| |
|
|
|
|
|
|
|||
|
Prepublished online as a Blood First Edition Paper on June 7, 2002; DOI 10.1182/blood-2001-12-0291.
IMMUNOBIOLOGY
From the Departments of Hematology and Gynecology,
Catholic University Medical School, Rome, and the Laboratory of
Clinical Pathology and Microbiology, IRCCS San Gallicano, Rome, Italy.
Granulocyte colony-stimulating factor (G-CSF) may affect
T-cell homeostasis by multiple mechanisms, inducing polarization of
cytokine secretion, inhibition of T-cell proliferation, and enhancement
of T-cell apoptosis. We analyzed the production of interleukin-10
(IL-10) and transforming growth factor- Hematopoietic stem cells (HSCs) circulate in the
peripheral blood, and clinical provision of cytokines such as
granulocyte-colony-stimulating factor (G-CSF) alone or along with
cytoreductive chemotherapy has the ability to increase dramatically HSC
frequency.1 HSC transplantation (HSCT) has become a
powerful strategy for the treatment of leukemia, aplastic anemia,
congenital immunodeficiencies, hemoglobin disorders, and autoimmune and
degenerative diseases.2 In particular, allogeneic HSCs may
be useful for cancer treatment and in a nonmalignant clinical
setting and might lead to donor-specific chimerism for inducing
lifelong tolerance to tissue or organ
transplantation.2
To date, results of allogeneic peripheral blood HSCT for hematologic
malignancies suggest that this technique has potential advantages over
conventional bone marrow transplantation1 given that
hematopoietic engraftment might be more prompt because of the infusion
of so-called facilitator T cells, and the antileukemic effect of T
cells contained within the graft may be enhanced. Although T-cell dose
in peripheral blood HSC allografts is markedly higher than in bone
marrow allografts, the level of acute graft-versus-host disease (GVHD)
has been tolerable.1 Several explanations for this
phenomenon have been proposed, including functional alteration of T
cells in G-CSF-mobilized allografts. Support for this hypothesis stems
from recent studies in mice and in humans. New properties of G-CSF as a
modulator of the immune response have been postulated, for example, in
indirect actions on T-cell function through bystander cells, endogenous
mediators, or effects on bone marrow lymphoid precursors.3-6
The impact of G-CSF on cytokine secretion by human T cells remains
controversial. Some studies describe the polarization of T-cell
responses toward a helper T cell type 2 (TH2)
functional profile, and others document the inhibition of helper T cell
type 1 (TH1) and TH2 cytokine
production.7,8 Previously, we demonstrated that G-CSF can
inhibit T-cell proliferation in response to polyclonal mitogens by
modulating the expression of key components of the cell cycle machinery
at the G1-S transition9,10; furthermore, soluble inhibitory factors elicited by G-CSF can favor the execution of
T-cell apoptosis through increased bax expression, collapse of mitochondrial transmembrane potential, caspase-3 cleavage, and DNA
fragmentation.11
Protective immunity to foreign antigens and control of autoaggressive
immune reactions are ensured by T regulatory (Tr) cells.12 Tr cells have been described in a variety of experimental systems and
have the ability to protect from autoimmune diseases,12 inflammatory bowel disease,13 allograft rejection, and
cyclosporin A-induced autologous GVHD.14 Specifically, Tr
cells with high interleukin-10 (IL-10) or transforming growth
factor- Herein we report that highly purified CD4+ T cells from
healthy HSC donors receiving G-CSF acquire the functional properties of
Tr cells after activation with alloantigens and secrete high amounts of
IL-10 and moderate amounts of TGF- Characteristics of HSC donors
T-cell isolation and stimulation
Transwell experiments Coculture experiments were performed with Transwell systems (MilliCell inserts, 0.4 µM; Millipore, Watford, United Kingdom) for the assessment of regulatory properties of post-G MLRCD4+ T cells against nonregulatory autologous pre-G MLRCD4+ T cells (indicator CD4+ T cells). Both chambers of each Transwell received irradiated allogeneic TCD PBMCs as stimulator cells. The proliferation of indicator CD4+ T cells plated in the lower chamber was monitored in the absence of direct contact with 5 × 105 post-G MLRCD4+ T cells from the same HSC donor, placed in the upper compartment of the Transwell (primary cocultures). In selected coculture experiments, neutralizing anti-TGF- 1 (20 ng/mL) or anti-IL-10 antibodies (10 µg/mL; both from R&D Systems) were added as indicated in the figure legends. After 7 days, the basket was removed and proliferation of
autologous indicator CD4+ T cells was measured, as will
be detailed.
Antigen specificity of suppression mediated by post-G MLRCD4+ T cells was assessed in secondary cocultures. Briefly, pre-G CD4+ T cells were stimulated with allogeneic TCD PBMC from different donors (donor A or donor B). Seven days later, these donor A- or donor B-specific indicator CD4+ T cells were restimulated with allogeneic TCD PBMCs from donor A or donor B, separated through Transwell chambers by suppressor post-G CD4+ T cells. The proliferation of indicator CD4+ T cells was estimated, as will be described. Immunologic markers Expression of informative activation-differentiation antigens and that of receptors for representative CC and CXC subfamilies of chemokines was investigated by flow cytometry. Briefly, aliquots of MLRCD4+ T cells were incubated for 20 minutes at 4°C with pretitrated amounts of the following fluorescein isothiocyanate (FITC)- or phycoerythrin (PE)-conjugated monoclonal antibodies (mAbs): CD45RA (L48 clone, immunoglobulin G1 [IgG1]), CD45RO (UCHL-1 clone, IgG1), CD25 (2A3 clone, IgG1), CD40L (CD154; 89-76 clone, IgG1), CD44 (L178 clone, IgG1; Becton Dickinson, Mountain View, CA), CD122 (IL-2 receptor -chain [IL-2R
-chain]; Mik- 3 clone, IgG1), CD132 (IL-2R
-chain; AG184 clone, IgG1), CD45RB (MT4 clone,
IgG1), CXCR3 (CD183; 1C6 clone, IgG1), CXCR4
(CD184; 12G5 clone, IgG2a), CCR5 (CD195; 2D7 clone,
IgG2a), CCR6 (11A9 clone, IgG1), CCR7 (CDw197;
2H4 clone; IgM; PharMingen, San Diego, CA), CD28 (15E8 clone,
IgG1), CD62L (DREG-56 clone, IgG1), CD95 (DX2
clone, IgG1), CD95L (CD178; ALF-2.1 clone,
IgG2a), CD38 (HIT2 clone, IgG1; Caltag Laboratories, Burlingame, CA) or with the appropriate
fluorochrome-conjugated, isotype-matched irrelevant mAbs to establish
background fluorescence. Cells labeled with the primary unconjugated
anti-CCR7 mAb were further incubated with FITC-conjugated
goat-anti-mouse mAb (Caltag Laboratories) for 30 minutes at 4°C.
