|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Prepublished online as a Blood First Edition Paper on June 14, 2002; DOI 10.1182/blood-2002-02-0531.
NEOPLASIA
From the Department of Medicine, Division of
Hematology and Medical Oncology, Oregon Health and Science University,
and Portland Veterans Affairs Medical Center, Portland; and
SUGEN, South San Francisco, CA
Internal tandem duplication (ITD) in the juxtamembrane portion of
Fms-like tyrosine kinase 3 (FLT3), a type III receptor tyrosine kinase
(RTK), is the most common molecular defect associated with acute
myeloid leukemia (AML). The high prevalence of this activating mutation
makes it a potential target for molecularly based therapy. Indolinone tyrosine kinase inhibitors have known activity against KIT,
another member of the type III RTK family. Given the conserved homology
between members of this family, we postulated that the activity of some
KIT inhibitors would extend to FLT3. We used various leukemic cell
lines (BaF3, MV 4-11, RS 4;11) to test the activity of indolinone
compounds against the FLT3 kinase activity of both wild-type
(WT) and ITD isoforms. Both SU5416 and SU5614 were capable of
inhibiting autophosphorylation of ITD and WT FLT3 (SU5416
concentration that inhibits 50% [IC50], 100 nM;
and SU5614 IC50 10 nM). FLT3-dependent activation of the
downstream signaling proteins mitogen-activated protein kinase
(MAPK) and signal transducer and activator of transcription 5 (STAT5) was also inhibited by treatment in the same
concentration ranges. FLT3 inhibition by SU5416 and SU5614 resulted in
reduced proliferation (IC50, 250 nM and 100 nM,
respectively) and induction of apoptosis of FLT3 ITD-positive leukemic
cell lines. Treatment of these cells with an alternative growth factor
(granulocyte-macrophage colony-stimulating factor
[GM-CSF]) restored MAPK signaling and cellular
proliferation, demonstrating specificity of the observed inhibitory
effects. We conclude that SU5416 and SU5614 are potent inhibitors of
FLT3. Our finding that inhibition of FLT3 induces apoptosis of leukemic cells supports the feasibility of targeting FLT3 as a novel treatment strategy for AML.
(Blood. 2002;100:2941-2949) FLT3 (Fms-like tyrosine kinase 3; CD135) is the
receptor for the hematopoietic growth factor FLT3 ligand (FL) and
belongs to the type III receptor tyrosine kinase (RTK) family that
includes KIT (CD117, c-KIT, stem cell factor receptor), and the
receptors for macrophage colony-stimulating factor (M-CSF) and
platelet-derived growth factor (PDGF). These receptor tyrosine kinases
are highly homologous and contain 5 extracellular immunoglobulinlike
domains, a single transmembrane domain, and a cytoplasmic tyrosine
kinase domain split into 2 subdomains (TK1, TK2). The cytoplasmic
juxtamembrane and kinase domains are the most highly homologous regions
among members of the type III RTK family and are conserved even
between various species.1,2 Binding of ligand to these
receptors induces receptor dimerization, stimulation of receptor kinase activity, and initiation of signal transduction. In the absence of
ligand binding, these receptors have only minimal kinase activity. However, mutations of these receptors can result in ligand-independent activation of receptor kinase activity.3-7
The most common molecular defect identified in acute myeloid leukemia
(AML) patients is an activating mutation of FLT3 tyrosine kinase. In approximately 20% to 30% of patients with AML and 3% of
patients with myelodysplasia, FLT3 contains an internal tandem duplication (ITD) of the juxtamembrane domain. More recently, an
additional 7% of AML and 3% of myelodysplasia patients were found to
have a point mutation in the activation loop of the FLT3 kinase
domain.8 These mutations lead to constitutive activation of the FLT3 tyrosine kinase activity and are capable of transforming 32D or BaF3 cells.9-11 BaF3 or 32D cells
transfected with an FLT3 ITD are leukemogenic in mice.12
In most studies of AML, the presence of this mutation portends a poorer
prognosis, regardless of the disease subtype.13-18
Although a more aggressive disease phenotype is not observed in every
study of FLT3 mutations in AML, loss of the wild-type (WT) allele
leaving only the ITD mutation results in both decreased overall
survival and higher relapse rates.18
