|
|
Previous Article | Table of Contents | Next Article 
Blood, 1 October 2002, Vol. 100, No. 7, pp. 2506-2514
HEMOSTASIS, THROMBOSIS, AND VASCULAR BIOLOGY
Evidence that -synuclein functions as a negative regulator of
Ca++-dependent -granule release from human
platelets
Sang Myun Park,
Han Young Jung,
Hyun Ok Kim,
Hyangshuk Rhim,
Seung R. Paik,
Kwang Chul Chung,
Jeon Han Park, and
Jongsun Kim
From the Department of Microbiology and Brain Korea
21 Project of Medical Sciences, Department of Clinical
Pathology, and Department of Pharmacology, Yonsei University College of
Medicine, Seoul, Korea; Research Institute of Molecular Genetics,
Catholic University College of Medicine, Seoul, Korea; and Department
of Biochemistry, Inha University College of Medicine, Inchon, Korea.
 |
Abstract |
-Synuclein has been implicated in the pathogenesis of Parkinson
disease (PD) and related neurodegenerative disorders. More recently, it
has been suggested to be an important regulatory component of vesicle
transport in neuronal cells. -Synuclein is also highly expressed in
platelets and is loosely associated with the membrane of the secretory
-granules. However, the functional significance of these
observations is unknown. In this study, the possible function of
-synuclein in vesicle transport, with particular regard to
-granule release from the platelets, was investigated. The results
showed that ionomycin- or thrombin-induced -granule secretion was
inhibited by exogenous -synuclein addition in a dose-dependent
manner. However, [3H]5-HT release from the dense granules
and hexosaminidase release from the lysosomal granules were not
affected. Two point mutants (A30P and A53T) found in some familial
types of PD, in addition to -synuclein and -synuclein112,
effectively inhibited PF4 release from the -granules. However, the
deletion mutants, which completely lacked either the N-terminal region
or the C-terminal tail, did not affect -granule release.
Interestingly, exogenously added -synuclein appeared to enter the
platelets but did not change the Ca++ level in the
platelets at the resting state and the increase in the Ca++
level on stimulation. Electron microscopy also supported that -synuclein inhibits -granule release. These results suggest that
-synuclein may function as a specific negative regulator of
-granule release in platelets.
(Blood. 2002;100:2506-2514)
© 2002 by The American Society of Hematology.
 |
Introduction |
-Synuclein is an acidic neuronal protein
containing 140 amino acids.1,2 It is highly expressed in
brain tissues and is primarily localized at the presynaptic terminals
of neurons.3 In addition to its expression in neuronal
cells, -synuclein is expressed in other tissues, such as the heart,
skeletal muscle, pancreas, and placenta, but it is less abundant than
in the brain.1,2 -Synuclein consists of 3 distinct
regions.4 The N-terminal region contains KTKEGV repeats,
which form amphipathic -helices that are similar to the
lipid-binding domain of apolipoproteins. The central region is a
hydrophobic NAC (non-A component of Alzheimer disease) peptide, and
the C-terminal region is primarily composed of acidic amino acids. In
addition to -synuclein, - and -synuclein and synoretin, which
belongs to the synuclein family, have been identified in
humans.1,4-6
-Synuclein has also been identified as a major component of
intracellular fibrillar protein deposits (Lewy bodies) in several neurodegenerative diseases, including Parkinson
disease,7,8 diffuse Lewy body disease,9 and
multiple systemic atrophy.10 Interest in the pathologic
role of -synuclein was enhanced when 2 different mutations, A30P and
A53T, were found in some patients with early-onset familial Parkinson
disease.11,12 Although significant progress has been made
in understanding the pathologic role of -synuclein in
neurodegenerative diseases,13-17 the biologic function of
-synuclein is unclear. Several hypotheses for the normal function of
-synuclein have been proposed. First, -synuclein may play a role
in the neuronal plasticity responses because its avian homolog,
synelfin, is regulated during a critical period of song
learning.18 Second, -synuclein is a presynaptic protein that can interact with particular types of lipid bilayers, such as with
the synthetic, small, unilamellar phospholipid vesicles containing
acidic phospholipids.19 Third, - and -synucleins may
play an important regulatory role in the vesicular transport process
because these proteins appear to selectively inhibit phospholipase D-2
(PLD2).20 Recently, -synuclein knockout mice were
produced.21 These mice appear to be viable and fertile,
exhibit an intact brain architecture, and have a normal complement of
dopaminergic cell bodies, fibers, and synapses, which suggests that
-synuclein is not essential for neuronal development and
differentiation. However, they exhibit an accelerated recovery of
dopamine release when presented with multiple stimuli. This suggests
that -synuclein might negatively regulate the activity-dependent
dopamine release. Overall, it is highly likely that the normal function
of -synuclein is associated with the trafficking of vesicles and
that functional disorders in this process might be associated with
neurodegenerative diseases.
In a previous paper, -synuclein was shown to be highly expressed in
various hematopoietic cells including T cells, B cells, NK cells, and
monocytes in addition to neuronal cells.22 This result
suggests that the -synuclein function might not be restricted to
just the neurons. Hashimoto et al23 also showed that
-synuclein is abundant in platelets and that -synuclein
immunoreactivity is loosely associated with the membrane of
-granules and plasma membrane. These results led us to suggest that
-synuclein may play an important role in vesicle release from
hematopoietic cells, particularly in -granule release from the platelets.
In this study, the effect of exogenous -synuclein addition on
granule release in platelets was investigated. -Synuclein is shown
to specifically inhibit -granule secretion from platelets when they
are stimulated with either ionomycin or thrombin.
 |
Materials and methods |
Construction of expression vectors for -synuclein point
mutants
Three mutant form constructs of -synuclein were made using
polymerase chain reaction (PCR)-based, site-directed mutagenesis from
pRK172 encoding the wild-type -synuclein (a kind gift from Dr R. Jakes, Medical Research Council, Cambridge, United Kingdom). The 2 XcmI sites in the -synuclein gene were used for
subcloning. Briefly, A30P and A53T point mutations were introduced by
PCR with pRK172 as the template, the 5'-oligonucleotide primer
agaaaaccaaacagggtgtggcagaagaccaggaagacaaaagaggt and the
3'-oligonucleotide primer cgagctctcaagcttggatggaacatctgtgtcagcag (the mutated codon is underlined) for A30P, and the
5'-oligonucleotide primer
ccaaaaccaaggagggagtggtgcatggtgtgacaacagtggctgagaag and the 3'-oligonucleotide primer cgagctctcaagcttggatggaacatctgtgtcagcag (the mutated codon is underlined) for A53T,
respectively. An A30P-A53T double-mutant construct was generated by
ligating the XcmI-digested DNA fragment from the A30P
construct into the pRKA53T XcmI. All constructs were
confirmed by DNA sequencing.