After washings with PBS, cells were kept on ice until flow
cytometric analysis.
Analysis of cytokine production The frequency of cytokine-producing CD4+ T cells was evaluated as previously described.21 Briefly, MLRCD4+ T cells were exposed to a protein transport inhibitor (1 µg/mL Brefeldin A; Sigma Chemical, St Louis, MO) during the last 4 hours of culture. Cells were then fixed with 1% paraformaldehyde for 15 minutes at room temperature, and underwent permeabilization with 0.01% saponin and incubation with FITC- or PE-conjugated anti-interferon (IFN)- mAb (NIB42 clone,
IgG1; Becton Dickinson), anti-IL-10 mAb (B-N10 clone,
IgG2b; Valter Occhiena, Turin, Italy), or anti-IL-4 mAb
(8D4-8 clone, IgG1; Becton Dickinson) or with unconjugated
anti-TGF- 1 rabbit polyclonal antibodies (Santa Cruz Biotechnology,
CA) for 30 minutes at 4°C. After washings with PBS, FITC-conjugated
goat-anti-rabbit antibodies (Caltag Laboratories) were added to
CD4+ T cells stained with the primary unconjugated
anti-TGF- 1 antibody, and these CD4+ T cells were
further incubated for 30 minutes at 4°C before flow cytometric
analysis. Recombinant cytokines (all from R&D Systems) were always
included to control for the specificity of mAb binding.
Cytokine synthesis was evaluated by the analysis of supernatants 7 days
after alloantigen stimulation. IL-2, IL-4, IL-10, and TGF- Generation of dendritic cells for autologous MLR PBMCs were seeded at 0.5 × 107/mL into 6-well culture plates containing AIM-V (Invitrogen, Carlsbad, CA) supplemented with 0.5% human serum albumin. After 2 hours at 37°C, nonadherent cells were removed, and adherent cells were cultured at 37°C in a humidified 6% CO2-95% air incubator in the presence of recombinant human granulocyte macrophage (GM)-CSF (800 IU/mL) and IL-4 (500 IU/mL; both from R&D Systems). After 7 days of culture, tumor necrosis factor- (TNF- ) (R&D Systems) was added at
1000 IU/mL to induce dendritic cell (DC) maturation.23
Pre-G indicator CD4+ T cells were cultured with irradiated
(25 Gy) DCs at a 1:3 stimulator-responder ratio in the lower chamber of
a Transwell system, separated by post-G CD4+ T cells in the
upper compartment of the Transwell. To test for antigen-specific T-cell
responses, cultures were performed in the presence of a recall antigen
(purified protein derivative of Mycobacterium tuberculosis
[PPD]; 20 µg/mL final concentration; Staten Serum Institute,
Copenhagen, Denmark). During the last 24 hours of culture, pre-G
indicator CD4+ T cells were pulsed with bromodeoxyuridine
(BrdUrd), and proliferation was evaluated as detailed below. Cocultures
of indicator CD4+ T cells and DCs not pulsed with PPD were
always included to control for the antigen dependency of the response.
Proliferation assays and cell cycle analysis During the last 24 hours of the MLR, cells were pulsed with 25 µM BrdUrd (Sigma Chemical); cultures were stopped, and cells were fixed with ice-cold 70% ethanol.10 After partial DNA denaturation with 3 N HCl containing 0.5% Tween-20, cells were incubated for 30 minutes at 4°C with FITC-conjugated anti-BrdUrd mAb (BR-3 clone, IgG1; Caltag Laboratories) or with isotype-matched irrelevant mAbs to establish background fluorescence; cells not exposed to BrdUrd were used to evaluate the specificity of the anti-BrdUrd staining. Cellular DNA content was measured by resuspending the BrdUrd-labeled cells in DNA staining buffer (5 µg/mL propidium iodide, 2 mg/mL RNase; Sigma Chemical) before flow cytometric analysis.Messenger RNA detection RNA was isolated with the RNeasy minikit (Qiagen, Hilden, Germany) and was reverse-transcribed with 25 U Moloney murine leukemia virus reverse transcriptase (RT; Perkin Elmer Cetus, San Diego, CA) at 42°C for 30 minutes in the presence of random hexamers. Two microliters cDNA product was amplified with 1 U Amplitaq Gold (Perkin Elmer) in the presence of primers specific for the gene of interest, together with primers specific for the housekeeping gene aldolase-A. The ratio between the sample RNA to be determined and aldolase-A was calculated to normalize for initial variations in sample concentration and as a control for reaction efficiency, as reported.24 Reverse transcription-polymerase chain reaction (RT-PCR) was performed using the following oligonucleotides: GATA-3 forward, TAAACGAGCTGTTCTTGGGG; GATA-3 reverse, GTCCTGTGCGAACTGTCAGA; aldolase-A forward, CGCAGAAGGGGTCCTGGTGA; aldolase-A reverse, CAGCTCCTTCTTCTGCTCCGGGGT (Pharmacia Biotech, Uppsala, Sweden). Band intensity was quantified with Photoretix 1D (Photoretix International, Newcastle-upon-Tyne, United Kingdom) and was expressed as relative absorbance units.24Flow cytometry and immunofluorescence analysis Samples were run through a FACScan flow cytometer (Becton Dickinson) equipped with an argon laser emitting at 488 nm. The fluorescence of FITC was recorded in FL1 (525 nm), and the fluorescence of PE and propidium iodide was recorded in FL2 (575 nm), after suitable electronic compensation. A minimum of 10 000 events was acquired in list mode using CellQuest software. Details on instrument settings and requirements are published elsewhere.11,25Statistical analysis The approximation of population distribution to normality was tested using statistics for kurtosis and symmetry. Results were asymmetrically distributed and, consequently, were presented as median values and ranges. All comparisons were performed with the Wilcoxon W test for paired determinations or the Mann-Whitney U test for unpaired data, as appropriate. The criterion for statistical significance was defined as P .05.