Work to date on mutant FLT3 isoforms has employed either primary AML
patient samples or transgenically modified BaF3 or 32D cells. Although
both model systems have their merits and are suitable for certain types
of experiments, there is only one published report using human AML cell
lines with naturally occurring FLT3 ITD mutations. Such cell lines
could be useful in the study of FLT3 signaling and the development of
novel therapeutics. Indeed, cell models of chronic myelogenous
leukemia (CML)19 and acute promyelocytic leukemia
(APL)20 have been critical for advancing our
understanding of the biology of these diseases and have helped in the
development of improved therapeutic approaches. In our experiments, we
found that the MV 4-11 biphenotypic leukemia cell line contains a
naturally occurring FLT3 ITD mutation, and we report on its
uses for the testing of FLT3 inhibitors herein. Our findings with the
MV 4-11 cell line confirm the results recently reported by Levis et
al.21
SU5416 (Semaxanib; SUGEN, South San Francisco, CA) is an indolinone
compound that inhibits the tyrosine kinase activity of flk-1/kinase
domain receptor (KDR)22 and KIT.23
SU5416 was used in phase 3 clinical trials for the treatment of
metastatic colorectal cancer (targeting vascular endothelial growth
factor receptor [VEGFR]) and phase 2 trials for leukemia
(targeting KIT and/or VEGFR). In preclinical studies, SU5416 treatment
of a myeloid cell line that is dependent on ligand-induced KIT
signaling resulted in inhibition of KIT receptor autophosphorylation as
well as a decrease in cellular proliferation.23
Additionally, treatment of KIT-positive AML myeloblasts with SU5416
resulted in apoptosis.23 Given the sequence conservation
between the tyrosine kinase domains of KIT and FLT3, we postulated that
SU5416 and/or structurally related compounds would have inhibitory
effects on FLT3 kinase activity. Unlike tyrosine kinases inhibitors
used in previous studies of FLT3,12,24-26 SU5416 is highly
specific for flk-1/KDR and KIT and displays minimal effects on
epidermal growth factor receptor, insulin receptor, and
platelet-derived growth factor receptor.27 As noted above,
SU5416 has an established safety record in the clinic.
In this study, we found that SU5416 and the structurally related
compound SU5614 inhibit FLT3 tyrosine kinase activity of both wild-type
and ITD-mutant isoforms. We demonstrate that both compounds inhibit
mutant FLT3 kinase activity and downstream signaling via the
mitogen-activated protein kinase (MAPK) and signal transducer and activator of transcription 5 (STAT5) pathways. Despite the presence of activating RAS mutations and multiple
cytogenetic abnormalities of MV 4-11 cells, both compounds markedly
inhibit cellular proliferation and induce apoptosis. These studies
indicate that inhibition of FLT3 kinase activity is a novel therapeutic approach to the treatment of AML.
Cell culture
Site-directed mutagenesis and BaF3 mutant transfection
Reagents Indolinone compounds SU5416, SU5614, SU6668, and SU6597 were obtained from SUGEN. These compounds were dissolved in dimethyl sulfoxide (DMSO) to create 10-mM stock solutions that were frozen at 20°C. Human recombinant FL was purchased from
R&D systems (Minneapolis, MN).
Polymerase chain reaction Genomic DNA was obtained from cultured cells with the use of a DNAeasy Tissue Kit (Qiagen, Valencia, CA). The juxtamembrane domain of FLT3 was amplified with the use of the following primer pair: 5' CTCTTCATTGTCGTTTTAACCC 3' (sense primer) and 5' TTCCATTCTTACCAAACTCT 3' (antisense primer). Polymerase chain reaction (PCR) amplification of genomic DNA was performed with the use of 500 ng whole-cell DNA as previously described.32WAVE high-performance liquid chromatography (HPLC) We assessed 5- to 20-µL aliquots of each PCR reaction for FLT3 mutations using a Transgenomic (Omaha, NE) WAVE HPLC system.33 Samples were run at 50°C to distinguish fragments of different lengths. Amplimers were bidirectionally sequenced on an ABI 377 sequencer by means of the BigDye terminator kit (Applied Biosystems, Foster City, CA).32Antibodies An anti-FLT3 rabbit polyclonal antibody (C-20; Santa Cruz Biotechnology, CA) was used at 1:1000 dilution. An antiphosphotyrosine antibody (PY20; Transduction Laboratories, Lexington, KY) was used at a 1:1000 dilution. An antiphospho-p44/p42 MAP kinase (Thr202/Tyr204) antibody