Purification of -synuclein, -synuclein, and -synuclein
point mutants and of -synuclein deletion mutants
The - and -synucleins and mutant forms of -synuclein
were overexpressed in Escherichia coli (Bl21), and the
recombinant proteins were purified as described
previously.24 -Synuclein112 (also called NACP112) was
purified using a method described previously.25 -Synuclein deletion mutants (Syn61-140 and Syn96-140) were prepared as described previously.26 The -synuclein1-97 protein
(Syn1-97) was prepared by ASPN digestion as described
previously.27
Platelet preparation and stimulation assay
Fresh platelets were obtained from the Yonsei University Medical
Center blood bank and were prepared from the peripheral blood of
healthy donors after they gave informed consent, as described previously.28 Fifty microliters (more than
5 × 107) platelets in HEPES-buffered saline (140 mM
NaCl, 4.7 mM KCl, 2.2 mM CaCl2, 1.2 mM MgCl2,
1.2 mM KH2PO4, 11 mM glucose, 15 mM HEPES
[N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic
acid] pH 7.4) containing 0.1% bovine serum albumin (BSA) was mixed
with 50 µL HEPES-buffered saline containing an appropriate amount of the protein sample. Solutions were then incubated for 30 minutes on ice
to minimize spontaneous release. Samples were warmed to room
temperature for 5 minutes, then 0.5 to 1 µM ionomycin (Calbiochem, Nottingham, United Kingdom) or 0.1 to 1 U/mL thrombin (Sigma, St Louis,
MO) was added and the reactions were incubated for a further 5 minutes at room temperature. Reactions were stopped by placing the
samples on ice for 4 minutes followed by centrifugation at 13 000 rpm
for 1 minute. Supernatants were collected and assayed as below. All the
experiments (Figures
1-5)
were performed at least 3 times using the platelets from 3 different donors. The error bar indicates the results from triplicate
experiments.

View larger version (22K):
[in this window]
[in a new window]
| Figure 1.
Exogenously added -synuclein inhibits ionomycin- or
thrombin-induced PF4 release from purified platelets.
(A) Ionomycin- and thrombin-induced PF4 release from the -granules
in platelets. Purified platelets (100 µL, more than 106
cells/µL) in HEPES-buffered saline containing 0.1% BSA were
incubated for 30 minutes on ice to minimize a spontaneous release.
Samples were warmed to room temperature for 5 minutes, then 0.5 µM
ionomycin or 0.1 U/mL thrombin was added and the reactions were further
incubated for 5 minutes at room temperature. Reactions were quenched by
placing the samples in ice followed by centrifugation. Supernatants
were collected and assayed by quantitative ELISA to determine the
amount of PF4. (B) -Synuclein inhibits ionomycin-induced PF4 release
from the -granules in a dose-dependent manner. (C) -Synuclein
inhibits thrombin-induced PF4 release from the -granules in a
dose-dependent manner. (D) Effect of the incubation time with
-synuclein. Platelet solutions were incubated with 10 µM
-synuclein for the indicated times on ice before stimulation with
ionomycin. The PF4 released was quantified using the same method shown
in panel A.
|
|

View larger version (26K):
[in this window]
[in a new window]
| Figure 2.
Exogenously added -synuclein inhibits ionomycin- or
thrombin-induced CD62P expression on purified platelets.
Surface expression of CD62P was analyzed by flow cytometry before and
after stimulation with 1 µM ionomycin (A) or 0.1 U/mL thrombin (B) in
the presence and absence of -synuclein.
|
|

View larger version (20K):
[in this window]
[in a new window]
| Figure 3.
Exogenously added -synuclein has no effect on
ionomycin- or thrombin-induced [3H]5-HT release and
hexosaminidase release from platelets.
(A) Platelet-rich plasma was incubated with 0.037 MBq (1 µCi) per
milliliter [3H]5-HT for 60 minutes at room temperature to
enable sufficient uptake. Platelets were resuspended in HEPES-buffered
saline containing 0.1% BSA and were stimulated with either 1 µM
ionomycin or 1 U/mL thrombin in the presence or absence of 2 µM
imipramine, as described in "Materials and methods." After the
platelet stimulation assay, 50 µL supernatant was added to a 5 mL
cocktail solution, and the radioactivity was measured using a liquid
scintillation counter. (B) -Synuclein has no effect on
ionomycin-induced [3H]5-HT release from the dense
granules. (C) -Synuclein has no effect on thrombin-induced
[3H]5-HT release from the dense granules in the
presence of 2 µM imipramine. (D) Ionomycin-induced lysosomal
granule release was measured by a quantitative -hexosaminidase
assay, as described in "Materials and methods." (E)
Ionomycin-induced hexosaminidase release from lysosomal granules is not
affected by exogenously added -synuclein, GST- -synuclein, or
-synuclein112.
|
|

View larger version (8K):
[in this window]
[in a new window]
| Figure 4.
Mutant forms of -synuclein (A30P, A53T, A30P/A53T),
-synuclein, and -synuclein112 function like the wild-type
-synuclein.
(A) -Synuclein point mutants (A30P, A53T), found in the early-onset
familial PD patients, and a double mutant (A30P/A53T) inhibits the
ionomycin-induced PF4 release in a similar way to that found in
wild-type. Below the figure, each protein for the quantitative
comparison was loaded in SDS-PAGE and stained by Coomassie brilliant
blue R-250. (B) -Synuclein and (C) -synuclein112 also inhibit the
PF4 release. The PF4 released was measured as in Figure 1.
|
|

View larger version (15K):
[in this window]
[in a new window]
| Figure 5.
Fragments of -synuclein have no effect on
ionomycin-induced PF4 release from platelets.
(A) Diagram of the wild-type -synuclein and its deletion mutants.
(B) Purified proteins of -synuclein, -synuclein fragments
(Syn1-97, Syn61-140, Syn96-140) were separated on 12% SDS
polyacrylamide gel and stained with Coomassie brilliant blue R-250. (C)
Both N-terminally and C-terminally truncated -synuclein proteins did
not appear to inhibit the ionomycin-induced PF4 release from platelets.
For these experiments 10 µM synuclein proteins was used, and the PF4
released was measured as in Figure 1.
|
|
Measurement of -granule secretion
-Granule release was measured by quantitative enzyme-linked
immunosorbent assay (ELISA) for the -granule protein, platelet factor 4 (PF4), as described previously.29 Supernatants
obtained from the platelet stimulation assay were added to the wells of a high-binding ELISA plate (Costar, Cambridge, MA) containing 150 µL
binding buffer (15 mM Na2CO3, 35 mM
NaHCO3, pH 9.6). Samples were incubated at 37°C for 2 hours. Wells were washed 4 times with phosphate-buffered saline (PBS)
containing 0.05% Tween 20 (PBS-T). Blocking was carried out at 37°C
for 2 hours using a blocking solution (5% nonfat dried milk in PBS-T).