Cytokine production by MLRCD4+ T cells To provide a quantitative measure of the cytokine-producing ability of T cells after their exposure to G-CSF, pre-G and post-G CD4+ T cells from the same HSC donor were challenged with irradiated TCD PBMCs from an unrelated healthy volunteer. Alloantigen-activated post-G MLRCD4+ T cells showed a general suppression of cytokine production; the frequency of cells expressing intracellular IL-2 and IL-4 was significantly lower than that of pre-G MLRCD4+ T cells (Table 1). Similarly, IFN- production by
post-G MLRCD4+ T cells was
decreased (data not shown). When the percentage of CD4+ T
cells releasing IL-10 and TGF- 1 was evaluated, a significant increase in the frequency of post-G
MLRCD4+ T cells expressing
intracellular IL-10 was found; conversely, the frequency of post-G
MLRCD4+ T cells reactive with the
anti-TGF- 1 mAb was unchanged compared with pre-G
MLRCD4+ T cells (Table 1). Thus, only
a small proportion of post-G MLRCD4+
T cells had a Tr1-like cytokine production profile
(IL-10++TGF- 1+IL-2low/ IL-4low/ )
as judged by the flow cytometric analysis at the single-cell level.
Cytokine release in culture supernatants was next evaluated using
sensitive and specific enzyme-linked immunosorbent assay (ELISA). As
shown in Table 1, post-G MLRCD4+ T
cells produced higher amounts of IL-10 than did pre-G
MLRCD4+ T cells; furthermore,
significant levels of TGF-
Cell surface phenotype of MLRCD4+ T cells Next, post-G MLRCD4+ T cells were analyzed for the expression of informative activation-differentiation antigens; levels of surface antigen expression were compared with those of pre-G MLRCD4+ T cells. No differences were found between freshly isolated pre-G and post-G CD4+ T cells for the expression pattern of the cell-surface antigens detailed in "Patients, materials, and methods" (data not shown), thus confirming results of previous studies.9 In particular, the percentage of CD4+ T cells constitutively expressing CD25 was not significantly different between peripheral blood pre-G and post-G cells (12% [range, 7%-15%] vs 11% [range, 8%-12%], respectively). Conversely, alloantigen-activated post-G CD4+ T cells showed unique phenotypic features. The activation-costimulatory molecules CD62L and CD28 were detected on lower percentages of post-G than of pre-G MLRCD4+ T cells (Figure 2). Post-G MLRCD4+ T cells expressed the highest frequency and intensity of the IL-2R -chain (CD122) and -chain
(CD132); in contrast, the inducible expression of the IL-2R -chain
(CD25) was comparable on pre-G and post-G
MLRCD4+ T cells (Figure 2). CD45RA
and CD45RO antigens, considered as markers of naive and memory cells,
respectively, were found at comparable levels in pre-G and post-G
MLRCD4+ T cells, as were CD45RB
expression pattern and CD95, CD95L, and CD40L levels (Figure 2).
Finally, post-G MLRCD4+ T cells
expressed high levels of CCR7 and CXCR4 chemokine receptors (Figure
3). Whereas CXCR3 and CCR5 receptors were
detected on marginal proportions of pre-G and post-G
MLRCD4+ T cells, a distinct subset of
MLRCD4+ T cells staining positively
with the anti-CCR6 mAb could be resolved only in pre-G
MLRCD4+ T-cell cultures.
Collectively, these experiments showed that post-G
MLRCD4+ T cells preferentially
expressed markers characteristic of activated-memory T cells, in
conjunction with reduced levels of the costimulatory molecule
CD28.
Proliferation of MLRCD4+ T cells Because Tr1 cells have an intrinsically low ability to proliferate in response to antigen activation,13 experiments were conducted to determine whether the functional polarization of post-G MLRCD4+ T cells to a Tr1-like profile was associated with inhibited proliferation. In line with previously published data,10 the frequency of post-G MLRCD4+ T cells incorporating BrdUrd, in response to stimulation through the T-cell receptor (TCR) for antigen, was significantly lower than T-cell responses in the same donor before G-CSF was given (Figure 4).
Defective production of the TH1-promoting cytokine IL-12 by
antigen-presenting cells has been advocated as a potential mechanism of
suppression of T-cell function by G-CSF.27 With these
findings in mind, we provided exogenous IL-12 to hyporesponsive post-G MLRCD4+ T cells and measured T-cell
proliferation after 4 days of culture. Unexpectedly, IL-12 was
incapable of restoring post-G MLRCD4+
T-cell proliferation to the levels recorded in pre-G
MLRCD4+ T cells (Figure
5). Conversely, high levels of bystander
proliferation were found in post-G
MLRCD4+ T cells after their exposure
to IL-2, IL-15, or both (Figure 5), approaching proliferative responses
of similarly costimulated pre-G
MLRCD4+ T cells (data not shown).