was used at 1:1000 dilution (New England Biolabs, Beverly, MA). An antiphosphotyrosine-STAT5 antibody (Cell Signaling Technology, Beverly MA) was used at 1:1000 dilution. An antibody to total MAP kinase (New England Biolabs) was used at 1:2000 dilution. A monoclonal antibody to total STAT5 (Santa Cruz Biotechnology) was used at 1:400 dilution. Peroxidase-conjugated goat antimouse antibody and goat antirabbit antibody were used at 1:5000 and 1:10 000 dilutions, respectively (BioRad, Hercules, CA).Immunoprecipitation and Western blots Approximately 5 × 107 MV 4-11 or 1 × 107 RS 4;11 cells were serum starved in Opti-Mem (Gibco-BRL) overnight and then exposed to varying concentrations of indolinone compounds (2 hours for SU5416 and 1 hour for SU5614). Cells were then incubated with 100 ng/mL FL for 15 minutes at 37°C before cell pellets were lysed with 100 to 150 µL protein lysis buffer (50 mM Tris [tris(hydroxymethyl)aminomethane], 150 mM NaCl, 1% Nonidet P-40 [NP-40], 0.25% deoxycholate with added inhibitors aprotinin, AEBSF [4-(2-aminoethyl)-benzenesulfonylfluoride hydrochloride], leupeptin, pepstatin, sodium orthovanadate, and sodium pyruvate). For immunoprecipitation, 1 to 1.5 mg protein from cell lysates was precleared with 5 µL normal rabbit agarose conjugate (Santa Cruz Biotechnology) for 1 hour and then incubated with 5 µL primary antibody overnight at 4°C. Then, 20 µL Protein A/G Plus-Agarose bead (Santa Cruz Biotechnology) was added for 1 hour. This complex was washed 4 times with lysis buffer as listed above, and 15 µL sodium dodecyl sulfate (SDS) sample buffer was added to each. These samples were then analyzed by Western immunoblot assay as previously described.34Proliferation assays Cells were added to 96-well plates at densities of 50 000 cells per well for MV 4-11 and RS 4;11, and 20 000 cells per well for BaF3 cells. To decrease growth factor concentration (GM-CSF), MV 4-11 cells were rinsed once in sterile phosphate-buffered saline (PBS) and incubated overnight in DMEM supplemented with 10% FBS. Test compound was added, and proliferation was measured at 72 hours by means of an XTT (2,3-bis[2-methoxyl-4-nitro-5-sulfophenyl]-2H-tetrazolium-5-carboxanilide)-based assay (Roche Molecular Biochemicals, Indianapolis, IN).28Apoptosis assays MV 4-11 cells were rinsed with PBS and incubated in DMEM supplemented with 10% FBS. 1 × 106 cells were incubated with SU5416 for 72 hours or SU5614 for 48 hours. Apoptosis was assessed by means of a fluorescein isothiocyanate (FITC)-labeled annexin-V/propidium iodide assay (Immunotech, Marseilles, France).28
SU5416 and SU5614 inhibit proliferation of BaF3 cells expressing a mutant human FLT3 protein To test the effects of small molecule compounds on the kinase activity of FLT3, we used site-directed mutagenesis to synthetically generate a human FLT3 cDNA with an ITD identical to one previously reported in an AML patient.31 The ITD mutation consisted of an in-frame duplication of the codons encoding for residues 597 through 602 (Tyr-Glu-Tyr-Asp-Leu-Lys).35 Transfection of an expression vector encoding this FLT3 ITD cDNA resulted in factor-independent growth of BaF3 as previously reported.11SU5416, SU5614, SU6668, and SU6597 are indolinone compounds selected
for their known ability to specifically inhibit KIT23,36 and FLK-1/KDR.27 These compounds have varying potency
against PDGFR and do not inhibit EGFR or other kinases.37
Given that members of the type III and IV receptor tyrosine kinase
families share striking homology with highly preserved juxtamembrane
and kinase domains,38-40 we postulated that the activity
of some of these compounds would extend to FLT3. The 4 compounds were
initially screened with our BaF3 ITD-mutant FLT3 cell line with the use of concentrations of 5 µM, 500 nM, and 250 nM. Proliferation
of these cells was potently inhibited by SU5416 and SU5614 (Figure 1A), with a concentration that inhibits
50% (IC50) for SU5416 at 250 nM. SU5614 was found to be
more potent than SU5416; IC50 for this drug was not reached
in the screening assay (IC50 < 250 nM). SU6597 and SU6668
affected proliferation only at the highest concentrations tested. In
contrast, the proliferation of parental BaF3 cells, grown in the
presence of IL-3, was unaffected by any of these 4 compounds even with
the use of a dose of 5 µM (Figure 1B).