Sheep anti-PF4 primary antibodies (Accurate Chemical and Scientific,
Westbury, NY) were diluted to 10 µg/mL in the blocking solution and
were added to the wells. The resultant mixture was then incubated for 2 hours at 37°C. The wells were washed 4 times, and anti-sheep secondary antibodies conjugated to horseradish peroxidase (Sigma) diluted in the blocking solution were added. Samples were then allowed
to incubate for 1 hour at 37°C. Wells were washed 4 times, and 100 µL of 0.4 mg/mL -phenylenediamine (Sigma) in a citrate-phosphate buffer (pH 5.5) was then added. After 15 minutes, the reaction was
quenched by the addition of 150 µL of 2.5 N
H2SO4. Samples were quantified using a Spectra
MAX 340 ELISA Reader (Molecular Devices, Sunnyvale, CA) at a 490-nm
wavelength. The percentage release was calculated using the following
equation: [OD490 (release from
sample) OD490 (spontaneous
release)]/[OD490 (release from no addition of
protein) OD490 (spontaneous release)] × 100. Cells
were lysed by 2% Triton X-100 (Sigma) to measure the total amount of granule (Figures 1-5).
Flow cytometric analysis
CD62P (P-selectin) expression was measured by flow cytometric
analysis using a slight modification of a previously described method.30,31 Five microliters platelet-rich plasma was
diluted to 95 µL HEPES-buffered saline containing 0.1% BSA and
anti-CD62P antibodies (AC1.2; BD PharMingen, San Diego, CA). Samples
were incubated for 30 minutes at room temperature in the presence or the absence of 10 µM -synuclein. After the samples were stimulated with either 1 µM ionomycin or 0.1 U/mL thrombin for 5 minutes at room
temperature, 100 µL of 2% paraformaldehyde was added for fixation,
and the mixture was further incubated for 10 minutes. When thrombin was
used as the stimulus, 5 mM Gly-Pro-Arg-Pro (GPRP; Sigma) was added to
prevent platelet aggregation. Samples were subsequently incubated with
fluorescein isothiocyanate (FITC)-conjugated secondary antibodies for
30 minutes. Then samples were diluted 10- fold and were analyzed in a
Becton Dickinson FACScalibur (Franklin Lakes, NJ).
Measurement of dense granule secretion
Dense granule secretion was measured by a
[3H]5-HT release assay. Platelet-rich plasma was
incubated with 0.037 MBq (1 µCi) per milliliter
[3H]5-HT (New England Nuclear, Boston, MA) for 60 minutes
at room temperature to allow for sufficient uptake. After incubation, the platelet-rich plasma was washed twice with platelet-poor plasma and
once with Tyrode solution. Platelets were resuspended in HEPES-buffered saline containing 0.1% BSA. A platelet stimulation assay was then performed as described above. Before stimulation, 2 µM imipramine (Calbiochem) was added to prevent reuptake in some cases. After the platelet stimulation assay, radioactivity was measured using a
liquid scintillation counter.32 Percentage release was
calculated similarly to the method used for the -granule
release assay.
Measurement of lysosomal granule release
Lysosomal granule release was measured by a quantitative
-hexosaminidase assay, as described previously.33 After
the platelet stimulation assay, 20 µL each supernatant was added to a
100 µL citrate-phosphate buffer (pH 4.5), and 50 µL of 20 mM
p-nitrophenyl- -D-glucosaminides (Sigma) was
added to the reaction mixture. Reaction mixtures were incubated at
37°C for 30 minutes. Reactions were quenched by the addition of 250 µL of 0.08 N NaOH. Samples were quantified using a Spectra MAX 340 ELISA Reader at a 410-nm wavelength. Percentage release was calculated
similarly to the method used for -granule release assay.
Confocal microscopy and Western blot analysis
Platelet-rich plasma was incubated for 30 minutes at room
temperature in either the presence or absence of -synuclein and then
was washed twice with platelet-poor plasma. For confocal microscopy,
the platelets were attached to slide glasses and were fixed for 5 minutes with 4% paraformaldehyde. Fixed platelets were washed several
times with a washing buffer (PBS containing 0.1% saponin and 0.1% BSA
or PBS containing 0.1% BSA only) and were incubated for 30 minutes at
room temperature with anti- -synuclein antibodies (Synuclein-1;
Transduction Laboratories). After washing 4 times, the
platelets were incubated for 30 minutes at room temperature with
FITC-conjugated secondary antibodies and then were washed several times
again with the washing buffer. Immunostained platelets were observed
using confocal microscopy (Reica, TCSNT system; Chatsworth,
CA). -Synuclein was also detected by Western blotting. Briefly, the platelets were lysed with 1× sodium dodecyl sulfate (SDS)
sample buffer, and the lysates were loaded onto a 12% SDS polyacrylamide gel and transferred to a polyvinylidene difluoride membrane. Western blot analysis was then performed with
anti- -synuclein antibodies (LB509; Zymed, South San Francisco, CA).
Measurement of Ca++ concentrations
Platelet-rich plasma was prepared as described above and
incubated for 1 hour at room temperature with 1 µM
Fura-2/AM (Molecular Probes, Eugene, OR). The platelets
were then washed twice by platelet-poor plasma, and the pellets were
resuspended in HEPES-buffered saline containing 0.1% BSA to a final
concentration of more than 107 cells/mL. The
fura-2/AM fluorescence was measured using 2-mL aliquots of
the platelets on a spectrofluorometer (Photon Technology International,
Brunswick, NJ). Excitation wavelengths were alternated between 340 nm
and 380 nm every second, and the emission wavelength was 510 nm. Data
were analyzed to give a fluorescence intensity ratio at the excitation
wavelengths of 340/380nm.
Preparation of platelets for electron microscopy
After the platelets were stimulated by ionomycin in the presence
or absence of -synuclein, the samples were fixed with 0.1 M
cacodylate buffer (pH 7.4) containing 2% glutaraldehyde, 2% paraformaldehyde, and 0.5% CaCl2 for 6 hours and were then
washed with a 0.1 M cacodylate buffer (pH 7.4). Samples were postfixed with 1.33% OsO4 in a cacodylate buffer for 2 hours. Fixed
samples were dehydrated with alcohol and then were incubated with
propylene oxide for 10 minutes. Embedding EPON mixtures (EPON812, nadic methyl anhydride [MNA], dodecenyl succinic anhydride [DDSA], and tridimethyl phenol [DMP30]) were prepared, and the samples were sectioned using an ultramicrotome followed by double staining with
uranyl acetate and lead citrate. Samples were observed using a
transmission electron microscope (TEM; Philips CM-10).
 |
Results |
Exogenous -synuclein addition specifically inhibits the
-granule secretion
An in vitro granule release assay system was established using
purified platelets as a model system, and either ionomycin or thrombin
was used as a stimulus to investigate the molecular mechanism and the
regulation of the granule release from cells. First, the amount of
secreted platelet factor 4 (PF4) was measured to monitor -granule
release after ionomycin or thrombin stimulation. When the platelets
were stimulated with 0.5 µM ionomycin for 5 minutes at room
temperature, approximately 70% of the total PF4 in the -granules
was released (Figure 1A). Thrombin, a natural platelet stimulator, was
as effective as ionomycin (Figure 1A). The effect of -synuclein on
the -granule secretion from platelets was next investigated using
the established granule release assay system. When the platelets were
incubated with -synuclein, Ca++-induced PF4 release was
inhibited in a dose-dependent manner, but Ca++-induced PF4
release was not affected by BSA (Figure 1B). PF4 release was inhibited
up to 60% of its normal maximal release when the platelets were
incubated with 10 µM -synuclein. -Synuclein also appeared to
inhibit PF4 release when the platelets were stimulated with 0.1 U/mL
thrombin (Figure 1C).