Post-G MLRCD4+ T cells suppress the alloproliferative response of autologous T cells in a cell-contact-independent and an antigen-nonspecific manner We then analyzed the regulatory properties of post-G MLRCD4+ T cells. To this purpose, freshly isolated post-G CD4+ T cells were immediately cocultured with pre-G CD4+ T cells from the same donor (primary coculture), or they were first separately activated and such prestimulated CD4+ T cells were used for secondary cocultures. As shown in Figure 6A, post-G MLRCD4+ T cells inhibited the alloreactivity of indicator CD4+ T cells in primary coculture, suggesting that cell-cell contact was dispensable for the regulatory function of post-G MLRCD4+ T cells. Parallel coculture experiments conducted in the absence of a Transwell showed that post-G MLRCD4+ T cells suppressed by a median of 30% the proliferation of indicator CD4+ T cells if added directly to the culture (data not shown). In addition, we found that significant suppression of bystander autologous CD4+ T cells was induced by the transfer of cell-free supernatants of activated post-G MLRCD4+ T cells (data not shown). As depicted in Figure 6B, the in vitro suppressive activities of post-G MLRCD4+ T cells were partially reversed by the addition of neutralizing antibodies to the cytokines IL-10 and TGF- 1. Interestingly, after removal of the suppressor
cells from the coculture, indicator CD4+ T cells remained
in a nonproliferating state and entered the cell cycle only if
supplemented with exogenous IL-2 or IL-15 or, slightly more pronounced,
the combination of both cytokines (data not shown). Because T-cell
expansion may induce the recovery of responsiveness by T cells
anergized in vitro, we tested the suppressive activity of post-G
MLRCD4+ T cells after 4 days of
costimulation with IL-2, IL-15, or both. Notably, cytokine-costimulated
post-G MLRCD4+ T cells retained their
suppressive activity in contrast to indicator CD4+ T cells,
which continued not to be suppressive (data not shown).
Further studies were conducted to investigate the antigen specificity
of the suppression mediated by post-G
MLRCD4+ T cells. In the 2-stage
culture system that we used, post-G
MLRCD4+ T cells were first
preactivated with TCD PBMCs from an HLA-mismatched healthy donor (donor
A), and these donor A-specific post-G
MLRCD4+ T cells were placed in the
upper chamber of a Transwell separated from autologous indicator
CD4+ T cells preactivated with TCD PBMCs from the same
donor or from a different donor (donor B). In these secondary
cocultures, the alloreactivities of donor A-specific and of donor
B-specific indicator CD4+ T cells were down-regulated,
suggesting that the suppressor function of post-G
MLRCD4+ T cells was antigen
nonspecific (Figure 7A). Notably,
triggering of post-G MLRCD4+ T cells
through the TCR complex was required for the activation of their
suppressor-effector function because quiescent post-G MLRCD4+ T cells did not mediate
suppression (data not shown).
Finally, we wanted to address whether post-G MLRCD4+ cells were also capable of suppressing T-cell proliferation in response to a recall antigen presented by professional antigen-presenting cells. To this purpose, PPD-pulsed, monocyte-derived DCs were used to stimulate pre-G CD4+ T cells in the lower compartment of a Transwell. Of note, post-G MLRCD4+ T cells placed in the upper chamber of the Transwell reproducibly suppressed the proliferation of pre-G CD4+ T cells in the lower chamber of the Transwell by a median of 50% (Figure 7B). Generation of suppressor CD4+ T cells is not enhanced by in vitro exposure to immunosuppressive agents To ascertain whether the in vitro generation of Tr1 cells could be potentiated by drugs routinely administered in vivo for the prevention or treatment of GVHD after HSC allografting, post-G CD4+ T cells were challenged with alloantigens in the presence of immunosuppressive drugs, as indicated in Table 2 (primary MLR). Under these culture conditions, no induction of IL-10 or TGF- 1 production was noted at
the single-cell level (data not shown) or in culture supernatants,
compared with control cultures of post-G CD4+ T cells
performed in the absence of pharmacologic agents. Although pre-G
MLRCD4+ T cells differentiated in the
presence of immunosuppressive drugs were incapable of mediating the
suppression of indicator T cells restimulated with allogeneic TCD PBMCs
in secondary Transwell cocultures (data not shown), post-G
MLRCD4+ T cells generated in the
absence or in the presence of exogenously added drugs inhibited the
proliferation of indicator T cells by a median of 40%, suggesting
comparable levels of regulatory activity (Table 2).
Lack of suppressor activity by peripheral CD4+ T cells from patients who received allografts with G-CSF-mobilized HSCs Next, we sought to determine whether T cells with regulatory activity could be differentiated from the peripheral blood of patients who underwent allografting with G-CSF-mobilized HSCs from HLA-identical siblings. Interestingly enough, no increase in the proportion of alloantigen-activated CD4+ T cells releasing IL-10 and TGF- 1 or in cytokine levels in culture supernatants was
found compared with CD4+ T cells from healthy donors (Table
3). Conversely, CD4+ T cells
from patients who underwent allografting secreted significant amounts
of the prototypic TH1 cytokine IFN- . Consistent with the
lack of regulatory activity, these CD4+ T cells did not
mediate detectable levels of suppression of third-party bystander T
cells when plated in secondary Transwell cocultures (Table 3). In
particular, BrdUrd incorporation by indicator CD4+ T cells
was of the same order of magnitude in cocultures performed with
CD4+ T cells from healthy controls and from patients who
underwent allografting. Of interest, TH1 and Tr1 cytokine
production was depressed in patient 3, who was receiving
immunosuppressive therapies for acute GVHD. Overall, these findings
suggested that allogeneic stimulation occurring in vivo after HSC
transplantation was insufficient to promote the generation of
CD4+ T cells with a Tr1-like functional profile, at least
in the context of HLA-identical transplantation.