As further proof of the specific nature of the effect of SU5416 and SU5614 on the proliferation of BaF3 ITD-mutant FLT3 cells, we tested the compounds on the proliferation of BaF3 cells transfected with p210 BCR-ABL, NPM-ALK, or v-src (data not shown). None of the 4 compounds had any effect on the proliferation of these factor-independent cells. On the basis of these results, we selected SU5416 and SU5614 for additional study. MV 4-11 cells have an internal tandem duplication mutation of the FLT3 receptor In order to further characterize the activity of SU5416 and SU5614, we sought to test these compounds against WT human FLT3 protein kinase activity as expressed in human cell lines. The acute lymphocytic leukemia cell line RS 4;11 has been reported to express wild-type FLT3 and has been previously used to study FLT3 signal transduction.30 We investigated the use of MV 4-11 cells, an AML cell line that contains a similar translocation of chromosomes 4 and 11, as a control in our experiments of FLT3 signal transduction. However, in preliminary experiments to verify FLT3 expression and function, ligand-independent phosphorylation of FLT3 was observed in MV 4-11 but not RS 4;11 cells, suggesting that the MV 4-11 cells might express a mutant FLT3 isoform (data not shown).To test this hypothesis, we purified genomic DNA from several human
leukemia cell lines, including MV 4-11, RS 4;11, MO7e, and TF-1 cells,
and used PCR to amplify the juxtamembrane region of FLT3. The resulting
amplicons were then analyzed by high-performance liquid
chromatography.33 The FLT3 PCR product obtained from MV
4-11 genomic DNA had a higher molecular weight than that obtained from
RS 4;11, MO7e, or TF-1 cells (Figure 2A).
Sequencing revealed a homozygous 30-base pair (bp) internal tandem
duplication at cDNA position 1803 consisting of
GGTGATTTCAGAGAATATGAATATGATCTC.
This in-frame duplication encompasses Tyr597, consistent with previous reports that FLT3 ITD mutations always involve either this codon or Tyr591.41 As seen in Figure 2A, only the mutant FLT3 allele was detected in MV 4-11 cells. The amplicon from RS 4;11 was sequenced and found to be WT. For the reader's convenience, in this manuscript these cell lines will subsequently be referred to as MV 4-11 (FLT3 ITD) and RS 4;11 (FLT3 WT). SU5416 and SU5614 inhibit the phosphorylation of internal tandem duplication mutant (MV 4-11) and wild-type (RS 4;11) FLT3 To confirm that SU5416 and SU5614 could inhibit the kinase activity of FLT3 in human leukemia cell lines, we first tested the effect of these 2 compounds on ligand-independent receptor phosphorylation observed in MV 4-11 (FLT3 ITD). This cell line had a low baseline expression of FLT3, requiring immunoprecipitation of FLT3 for our immunoblotting experiments. Antiphosphotyrosine immunoblots of the immunoprecipitated FLT3 protein revealed autophosphorylation of FLT3 protein in the absence of exogenous FL (Figure 3). This ligand-independent phosphorylation was inhibited by SU5416 with an IC50 of approximately 100 nM (Figure 3). SU5614 inhibited the ITD-mutant protein phosphorylation with an IC50 of approximately 10 nM (Figure 3). To determine whether SU5416 and SU5614 modulated expression of mutant FLT3 protein, the membrane was stripped and reprobed with anti-FLT3 antibody. There was no change in the expression of FLT3 protein in cells treated with SU5416 or SU5614.
To test whether SU5416 and SU5614 would have similar effects on
FL-dependent autophosphorylation of the WT FLT3 receptor, we pretreated
RS 4;11 (FLT3 WT) cells with SU5416 or SU5614 before stimulating the
cells with FL. FLT3 phosphorylation dramatically increased following
treatment with 100 ng/mL recombinant human FL. Pretreatment with SU5416
or SU5614 inhibited ligand-dependent autophosphorylation with an
IC50 of 100 nM and 10 nM, respectively (Figure
4).