Subsequently, the time course of inhibition caused by -synuclein
treatment was then investigated. A platelet solution was incubated with
10 µM -synuclein for 5, 10, 30, and 60 minutes before stimulation,
respectively, and the amount of PF4 release was measured. As shown in
Figure 1D, there was no significant difference in the inhibition level
at all the tested times, which suggests that the effect of
-synuclein occurs early. The incubation temperature (4°C, 25°C,
or 37°C) did not affect the inhibitory role of -synuclein on
-granule release (data not shown).
To confirm the observation that -synuclein inhibits -granule
release, CD62P expression was analyzed by flow cytometry before and
after stimulation in the presence or absence of -synuclein. CD62P is
a component of the -granule membrane that is only expressed on the
platelet surface after -granule secretion.31 As shown in Figure 2A, the platelets stimulated with ionomycin demonstrate a
marked increase in CD62P surface expression (dashed line).
Interestingly, the surface CD62P surface expression level was greatly
reduced in the presence of -synuclein (solid line). Similar results
were obtained when the platelets were stimulated with thrombin (Figure 2B). -Synuclein did not affect CD62P surface expression in resting platelets (data not shown). Flow cytometry data demonstrate that the
platelets exposed to -synuclein and then stimulated by an agonist,
particularly thrombin, fall into 2 discrete populations: those that are
still stimulated and those that are inhibited essentially to the
resting levels of CD62P expression. The reason for this result is
unclear, but it may be related to heterogeneous incorporation of
-synuclein.
Abeliovich et al21 suggested that -synuclein negatively
regulates dopamine release in neuronal cells. In addition, Forloni et
al34 reported that an externally applied NAC had an effect on dopamine level at concentrations 5 to 50 times lower than those affecting the cell viability in dopaminergic neuronal cells. Because dense granules in the platelets have properties similar to those of
small dense core granules containing catecholamine in neuron cells,35 -synuclein was investigated to determine
whether it could also affect the dense granule release from platelets.
To investigate the effect of -synuclein on the dense granule
release, platelets were incubated with [3H]5-HT and then
stimulated with 1 µM ionomycin or 1 U/mL thrombin in the presence or
absence of -synuclein. As shown in Figure 3A, the released
[3H]5-HT was approximately 34% and 60% of total
[3H]5-HT uptake in the absence or presence of 2 µM
imipramine, respectively. When the platelets were incubated with
-synuclein, [3H]5-HT release was not affected by
-synuclein in either the presence or the absence of imipramine
(Figure 3B,C, respectively). This indicates that -synuclein does not
play a role in the regulation of dense granule release and reuptake. We
also investigated the effect of -synuclein on lysosomal granule
release to observe whether it specifically inhibited -granule
release. Lysosomal granule release was measured by assaying the
released hexosaminidase activity (Figure 3D). As shown in Figure 3E,
lysosomal granule release was unaffected by either -synuclein or
-synuclein112. Overall, these results suggest that -synuclein
specifically regulates -granule release in platelets.
Effects of -synuclein point mutants, -synuclein112, and
-synuclein
The 2 point mutants of -synuclein (A30P and A53T), which are
associated with a few cases of familial Parkinson
disease,11,12 have been thoroughly examined to elucidate
the role of -synuclein in the pathogenesis of Parkinson disease.
These mutant forms of -synuclein appear to have different properties
than the wild-type with respect to the aggregation
patterns36,37 and cytotoxicity to cells.38
However, the pathologic role of the -synuclein mutation in Parkinson
disease is still controversial because most cases of Parkinson disease
are sporadic, and the point mutants are found only in the rare cases of
inherited Parkinson disease. In addition, these mutations did not cause
a change in the secondary structure of the protein, its interaction
with itself,39 or the intracellular distribution of the
protein in the cell cultures.40 The -synuclein point
mutants were also investigated to determine whether they have a
different effect in regulating Ca++-induced exocytosis of
-granules. When the platelets were incubated with these mutant
proteins, Ca++-induced PF4 release was also inhibited
similarly to wild-type -synuclein (Figure 4A), suggesting that the
point mutations (A30P, A53T, and A30P/A53T) do not affect the
regulatory function of -synuclein in -granule release.
The effects of -synuclein on -granule release from platelets were
also investigated. -Synuclein is a homolog of -synuclein. The
N-terminal amphipathic region of -synuclein is similar to that of
-synuclein, showing a 90% amino acid identity. However, the NAC
region lacks 11 central amino acids (amino acids 73-83), and the
C-terminal acidic tail has only 33% identity.41
Interestingly, our data demonstrate that -synuclein was also able to
negatively regulate -granule release from the platelets (Figure 4B).
In addition to -synuclein, -synuclein112, which is a deletion
mutant of -synuclein and lacks 28 amino acids at the C-terminal
acidic region (amino acids 103-130), was also able to negatively
regulate the -granule release from platelets (Figure 4C).
-Synuclein112 occurs naturally and is predominantly expressed in the
heart, skeletal muscles, and pancreas.42 The observations
that the PF4 release was inhibited by -synuclein and
-synuclein112, almost as effectively as -synuclein, suggest that
the conserved N-terminal region of the synuclein proteins may play an
important role in regulating -granule exocytosis.
Effects of -synuclein deletion mutants
Three -synuclein deletion mutants, Syn1-97, Syn61-140, and
Syn96-140, were synthesized to determine which part of -synuclein is
responsible for its negative regulatory function in -granule release
from platelets (Figure 5A,B). As shown in Figure 5C, none of these
deletion mutant proteins appeared to inhibit PF4 release. This suggests
that the deletion mutants, which completely lack either the N-terminal
amphipathic region or the C-terminal acidic tail, do not function as a
negative regulator of -granule release in platelets, although a
partial deletion of either the NAC peptide (as in -synuclein) or the
C-terminal acidic tail (as in -synuclein112) does not eliminate the
-synuclein function.
To better understand how exogenously added -synuclein inhibits
-granule release from the platelets, -synuclein was further investigated to determine whether it enters platelets and whether it is
confined to granules or actually moves into platelet cytosol. After
treating the platelets with -synuclein, the localization of
-synuclein was analyzed using confocal microscopy, and any -synuclein that entered the cytosol was detected by Western blot analysis. As shown in Figure 6, more
-synuclein was observed in the platelets treated with exogenous
-synuclein (Figure 6Aii) than in the normal platelets (Figure 6Ai).