Tr cells play a key role in the maintenance of immunologic
tolerance to self-antigens and foreign antigens.26
Different subsets of Tr cells, generated in vitro or isolated ex vivo,
have the capacity to inhibit the response of other T cells through a
cell contact-dependent or a cytokine-dependent
mechanism.12 In particular, naturally occurring human
CD4+ T cells that constitutively express the CD25 marker
have been identified and exert immunosuppression through cell-cell
interaction involving cell-surface TGF- To date, limited attempts to identify surface markers specific for Tr
cells have been made. Relationships among different subsets of Tr
cells Whereas further studies are needed to characterize the potentially
multiple types of regulatory-suppressor T cells, it is well
established that the secretion of IL-10 and TGF- Our interest in TGF- In this study, we used culture conditions in which purified
CD4+ T cells were activated with alloantigens through their
TCRs, and we found that post-G
MLRCD4+ T cells acquired a Tr1-like
profile of cytokine secretion, consisting of high IL-10 and moderate
TGF- Consistent with the specific role of GATA-3 in the induction of TH2 cells,40 we found that post-G MLRCD4+ T cells expressed low levels of GATA-3 mRNA, supporting the view that, unlike murine T cells, human T cells are not genuinely polarized to a TH2 profile after exposure to G-CSF in vivo.41 Among the phenotypic features of post-G
MLRCD4+ T cells we identified,
markedly reduced CD62L and CD28 expression was of interest because
CD62L-negative T cells with impaired alloproliferative responses have
been reported to increase after in vivo exposure to G-CSF, and
defective CD28 costimulation has been advocated as a potential
mechanism of T-cell hyporesponsiveness induced by
G-CSF.42,43 Notably, CD122 and CD132 expression was
enhanced on post-G compared with pre-G
MLRCD4+ T cells; this finding was
intriguing because Tr1 cells might be exquisitely sensitive to
stimulation with the IL-2R The human chemokine system encompasses a variety of chemotactic cytokines that recruit leukocyte subsets to sites of antigen presentation and inflammation.44-46 Chemokine receptor expression is tightly regulated depending on stage of activation and differentiation of T cells.44 So far, no data on the differential expression of chemokine receptors on Tr1 cells have been published; conversely, CD4+CD25+ Tr cells were recently found to express preferentially CCR4 and CCR8 chemokine receptors and to migrate in response to a number of inflammatory chemokines.46 When we studied post-G MLRCD4+ T cells for the expression of receptors for inflammatory (CXCR3, CCR5) and homeostatic chemokines (CXCR4, CCR7) and for chemokines ascribed to both subfamilies (CCR6), we found a distinctive pattern consisting of high CCR7 levels in the absence of significant CXCR3, CCR5, and CCR6 receptor expression. Cell-surface expression of CXCR4, which is known to be down-regulated after T-cell activation,47,48 was significantly higher in post-G MLRCD4+ T cells than in pre-G MLRCD4+ T cells. Although evaluation of the migratory behavior of post-G MLRCD4+ T cells was beyond the aims of the present investigation, the study of chemokine responses by post-G MLRCD4+ T cells is crucial to assess whether Tr1 cells have the capacity to migrate to sites of inflammation and to control immune responses. Somewhat expected as a result of the inhibitory effects of IL-10 and
TGF- Cultures containing post-G MLRCD4+ T
cells inhibited the proliferation of autologous pre-G
MLRCD4+ T cells (indicator cells) to
allogeneic stimulators and to recall antigens presented by
monocyte-derived DCs, demonstrating that post-G
MLRCD4+ T cells have the key
functional property of Tr cells. It should be pointed out that in
vitro-differentiated post-G MLRCD4+
T cells were remarkably potent suppressor cells. The percentage of
cells with a Tr1-like profile of cytokine
production Previously, it has been shown that immunosuppressive drugs might induce human CD4+ T cells to differentiate in vitro into regulatory T cells producing high levels of IL-10.50 Importantly, an increase of CD4+CD25+ Tr cells has also been demonstrated in tolerant mice receiving short treatment with vitamin D3 and mycophenolate mofetil after fully mismatched islet allografting,51 suggesting that pharmacologic agents added in vitro or administered in vivo might favor the development of Tr cells that can adoptively transfer transplantation tolerance. In our system model, no enhancement of Tr1 cell differentiation was evident when post-G CD4+ T cells were activated in vitro in the presence of a wide spectrum of drugs routinely administered in vivo for GVHD prevention or treatment. Further studies are ongoing to test whether in vivo immunosuppressive therapies can alter the balance between autoaggressive and regulatory T-cell responses. Because studies in mice and humans have suggested that the activation
of Tr cells might be an integral component of the allograft response,52,53 we investigated whether Tr cells could be
generated in vitro from the peripheral blood of patients who underwent
allograft with G-CSF-mobilized HSCs from HLA-identical siblings.
Interestingly, no increase of the IL-10- and TGF- From the results shown here, cytokine secretion and immunoregulatory properties of the human CD4+ T cells generated after in vivo treatment with G-CSF were superimposable with those of Tr1 cells.12,13 To our knowledge, this is the first set of data reporting the development of Tr1 cells from human peripheral blood T cells exposed to G-CSF in vivo. Interestingly, a suppressive and regulatory phenotype was induced specifically by in vivo exposure to G-CSF because normal CD4+ T cells activated with alloantigens in the presence of exogenously provided G-CSF were incapable of mediating suppression of bystander autologous CD4+ T cells (data not shown). At present, the cellular and molecular events that direct Tr1 cell
development in vivo are unknown, and whether Tr cells are a unique
lineage of cells imprinted with a regulatory function or whether Tr
cell function may be acquired by naive T cells in the periphery is
still unresolved.34 Of interest, an average 3.5-fold
increase of IFN- Because Tr cells can be expanded and maintained in
vitro,49 adoptive transfer of Tr1 cells generated ex vivo
after G-CSF treatment or immune manipulation to re-establish dominant
Tr activities in vivo can be envisaged as potential therapeutic options
for GVHD and other human T-cell-mediated diseases and for the
prevention of graft rejection. However, such strategies should be
approached cautiously
We thank Dr Tiziana Di Pucchio (Laboratory of Virology, Istituto Superiore di Sanità, Rome, Italy) for the generous gift of monoclonal antibodies against chemokine receptors and for helpful discussions. We also thank Dr Mothanje Barbara Lucia (Department of Infectious Diseases, Catholic University, Rome, Italy) for providing PPD for autologous MLR experiments.
Submitted December 27, 2001; accepted May 21, 2002.
Prepublished online as Blood First Edition Paper, June 7, 2002; DOI 10.1182/blood-2001-12-0291.
Supported in part by M.U.R.S.T. (Ministero dell'Università e della Ricerca Scientifica e Tecnologica, Italy).
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Sergio Rutella, Department of Hematology, Catholic University Medical School, Largo A. Gemelli 8-00168, Rome, Italy; e-mail: sergiorutella{at}tin.it.
1.
Champlin RE, Schmitz N, Horowitz MM, et al.
Blood stem cells compared with bone marrow as a source of hematopoietic cells for allogeneic transplantation.
Blood.
2000;95:3702-3709
2.
Weissman IL.
Translating stem and progenitor cell biology to the clinic: barriers and opportunities.
Science.
