064v1
100/7/2449    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kundu, M.
Right arrow Articles by Liu, P. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kundu, M.
Right arrow Articles by Liu, P. P.
Related Collections
Right arrow Hematopoiesis and Stem Cells
Right arrow Immunobiology
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2002 by American Society of Hematology         Online ISSN: 1528-0020