Interestingly, exogenous -synuclein addition appeared to be
localized near the plasma membrane more abundantly than in the cytosol.
However, -synuclein was barely detected when the platelets were not
permeabilized with saponin in either the presence or absence of
-synuclein (Figure 6Aiii,Aiv, respectively). This suggests that
-synuclein penetrates the platelets and localizes in the cytosol and
near the plasma membrane. Previous studies have shown that endogenous -synuclein loosely associates with the plasma membrane and the -granules in platelets.23 Western blot analysis showed
that exogenously added -synuclein penetrated the platelets (Figure 6B), as had been previously observed in neuronal cells.17
Interestingly, Syn61-140 also appeared to penetrate the platelets, but
Syn96-140 did not (Figure 6B). This indicates that the NAC region
(residues 61-95) plays a critical role in the membrane translocation of -synuclein.

View larger version (31K):
[in this window]
[in a new window]
| Figure 6.
Exogenously added -synuclein and Syn61-140 penetrate
platelets.
(A) Confocal microscopic analysis of the platelets treated or not
treated with 10 µM -synuclein in the presence (i,ii) or absence
(iii,iv) of 0.1% saponin. (B) Western blot analysis of the platelets
either treated or not treated with 10 µM synuclein proteins. Lane 1, platelets not treated with -synuclein; lane 2, platelets treated
with -synucleinl; lane 3, platelets treated with Syn61-140; lane 4, platelets treated with Syn96-140.
|
|
-Synuclein does not affect the intracellular Ca++
level and the increase of intracellular Ca++ level on
stimulation
The intracellular Ca++ level was measured by using
Fura-2/AM to determine whether -synuclein changes the
intracellular Ca++ level on activation. When -synuclein
was added to the platelets, there was no difference in the
Ca++ level for up to 5 minutes (Figure
7A). The Ca++ level was also
unchanged when platelets were incubated with -synuclein for a long
time (up to 1 hour; data not shown). The intracellular Ca++
level was then measured using ionomycin stimulation in the presence or
absence of -synuclein. Figure 7B shows that -synuclein did not
affect the increase in the intracellular Ca++ level on
activation in the platelets. The intracellular Ca++ level
was also unaffected by -synuclein treatment when the platelets were
stimulated with 0.1 U/mL thrombin (data not shown). Therefore, these
results suggest that exogenous -synuclein addition has no effect on
Ca++ homeostasis in platelets.

View larger version (21K):
[in this window]
[in a new window]
| Figure 7.
Intracellular Ca++ level and increase of
intracellular Ca++ level on stimulation in the presence and
absence of -synuclein.
Purified platelets were incubated with Fura-2/AM for 1 hour
at room temperature and were washed with Tyrode solution.
Fura-2/AM fluorescence was then measured using a
fluorescence spectrophotometer. (A) At t = 60, after the start of the
run, 10 µM -synuclein was added. (B) At t = 60, after the start
of the run, 0.5 µM ionomycin was added in the presence or absence of
10 µM -synuclein.
|
|
Morphologic changes in the presence and absence of
-synuclein
Morphologic changes in platelets at the resting and
ionomycin-stimulated states in the presence or absence of -synuclein were next examined using TEM to observe the effects of the inhibition of granule release. As shown in Figure
8A-B, platelets at the resting state
maintained a normal morphology and evenly dispersed granules regardless
of the presence of -synuclein. When the platelets were stimulated
with ionomycin, they underwent morphologic changes typical of platelet
stimulation (Figure 8C). In particular, there was cytoskeletal
contraction, which crowds granules toward the center of the cell. The
central, darker area represents the residual cytoskeletal cage
surrounding the granules and forcing them to the center of the cell on
activation. This is a unique feature of granule exocytosis that is
commonly observed in platelets.43,44 Interestingly, the
morphology of ionomycin-stimulated platelets in the presence of
-synuclein (Figure 8D) was clearly different from that of
ionomycin-stimulated platelets in the absence of -synuclein (Figure
8C). It was also different from that at the resting state (Figure
8A,B). In particular, more intracellular granules were observed than in
the ionomycin-stimulated platelets, and the granules were more
homogenous than in the platelets at the resting state.

View larger version (203K):
[in this window]
[in a new window]
| Figure 8.
Morphologic changes of platelets on stimulation in the
presence and absence of -synuclein in electron microscopy.
Purified platelets were prepared as described in "Materials and
methods" and were fixed for TEM analysis. (A, B) Platelets in the
resting state in the absence (A) and presence (B) of recombinant
-synuclein. (C) Platelets that have been stimulated with 0.5 µM
ionomycin for 5 minutes before fixation. (D) Platelets that were
preincubated with 10 µM recombinant -synuclein before stimulation
with 0.5 µM ionomycin. Scale bars, 1µm.
|
|
 |
Discussion |
Previous studies have suggested that -synuclein may have a
regulatory function in dopamine release from neuronal
cells.21 In this study, the negative regulatory function
of exogenous -synuclein addition in granule release from platelets
was investigated for the following reasons. First, platelets are easy
to prepare, and they contain many secretory granules. In addition,
platelets have been proposed to be good peripheral models for studying
the aminergic neuronal function because they have some similarities to
neurons, including their ability to manufacture, store, release, and
take up monoamines.45 Second, previous reports have shown
that -synuclein is also expressed in hematopoietic cells, suggesting
that the biologic function of -synuclein is not restricted to
neuronal cells.22 In particular, the -synuclein
function has been implicated in the differentiation of megakaryocytes,
platelet precursors.23 In addition, many abnormalities of
platelets have been found in patients with a wide variety of
neurodegenerative diseases, including Alzheimer disease,46
Huntington disease,47 and Parkinson
disease.32,48-50 Moreover, Sharma et al51
reported that the incidence of ischemic stroke in patients with
Parkinson disease is lower than in the controls, and platelet
aggregation is also significantly decreased,51 suggesting
that granule release might be blocked. Factor et al52 reported that the platelets of patients with Parkinson disease have
more and larger intracytoplasmic vacuoles, containing numerous granular
molecules around the open canalicular system, than those of the
controls. This suggests that the platelets from patients with Parkinson
disease have unknown defects in their secretory pathways.
These experiments were designed and conducted on the basis of recent
observations showing that -synuclein can penetrate
cells.34,53 In support to these observations, Forloni et
al34 showed that fluorescent NAC peptides can penetrate
cells and accumulate in the perinuclear region. In addition, Volles et
al54 recently reported that the protofibrillar form of
-synuclein binds the synthetic vesicles tightly and transiently
permeabilizes these vesicles. In a previous report, -synuclein was
demonstrated to be able to penetrate a neuronal cell and induce cell
death.17 The data in this study also demonstrate that
-synuclein penetrates the platelets (Figure 6) and subsequently
affects -granule release on stimulation (Figures 1, 2). It is
believed that exogenously added -synuclein translocates the plasma
membrane and that the increased -synuclein level in the cytoplasm
affects the -granule release from the platelets. Interestingly,
Syn61-140 also appeared to enter platelets but Syn96-140 did not
(Figure 6B), suggesting that the NAC region (residues 61-95) plays a
critical role in -synuclein penetration of platelets. This
observation is consistent with a previous report showing that NAC
peptide can penetrate neuronal cells.34
Like the wild type of -synuclein, the 2 point mutants (A30P and
A53T) found in a familial type of Parkinson disease and the double
mutant (A30P/A53T) effectively inhibited PF4 release (Figure 4A).