2000;287:1442-1446 3. Rutella S, Rumi C, Sica S, Leone G. Recombinant human granulocyte colony-stimulating factor (rhG-CSF): effects on lymphocyte phenotype and function. J Interferon Cytokine Res. 1999;19:989-994[CrossRef][Medline] [Order article via Infotrieve].
4.
Mielcarek M, Graf L, Johnson G, Torok-Storb B.
Production of interleukin-10 by granulocyte colony-stimulating factor-mobilized blood products: a mechanism for monocyte-mediated suppression of T-cell proliferation.
Blood.
1998;92:215-222
5.
Boneberg EM, Hareng L, Gantner F, Wendel A, Hartung T.
Human monocytes express functional receptors for granulocyte colony-stimulating factor that mediate suppression of monokines and interferon-
6.
Sloand EM, Kim S, Maciejewski JP, et al.
Pharmacologic doses of granulocyte colony-stimulating factor affect cytokine production by lymphocytes in vitro and in vivo.
Blood.
2000;95:2269-2274 7. Tayebi H, Kuttler F, Saas P, et al. Effect of granulocyte colony-stimulating factor mobilization on phenotypical and functional properties of immune cells. Exp Hematol. 2001;29:458-470[CrossRef][Medline] [Order article via Infotrieve].
8.
Nawa Y, Teshima T, Sunami K, et al.
G-CSF reduces IFN- 9. Rutella S, Rumi C, Lucia MB, Sica S, Cauda R, Leone G. Serum of healthy donors receiving recombinant human granulocyte colony-stimulating factor (rhG-CSF) induces T-cell unresponsiveness. Exp Hematol. 1998;26:1024-1033[Medline] [Order article via Infotrieve]. 10. Rutella S, Rumi C, Pierelli L, et al. Granulocyte colony-stimulating factor perturbs lymphocyte mitochondrial function and inhibits cell cycle progression. Exp Hematol. 2000;28:612-625[CrossRef][Medline] [Order article via Infotrieve]. 11. Rutella S, Pierelli L, Rumi C, et al. T-cell apoptosis induced by granulocyte colony-stimulating factor (G-CSF) is associated with retinoblastoma protein phosphorylation and reduced expression of cyclin-dependent kinase inhibitors. Exp Hematol. 2001;29:401-415[CrossRef][Medline] [Order article via Infotrieve]. 12. Roncarolo MG, Levings MK. The role of different subsets of T regulatory cells in controlling autoimmunity. Curr Opin Immunol. 2000;12:676-683[CrossRef][Medline] [Order article via Infotrieve]. 13. Groux H, O'Garra A, Bigler M, et al. A CD4+ T-cell subset inhibits antigen-specific T-cell responses and prevents colitis. Nature. 1997;389:737-742[CrossRef][Medline] [Order article via Infotrieve].
14.
Wu DY, Goldschneider I.
Tolerance to cyclosporin A-induced autologous graft-versus-host disease is mediated by a CD4+CD25+ subset of recent thymic emigrants.
J Immunol.
2001;166:7158-7164
15.
Letterio JL, Roberts AB.
Regulation of immune responses by TGF-
16.
Prud'homme GJ, Piccirillo CA.
The inhibitory effects of transforming growth factor-beta-1 (TGF- 17. Joss A, Akdis M, Faith A, Blaser K, Akdis CA. IL-10 directly acts on T cells by specifically altering the CD28 co-stimulation pathway. Eur J Immunol. 2000;30:1683-1690[CrossRef][Medline] [Order article via Infotrieve].
18.
D'Orazio TJ, Niederkorn JY.
A novel role for TGF-
19.
Zeller JC, Panoskaltsis-Mortari A, Murphy WJ, et al.
Induction of CD4+ T cell alloantigen-specific hyporesponsiveness by IL-10 and TGF-
20.
Boussiotis VA, Chen ZM, Zeller JC, et al.
Altered T-cell receptor + CD28-mediated signaling and blocked cell cycle progression in interleukin 10 and transforming growth factor- 21. Maino VC, Picker LJ. Identification of functional subsets by flow cytometry: intracellular detection of cytokine expression. Cytometry. 1998;34:207-215[CrossRef][Medline] [Order article via Infotrieve].
22.
Testa U, Martucci R, Rutella S, et al.
Autologous stem cell transplantation: release of early- and late-acting growth factors relates with hematopoietic ablation and recovery.
Blood.
1994;84:3532-3539 23. Rutella S, Pierelli L, Bonanno G, et al. Immune reconstitution after autologous peripheral blood progenitor cell transplantation: effect of interleukin-15 on T-cell survival and effector functions. Exp Hematol. 2001;29:1503-1516[CrossRef][Medline] [Order article via Infotrieve].
24.
Pierelli L, Marone M, Bonanno G, et al.
Modulation of Bcl-2 RNA/protein and p27 protein in human primitive hematopoietic progenitors by autocrine TGF-
25.
De Candia E, Hall SA, Rutella S, Landolfi R, Andrews RK, De Cristofaro R.
Binding of 26. Sakaguchi S. Regulatory T cells: key controllers of immunologic self-tolerance. Cell. 2000;101:455-458[CrossRef][Medline] [Order article via Infotrieve].
27.
Volpi I, Perruccio K, Tosti A, et al.
Postgrafting administration of granulocyte colony-stimulating factor impairs functional immune recovery in recipients of human leukocyte antigen haplotype-mismatched hematopoietic transplants.
Blood.
2001;97:2514-2521
28.
Baecher-Allan C, Brown JA, Freeman GJ, Hafler DA.
CD4+CD25high regulatory cells in human peripheral blood.
J Immunol.
2001;167:1245-1253
29.
Jonuleit H, Schmitt E, Stassen M, Tuettenberg A, Knop J, Enk AH.
Identification and functional characterization of human CD4+CD25+ T cells with regulatory properties isolated from peripheral blood.
J Exp Med.
2001;193:1285-1294
30.
Nakamura K, Kitani A, Strober W.
Cell contact-dependent immunosuppression by CD4+CD25+ regulatory T cells is mediated by cell surface-bound transforming growth factor-
31.
Yamagiwa S, Gray JD, Hashimoto S, Horwitz DA.
A role for TGF-
32.
Dieckmann D, Plottner H, Berchtold S, Berger T, Schuler G.
Ex vivo isolation and characterization of CD4+CD25+ T cells with regulatory properties from human blood.
J Exp Med.
2001;193:1303-1310
33.
Thornton AM, Shevach EM.
CD4+CD25+ immunoregulatory T cells suppress polyclonal T cell activation in vitro by inhibiting interleukin 2 production.
J Exp Med.
1998;188:287-296 34. Maloy KJ, Powrie F. Regulatory T cells in the control of immune pathology. Nat Immunol. 2001;2:816-822[CrossRef][Medline] [Order article via Infotrieve]. 35. Shevach EM. Certified professionals: CD4+CD25+ suppressor T cells. J Exp Med. 2001;193:F41-F45[CrossRef][Medline] [Order article via Infotrieve]. 36. Waldmann H, Cobbold S. Regulating the immune response to transplants: a role for CD4+ regulatory cells? Immunity. 2001;14:399-406[CrossRef][Medline] [Order article via Infotrieve].
37.
Annacker O, Pimenta-Araujo R, Burlen-Defranoux O, Barbosa TC, Cumano A, Bandeira A.
CD25+CD4+ T cells regulate the expansion of peripheral CD4 T cells through the production of IL-10.
J Immunol.
2001;166:3008-3018
38.
Asseman C, Mauze S, Leach MW, Coffman RL, Powrie F.
An essential role for interleukin-10 in the function of regulatory T cells that inhibit intestinal inflammation.
J Exp Med.
1999;190:995-1003
39.
Suchin EJ, Langmuir PB, Palmer E, Sayegh MH, Wells AD, Turka LA.
Quantifying the frequency of alloreactive T cells in vivo: new answers to an old question.
J Immunol.
2001;166:973-981 40. Hendriks RW, Nawijn MC, Engel JD, Van Doorninck H, Grosveld F, Karis A. Expression of the transcription factor GATA-3 is required for the development of the earliest T cell progenitors and correlates with stages of cellular proliferation in the thymus. Eur J Immunol. 1999;29:1912-1918[CrossRef][Medline] [Order article via Infotrieve].
41.
Pan L, Delmonte J, Jalonen CK, Ferrara JLM.
Pretreatment of donor mice with granulocyte colony-stimulating factor polarizes donor T lymphocytes toward type-2 cytokine production and reduces severity of experimental graft-versus-host disease.
Blood.
1995;86:4422-4429
42.
Sugimori N, Nakao S, Yachie A, et al.
Administration of G-CSF to normal individuals diminishes L-selectin+ T cells in the peripheral blood that respond better to alloantigen stimulation than L-selectin
43.
Tanaka J, Mielcarek M, Torok-Storb B.
Impaired induction of the CD28-responsive complex in granulocyte colony-stimulating factor mobilized CD4 T cells.
Blood.
1998;91:347-352 44. Moser B, Loetscher P. Lymphocyte traffic control by chemokines. Nat Immunol. 2001;2:123-128[CrossRef][Medline] [Order article via Infotrieve].
45.
Rutella S, Pierelli L, Bonanno G, Scambia G, Leone G, Rumi C.
Homogeneous expression of CXC chemokine receptor 4 (CXCR4) on G-CSF-mobilized peripheral blood CD34+ cells [letter].
Blood.
2000;95:4015-4016
46.
Iellem A, Mariani M, Lang R, et al.
Unique chemotactic response profile and specific expression of chemokine receptors CCR4 and CCR8 by CD4+CD25+ regulatory T cells.
J Exp Med.
2001;194:847-853 47. Sallusto F, Lenig D, Forster R, Lipp M, Lanzavecchia A. Two subsets of memory T lymphocytes with distinct homing potentials and effector functions. Nature. 1999;401:708-712[CrossRef][Medline] [Order article via Infotrieve].
48.
Murdoch C, Finn A.
Chemokine receptors and their role in inflammation and infectious diseases.
Blood.
2000;95:3032-3043
49.
Levings MK, Sangregorio R, Roncarolo MG.
Human CD25+CD4+ T regulatory cells suppress naive and memory T cell proliferation and can be expanded in vitro without loss of function.
J Exp Med.
2001;193:1295-1301
50.
Barrat FJ, Cua DJ, Boonstra A, et al.
In vitro generation of interleukin 10-producing regulatory CD4+ T cells is induced by immunosuppressive drugs and inhibited by T helper 1 (Th1)- and Th2-inducing cytokines.
J Exp Med.
2002;195:603-616
51.
Gregori S, Casorati M, Amuchastegui S, Smiroldo S, Davalli AM, Adorini L.
Regulatory T cells induced by 1
52.
Sanchez-Fueyo A, Weber M, Domenig C, Strom TB, Zheng XX.
Tracking the immunoregulatory mechanisms active during allograft tolerance.
J Immunol.
2002;168:2274-2281
53.
Bacchetta R, Bigler M, Touraine JL, et al.
High levels of interleukin 10 production in vivo are associated with tolerance in SCID patients transplanted with HLA mismatched hematopoietic stem cells.
J Exp Med.
1994;179:493-502
54.
Levings MK, Sangregorio R, Galbiati F, Squadrone S, de Waal Malefyt R, Roncarolo MG.
IFN- 55. Seo N, Hayakawa S, Takigawa M, Tokura Y. Interleukin-10 expressed at early tumor sites induces subsequent generation of CD4+ T-regulatory cells and systemic collapse of antitumor immunity. Immunology. 2001;103:449-457[CrossRef][Medline] [Order article via Infotrieve].
56.
Woo EY, Chu CS, Goletz TJ, et al.
Regulatory CD4+CD25+ T cells in tumors from patients with early-stage non-small cell lung cancer and late-stage ovarian cancer.
Cancer Res.