-Synuclein and -synuclein112 also inhibited the -granule release from platelets (Figure 4B,C). Interestingly, however, the
deletion mutants, Syn1-97, 61-140, and 96-140 which completely lack
the C-terminal acidic tail, the N-terminal amphipathic region, and the
N-terminal and NAC regions, respectively did not inhibit -granule
release (Figure 5). These findings show that the N-terminal and the
C-terminal regions of -synuclein are essential for the negative
regulation of -granule release by exogenously added -synuclein.
Based on previous observations showing that the N- and C-terminal
regions have the potential to interact with the vesicle membranes and
other proteins, respectively,19,38,39 it is proposed that
the N-terminal region (residues 1-95) is important for membrane
translocation and the interaction with vesicles and that the C-terminal
region is necessary for the effector function, although the detailed
molecular mechanism requires further investigation.
Previous studies have demonstrated that some amyloidogenic proteins are
able to modulate the intracellular Ca++ level in
platelets.55 However, in our experiments, -synuclein did not appear to modulate the intracellular Ca++ levels
(Figure 7). Furthermore, -synuclein did not appear to interrupt the
increase in the intracellular Ca++ level caused by
stimulation with either ionomycin or thrombin, suggesting that
exogenously added -synuclein has no effect on the Ca++
homeostasis in platelets. These observations can be explained by the
suggestion that -synuclein regulates -granule release by a
specific interaction with the -granules, as was reported by
Hashimoto et al.23
For the exocytosis of granules, 3 steps are required: docking, for
moving the vesicles to the target membrane; priming, for preparing the
interaction between the vesicular membrane and the target membrane; and
fusion, for secreting the vesicles.35 It is well known
that the N-ethylmalemide attachment protein receptor (SNARE) complex is
mainly involved in the final fusion step.56 On the other
hand, some proteins are known to play a role in the movement of
granules by regulating the interaction between the vesicular membranes
and the cytoskeletal proteins. For example, a neuron-specific protein,
synapsin I, is involved in the movement of the synaptic
vesicles.57 It has been proposed that the function of
-synuclein found in the presynaptic terminals may be associated with
synaptic transmission, including neurotransmitter release and
uptake.41 In this study, -synuclein appeared
specifically to inhibit the -granule release induced by the increase
in the intracellular Ca++ level in platelets. If
-synuclein were to inhibit all 3 kinds of granules, the -granule,
the dense granule, and the lysosomal granule, in the platelets, then
-synuclein could act at either the proximal or the distal step in
the cascade of events leading to the agonist-induced granule secretion.
In contrast, the observation that -synuclein inhibits only
-granule secretion suggests that -synuclein may act distally in
the mechanism of granule release. Considering that the lipid
compositions of the various vesicles differ from each other and that
there is also an asymmetric distribution of lipid components in each
vesicle,58 it is not surprising that -synuclein appears
to specifically interact with the -granules. In fact, earlier
studies have shown that the interaction between -synuclein and the
synthetic vesicles is affected by the lipid composition of the
membranes and by the size of the vesicles themselves.59 In
addition, the TEM images of the platelets that were stimulated with
ionomycin in the presence of -synuclein (Figure 8D) suggest that
-synuclein may interrupt the step that occurs before membrane fusion, presumably by disrupting the integrity of the -granule membrane or by blocking the movement of the -granules to the plasma
membrane. Alternatively, -synuclein itself may have no effect on the
cytoskeleton but may inhibit granule centralization by preventing
-granule-dependent autocrine stimulation because the TEM image
suggests that incubation with -synuclein prevents granule
centralization after agonist stimulation (Figure 8D).
In summary, exogenous -synuclein addition negatively regulates
Ca++-dependent -granule release in platelets, and this
effect is unaffected by the Parkinson disease-associated point
mutations. -Synuclein112 and -synuclein have the same properties
as -synuclein. However, a complete deletion of either the N-terminal
or the C-terminal region eliminates the negative regulatory effect of
-synuclein on -granule release. The mechanism of the negative
regulatory effect of -synuclein appears to be related to the
specific binding of this protein to the -granule membrane.
Elaborating the consequence of the specific binding and searching for
the binding partner of -synuclein in the platelets is necessary to
clarify the molecular mechanism for the negative regulatory function of
-synuclein in granule release. Additional investigations designed to
reveal the association between these findings and the pathogenesis of Parkinson disease would lead to useful tools for diagnosis and pathologic study of the disease.
 |
Acknowledgments |
We thank Dr R. Jakes (Medical Research Council, Cambridge) for the
recombinant - and -synuclein cDNAs; Drs. W. Y. Lee, M. K. Lee, E. C. Shin, H. M. Kim, and H. I. Kim for their
helpful discussions; and Dr J. T. Seo and H. J. Shin for
technical assistance. We also thank Dr J. T. Seo for giving us
access to the spectrofluorometer used for Ca++ level measurements.
 |
Footnotes |
Submitted September 17, 2001; accepted May 16, 2002.
Supported by a research grant from the Korea Research Foundation
(KRF-2001-DP0517).
The publication costs of this
article were defrayed in part by
page charge payment. Therefore,
and solely to indicate this fact,
this article is hereby marked
"advertisement"
in accordance with 18 U.S.C.
section 1734.
Reprints: Jongsun Kim, Department of Microbiology, Yonsei
University College of Medicine, 134 Shinchon-dong, Seodaemoon-gu, Seoul
120-752, Korea; e-mail: jkim63{at}yumc.yonsei.ac.kr.
 |
References |
1.
Jakes R, Spillantini MG, Goedert M.
Identification of two distinct synucleins from human brain.
FEBS Lett.
1994;345:27-32[CrossRef][Medline]
[Order article via Infotrieve].
2.
Ueda K, Fukushima H, Masliah E, et al.
Molecular cloning of cDNA encoding an unrecognized component of amyloid in Alzheimer disease.
Proc Natl Acad Sci U S A.
1993;90:11282-11286[Abstract/Free Full Text].
3.
Lavedan C.
The synuclein family.
Genome Res.
1998;8:871-880[Abstract/Free Full Text].
4.
Maroteaux L, Campanelli JT, Scheller RH.
Synuclein: a neuron-specific protein localized to the nucleus and presynaptic nerve terminal.
J Neurosci.
1988;8:2804-2815[Abstract].
5.
Ji H, Liu YE, Jia T, et al.
Identification of a breast cancer-specific gene, BCSG1, by direct differential cDNA sequencing.
Cancer Res.
1997;57:759-764[Abstract/Free Full Text].
6.
Surguchov A, Surgucheva I, Solessio E, Baehr W.
Synoretin a new protein belonging to the synuclein family.
Mol Cell Neurosci.
1999;13:95-103[CrossRef][Medline]
[Order article via Infotrieve].
7.
Spillantini MG, Schmidt ML, Lee VM, et al.
-Synuclein in Lewy bodies.
Nature.
1997;388:839-840[CrossRef][Medline]
[Order article via Infotrieve].
8.
Spillantini MG, Crowther RA, Jakes R, Hasegawa M, Goedert M.
-Synuclein in filamentous inclusions of Lewy bodies from Parkinson's disease and dementia with lewy bodies.
Proc Natl Acad Sci U S A.
1998;95:6469-6473[Abstract/Free Full Text].
9.
Takeda A, Mallory M, Sundsmo M, et al.
Abnormal accumulation of NACP/ -synuclein in neurodegenerative disorders.
Am J Pathol.
1998;152:367-372[Abstract].
10.
Wakabayashi K, Yoshimoto M, Tsuji S, Takahashi H.
Alpha-synuclein immunoreactivity in glial cytoplasmic inclusions in multiple system atrophy.
Neurosci Lett.
1998;249:180-182[CrossRef][Medline]
[Order article via Infotrieve].
11.
Kruger R, Kuhn W, Muller T, et al.
Ala30Pro mutation in the gene encoding -synuclein in Parkinson's disease.
Nat Genet.
1998;18:106-108[CrossRef][Medline]
[Order article via Infotrieve].
12.
Polymeropoulos MH, Lavedan C, Leroy E, et al.
Mutation in the -synuclein gene identified in families with Parkinson's disease.
Science.
1997;276:2045-2047[Abstract/Free Full Text].
13.
El-Agnaf OM, Jakes R, Curran MD, et al.
Aggregates from mutant and wild-type -synuclein proteins and NAC peptide induce apoptotic cell death in human neuroblastoma cells by formation of beta-sheet and amyloid-like filaments.
FEBS Lett.
1998;440:71-75[CrossRef][Medline]
[Order article via Infotrieve].
14.
Saha AR, Ninkina NN, Hanger DP, et al.
Induction of neuronal death by -synuclein.
Eur J Neurosci.
2000;12:3073-3077[CrossRef][Medline]
[Order article via Infotrieve].
15.
da Costa CA, Ancolio K, Checler F.
Wild-type but not Parkinson's disease-related ala-53 Thr mutant -synuclein protects neuronal cells from apoptotic stimuli.
J Biol Chem.
2000;275:24065-24069[Abstract/Free Full Text].
16.
Hsu LJ, Sagara Y, Arroyo A, et al.
-Synuclein promotes mitochondrial deficit and oxidative stress.
Am J Pathol.
2000;157:401-410[Abstract/Free Full Text].
17.
Sung JY, Kim J, Paik SR, et al.
Induction of neuronal cell death by Rab5A-dependent endocytosis of -synuclein.
J Biol Chem.
2001;276:27441-27448[Abstract/Free Full Text].
18.
George JM, Jin H, Woods WS, Clayton DF.
Characterization of a novel protein regulated during the critical period for song learning in the zebra finch.
Neuron.
1995;15:361-372[CrossRef][Medline]
[Order article via Infotrieve].
19.
Davidson WS, Jonas A, Clayton DF, George JM.
Stabilization of -synuclein secondary structure upon binding to synthetic membranes.
J Biol Chem.
1998;273:9443-9449[Abstract/Free Full Text].
20.
Jenco JM, Rawlingson A, Daniels B, Morris AJ.
Regulation of phospholipase D2: selective inhibition of mammalian phospholipase D isoenzymes by - and -synucleins.
Biochemistry.
1998;37:4901-4909[CrossRef][Medline]
[Order article via Infotrieve].
21.
Abeliovich A, Schmitz Y, Farinas I, et al.
Mice lacking -synuclein display functional deficits in the nigrostriatal dopamine system.
Neuron.
2000;25:239-252[CrossRef][Medline]
[Order article via Infotrieve].
22.
Shin EC, Cho SE, Lee DK, et al.
Expression patterns of -synuclein in human hematopoietic cells and in Drosophila at different developmental stages.
Mol Cells.
2000;10:65-70[Medline]
[Order article via Infotrieve].
23.
Hashimoto M, Yoshimoto M, Sisk A, et al.
NACP, a synaptic protein involved in Alzheimer's disease, is differentially regulated during megakaryocyte differentiation.
Biochem Biophys Res Commun.
1997;237:611-616[CrossRef][Medline]
[Order article via Infotrieve].
24.
Paik SR, Lee JH, Kim DH, Chang CS, Kim J.
Aluminum-induced structural alterations of the precursor of the non-A beta component of Alzheimer's disease amyloid.
Arch Biochem Biophys.
1997;344:325-334[CrossRef][Medline]
[Order article via Infotrieve].
25.
Kim TD, Paik SR, Yang CH, Kim J.
Structural changes in -synuclein affect its chaperone-like activity in vitro.
Protein Sci.
2000;9:2489-2496[Medline]
[Order article via Infotrieve].
26.
Park SM, Jung HY, Chung KC, et al.
Stress-induced aggregation profiles of GST- -synuclein fusion proteins: role of the C-terminal acidic tail of -synuclein in protein thermosolubility and stability.
Biochemistry.
2002;41:4137-4146[CrossRef][Medline]
[Order article via Infotrieve].
27.
Paik SR, Shin HJ, Lee JH.
Metal-catalyzed oxidation of -synuclein in the presence of Copper(II) and hydrogen peroxide.
Arch Biochem Biophys.
2000;378:269-277[CrossRef][Medline]
[Order article via Infotrieve].
28.
Mustard JF, Kinlough-Rathbone RL, Packham MA.
Isolation of human platelets from plasma by centrifugation and washing.
Methods Enzymol.
1989;169:3-11[Medline]
[Order article via Infotrieve]
29.
Lemons PP, Chen D, Whiteheart SW.
Molecular mechanisms of platelet exocytosis: requirements for -granule release.
Biochem Biophys Res Commun.
2000;267:875-880[CrossRef][Medline]
[Order article via Infotrieve].
30.
Shattil SJ, Cunningham M, Hoxie JA.
Detection of activated platelets in whole blood using activation-dependent monoclonal antibodies and flow cytometry.
Blood.
1987;70:307-315[Abstract/Free Full Text]
31.
Michelson AD.
Flow cytometry: a clinical test of platelet function.
Blood.
1996;87:4925-4936[Free Full Text]
32.
Barbeau A, Campanella G, Butterworth RF, Yamada K.
Uptake and efflux of 14C-dopamine in platelets: evidence for a generalized defect in Parkinson's disease.
Neurology.
1975;25:1-9[Abstract/Free Full Text].
33.
Holmsen H, Dangelmaier CA.
Measurement of secretion of lysosomal acid glycosidases.
Methods Enzymol.