2001;61:4766-4772
© 2002 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
C. Dufour, E. Ferretti, F. Bagnasco, O. Burlando, M. Lanciotti, U. Ramenghi, P. Saracco, M. T. Van Lint, D. Longoni, G. F. Torelli, et al. Changes in cytokine profile pre- and post-immunosuppression in acquired aplastic anemia Haematologica, December 1, 2009; 94(12): 1743 - 1747. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. G. Macambira, J. F. Vasconcelos, C. R. S. Costa, W. Klein, R. S. Lima, P. Guimaraes, D. T. A. Vidal, L. C. Mendez, R. Ribeiro-dos-Santos, and M. B. P. Soares Granulocyte colony-stimulating factor treatment in chronic Chagas disease: preservation and improvement of cardiac structure and function FASEB J, November 1, 2009; 23(11): 3843 - 3850. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. R. Guerin, J. R. Prins, and S. A. Robertson Regulatory T-cells and immune tolerance in pregnancy: a new target for infertility treatment? Hum. Reprod. Update, September 1, 2009; 15(5): 517 - 535. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Collazo, D. Wood, K. H. T. Paraiso, E. Lund, R. W. Engelman, C.-T. Le, D. Stauch, K. Kotsch, and W. G. Kerr SHIP limits immunoregulatory capacity in the T-cell compartment Blood, March 26, 2009; 113(13): 2934 - 2944. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. H. C. Baumeister, K. Holig, M. Bornhauser, M. Meurer, E. P. Rieber, and K. Schakel G-CSF mobilizes slanDCs (6-sulfo LacNAc+ dendritic cells) with a high proinflammatory capacity Blood, October 15, 2007; 110(8): 3078 - 3081. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Rutella, S. Danese, and G. Leone Tolerogenic dendritic cells: cytokine modulation comes of age Blood, September 1, 2006; 108(5): 1435 - 1440. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Rezvani, S. Mielke, M. Ahmadzadeh, Y. Kilical, B. N. Savani, J. Zeilah, K. Keyvanfar, A. Montero, N. Hensel, R. Kurlander, et al. High donor FOXP3-positive regulatory T-cell (Treg) content is associated with a low risk of GVHD following HLA-matched allogeneic SCT Blood, August 15, 2006; 108(4): 1291 - 1297. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Rutella, G. Bonanno, A. Procoli, A. Mariotti, D. G. de Ritis, A. Curti, S. Danese, G. Pessina, S. Pandolfi, F. Natoni, et al. Hepatocyte growth factor favors monocyte differentiation into regulatory interleukin (IL)-10++IL-12low/neg accessory cells with dendritic-cell features Blood, July 1, 2006; 108(1): 218 - 227. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Condomines, P. Quittet, Z.-Y. Lu, L. Nadal, P. Latry, E. Lopez, M. Baudard, G. Requirand, C. Duperray, J.-F. Schved, et al. Functional Regulatory T Cells Are Collected in Stem Cell Autografts by Mobilization with High-Dose Cyclophosphamide and Granulocyte Colony-Stimulating Factor. J. Immunol., June 1, 2006; 176(11): 6631 - 6639. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. S. Morris, K. P. A. MacDonald, and G. R. Hill Stem cell mobilization with G-CSF analogs: a rational approach to separate GVHD and GVL? Blood, May 1, 2006; 107(9): 3430 - 3435. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Rutella, F. Zavala, S. Danese, H. Kared, and G. Leone Granulocyte Colony-Stimulating Factor: A Novel Mediator of T Cell Tolerance J. Immunol., December 1, 2005; 175(11): 7085 - 7091. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Banovic, K. P. A. MacDonald, E. S. Morris, V. Rowe, R. Kuns, A. Don, J. Kelly, S. Ledbetter, A. D. Clouston, and G. R. Hill TGF-{beta} in allogeneic stem cell transplantation: friend or foe? Blood, September 15, 2005; 106(6): 2206 - 2214. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Leone, S. Rutella, G. Bonanno, A. Abbate, A. G. Rebuzzi, S. Giovannini, M. Lombardi, L. Galiuto, G. Liuzzo, F. Andreotti, et al. Mobilization of bone marrow-derived stem cells after myocardial infarction and left ventricular function Eur. Heart J., June 2, 2005; 26(12): 1196 - 1204. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Dudley, J. R. Wunderlich, J. C. Yang, R. M. Sherry, S. L. Topalian, N. P. Restifo, R. E. Royal, U. Kammula, D. E. White, S. A. Mavroukakis, et al. Adoptive Cell Transfer Therapy Following Non-Myeloablative but Lymphodepleting Chemotherapy for the Treatment of Patients With Refractory Metastatic Melanoma J. Clin. Oncol., April 1, 2005; 23(10): 2346 - 2357. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. P. A. MacDonald, V. Rowe, A. D. Clouston, J. K. Welply, R. D. Kuns, J. L. M. Ferrara, R. Thomas, and G. R. Hill Cytokine Expanded Myeloid Precursors Function as Regulatory Antigen-Presenting Cells and Promote Tolerance through IL-10-Producing Regulatory T Cells J. Immunol., February 15, 2005; 174(4): 1841 - 1850. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kared, A. Masson, H. Adle-Biassette, J.-F. Bach, L. Chatenoud, and F. Zavala Treatment With Granulocyte Colony-Stimulating Factor Prevents Diabetes in NOD Mice by Recruiting Plasmacytoid Dendritic Cells and Functional CD4+CD25+ Regulatory T-Cells Diabetes, January 1, 2005; 54(1): 78 - 84. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. S. Morris, K. P. A. MacDonald, V. Rowe, D. H. Johnson, T. Banovic, A. D. Clouston, and G. R. Hill Donor treatment with pegylated G-CSF augments the generation of IL-10-producing regulatory T cells and promotes transplantation tolerance Blood, May 1, 2004; 103(9): 3573 - 3581. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Yamagami, S. Yokoo, T. Mimura, and S. Amano Effects of TGF-{beta}2 on Immune Response-Related Gene Expression Profiles in the Human Corneal Endothelium Invest. Ophthalmol. Vis. Sci., February 1, 2004; 45(2): 515 - 521. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Rutella, G. Bonanno, M. Marone, D. de Ritis, A. Mariotti, M. T. Voso, G. Scambia, S. Mancuso, G. Leone, and L. Pierelli Identification of a Novel Subpopulation of Human Cord Blood CD34-CD133-CD7-CD45+Lineage- Cells Capable of Lymphoid/NK Cell Differentiation After In Vitro Exposure to IL-15 J. Immunol., September 15, 2003; 171(6): 2977 - 2988. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2002 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||