1989;169:336-342[Medline]
[Order article via Infotrieve]
34.
Forloni G, Bertani I, Calella AM, Thaler F, Invernizzi R.
-Synuclein and Parkinson's disease: selective neurodegenerative effect of alpha-synuclein fragment on dopaminergic neurons in vitro and in vivo.
Ann Neurol.
2000;47:632-640[CrossRef][Medline]
[Order article via Infotrieve].
35.
Reed GL, Fitzgerald ML, Polgar J.
Molecular mechanisms of platelet exocytosis: insights into the "secrete" life of thrombocytes.
Blood.
2000;96:3334-3342[Free Full Text].
36.
Narhi L, Wood SJ, Steavenson S, et al.
Both familial Parkinson's disease mutations accelerate -synuclein aggregation.
J Biol Chem.
1999;274:9843-9846[Abstract/Free Full Text].
37.
Conway KA, Lee SJ, Rochet JC, et al.
Acceleration of oligomerization, not fibrillization, is a shared property of both -synuclein mutations linked to early-onset Parkinson's disease: implications for pathogenesis and therapy.
Proc Natl Acad Sci U S A.
2000;97:571-576[Abstract/Free Full Text].
38.
Ostrerova N, Petrucelli L, Farrer M, et al.
-Synuclein shares physical and functional homology with 14-3-3 proteins.
J Neurosci.
1999;19:5782-5791[Abstract/Free Full Text].
39.
Conway KA, Harper JD, Lansbury PT.
Accelerated in vitro fibril formation by a mutant -synuclein linked to early-onset Parkinson disease.
Nat Med.
1998;4:1318-1320[CrossRef][Medline]
[Order article via Infotrieve].
40.
McLean PJ, Kawamata H, Ribich S, Hyman BT.
Membrane association and protein conformation of -synuclein in intact neurons: effect of Parkinson's disease-linked mutations.
J Biol Chem.
2000;275:8812-8816[Abstract/Free Full Text].
41.
Lücking CB, Brice A.
-Synuclein and Parkinson's disease.
Cell Mol Life Sci.
2000;57:1894-1908[CrossRef][Medline]
[Order article via Infotrieve].
42.
Ueda K, Saitoh T, Mori H.
Tissue-dependent alternative splicing of mRNA for NACP, the precursor of non-A beta component of Alzheimer's disease amyloid.
Biochem Biophys Res Commun.
1994;205:1366-1372[CrossRef][Medline]
[Order article via Infotrieve].
43.
Hartwig JH, DeSisto M.
The cytoskeleton of the resting human blood platelet: structure of the membrane skeleton and its attachment to actin filaments.
J Cell Biol.
1991;112:407-425[Abstract/Free Full Text].
44.
Hartwig JH.
Mechanisms of actin rearrangements mediating platelet activation.
J Cell Biol.
1992;118:1421-1442[Abstract/Free Full Text].
45.
Da Prada M, Cesura AM, Launay JM, Richards JG.
Platelets as a model for neurones?
Experientia.
1988;44:115-126[CrossRef][Medline]
[Order article via Infotrieve].
46.
Zubenko GS, Wusylko M, Cohen BM, Boller F, Teply I.
Family study of platelet membrane fluidity in Alzheimer's disease.
Science.
1987;238:539-542[Abstract/Free Full Text].
47.
Aminoff MJ, Trenchard A, Turner P, Wood WG, Hills M.
Plasma uptake of dopamine and 5-hydroxytryptamine and plasma-catecholamine levels in patients with Huntington's chorea.
Lancet.
1974;2:1115-1116[Medline]
[Order article via Infotrieve].
48.
Bonuccelli U, Piccini P, Del Dotto P, et al.
Platelet monoamine oxidase B activity in parkinsonian patients.
J Neurol Neurosurg Psychiatry.
1990;53:854-855[Abstract/Free Full Text].
49.
Blake CI, Spitz E, Leehey M, Hoffer BJ, Boyson SJ.
Platelet mitochondrial respiratory chain function in Parkinson's disease.
Mov Disord.
1997;12:3-8[CrossRef][Medline]
[Order article via Infotrieve].
50.
Rabey JM, Shabtai H, Graff E, Oberman Z.
[3H] dopamine uptake by platelet storage granules in Parkinson's disease.
Life Sci.
1993;53:1753-1759[CrossRef][Medline]
[Order article via Infotrieve]
51.
Sharma P, Nag D, Atam V, Seth PK, Khanna VK.
Platelet aggregation in patients with Parkinson's disease.
Stroke.
1991;22:1607-1608[Free Full Text].
52.
Factor SA, Ortof E, Dentinger MP, Mankes R, Barron KD.
Platelet morphology in Parkinson's disease: an electron microscopic study.
J Neurol Sci.
1994;122:84-89[CrossRef][Medline]
[Order article via Infotrieve].
53.
Borghi R, Marchese R, Negro A, et al.
Full length -synuclein is present in cerebrospinal fluid from Parkinson's disease and normal subjects.
Neurosci Lett.
2000;287:65-67[CrossRef][Medline]
[Order article via Infotrieve].
54.
Volles MJ, Lee SJ, Rochet JC, et al.
Vesicle permeabilization by protofibrillar -synuclein: implications for the pathogenesis and treatment of Parkinson's disease.
Biochemistry.
2001;40:7812-7819[CrossRef][Medline]
[Order article via Infotrieve].
55.
Hedin HL, Eriksson S, Fowler CJ.
Human platelet calcium mobilisation in response to beta-amyloid (25-35): buffer dependency and unchanged response in Alzheimer's disease.
Neurochem Int.
2001;38:145-151[CrossRef][Medline]
[Order article via Infotrieve].
56.
Sollner T, Bennett MK, Whiteheart SW, Scheller RH, Rothman JE.
A protein assembly-disassembly pathway in vitro that may correspond to sequential steps of synaptic vesicle docking, activation, and fusion.
Cell.
1993;75:409-418[CrossRef][Medline]
[Order article via Infotrieve].
57.
Valtorta F, Benfenati F, Greengard P.
Structure and function of the synapsins.
J Biol Chem.
1992;267:7195-7198[Free Full Text].
58.
Perrin RJ, Woods WS, Clayton DF, George JM.
Interaction of human -synuclein and Parkinson's disease variants with phospholipids: structural analysis using site-directed mutagenesis.
J Biol Chem.
2000;275:34393-34398[Abstract/Free Full Text].
59.
Jo E, McLaurin J, Yip CM, St George-Hyslop P, Fraser PE.
-Synuclein membrane interactions and lipid specificity.
J Biol Chem.
2000;275:34328-34334[Abstract/Free Full Text].

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
M. Ungerer, M. Peluso, A. Gillitzer, S. Massberg, U. Heinzmann, C. Schulz, G. Munch, and M. Gawaz
Generation of Functional Culture-Derived Platelets From CD34+ Progenitor Cells to Study Transgenes in the Platelet Environment
Circ. Res.,
September 3, 2004;
95(5):
e36 - e44.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|