To confirm that the effect was a result of inhibition of phosphorylation rather than down-regulation of FLT3 expression, we reprobed the blot with an antibody for FLT3. As shown in Figure 4, neither SU5416 nor SU5614 had an effect on expression of total FLT3. Therefore, we conclude that these compounds decrease both mutant and wild-type FLT3 autophosphorylation by decreasing FLT3 kinase activity without down-regulating FLT3 protein expression. SU5416 and SU5614 inhibit FLT3-dependent phosphorylation of STAT5 FLT3 signal transduction has been reported to occur via several pathways, including activation of STAT5.9 To test for the effect of these inhibitors on FLT3 signal transduction, we immunoprecipitated STAT5 protein from MV 4-11 (FLT3 ITD) cells treated with various concentrations of inhibitor. Phosphorylation was then assessed with the use of an antiphosphotyrosine-STAT5 antibody. SU5416 and SU5614 inhibited STAT5 phosphorylation with an IC50 of 100 nM and 10 to 50 nM, respectively. Both inhibitors decreased STAT5 phosphorylation without altering total STAT5 expression (Figure 5).
Inhibition of STAT5 phosphorylation occurred in an inhibitor dose range similar to that required to inhibit FLT3 activation. These results were consistent with the hypothesis that SU5416 and SU5614 inhibited FLT3 kinase activity required for downstream signaling via the STAT5 pathway. SU5416 and SU5614 inhibit phosphorylation of MAP kinase In addition to its effects on the STAT5 pathway, activation of FLT3 kinase also results in activation of MAPK. To assess the effects of SU5416 and SU5614 on the FLT3-dependent activation of MAPK, we probed lysates prepared from inhibitor-treated MV 4-11 (FLT3 ITD) cells with an antibody specific for phosphorylated MAPK. In MV 4-11 (FLT3 ITD) cells, the IC50 for inhibition of MAPK phosphorylation was 100 nM for SU5416 and 10 nM for SU5614 (Figure 6A). In contrast to the effect of these compounds on MAPK phosphorylation, the inhibitors had no effect on overall expression of MAPK protein.
MV 4-11 (FLT3 ITD) cells, unlike RS 4;11 (FLT3 WT) cells, express a receptor for GM-CSF. To confirm that the observed effects of SU5416 and SU5614 are specific to effects on FLT3 kinase and not the result of nonspecific toxicity, we pretreated MV 4-11 (FLT3 ITD) cells with inhibitor and then stimulated the cells with either 100 ng/mL FL or GM-CSF. As noted above, addition of FL does not induce resultant phosphorylation of MAP kinase after pretreatment with 1 µM SU5416 or SU5614. However, the addition of 100 ng/mL GM-CSF permitted MAPK phosphorylation despite the presence of these inhibitors (Figure 6B). We therefore concluded that the observed inhibitory effects of these compounds on MAPK activation was specific to FLT3 signal blockade. SU5416 and SU5614 inhibit proliferation of MV 4-11 (FLT3 ITD) but not RS 4;11 (FLT3 WT) cells To test the hypothesis that ligand-independent activation of FLT3 contributes to the growth of MV 4-11 (FLT3 ITD) cells, we tested the effects of SU5416 and SU5614 on these cells in short-term proliferation assays (Figure 7A). Treatment of MV 4-11 (FLT3 ITD) with 1 µM SU5416 or SU5614 decreased proliferation of MV 4-11 (FLT3 ITD) cells by 73% ± 1% and 91% ± 0% respectively as compared with vehicle-treated cells. In the presence of 100 nM SU5614, proliferation was decreased by 38% ± 6% compared with vehicle-treated controls. Similar to the observation in the BaF3-screening cell assays, SU6597 and SU6668 inhibited the proliferation of MV 4-11 (FLT3 ITD) only at the highest inhibitor concentration tested.
In contrast to the results with MV 4-11 (FLT3 ITD) cells, the RS 4;11 (FLT3 WT) cells were only marginally inhibited with the use of a 10-µM dose of SU5416 (Figure 7B). This demonstrated that the indolinone inhibitors exhibit minimal nonspecific toxicity on leukemia cells. The inhibitory effect on the MV 4-11 (FLT3 ITD) cell line in the nanomolar range suggested that a specific proliferative signaling pathway was being inhibited by SU5416 and SU5614. As noted previously, FLT3 phosphorylation, as well as its downstream targets (STAT5 and MAPK), was inhibited in a similar and consistent range. The marked 100-fold difference between specific activity and nonspecific toxicity suggests a favorable therapeutic index. GM-CSF restores proliferation of FLT3-inhibitor-treated MV 4-11 (FLT3 ITD) cells Given the observation that phosphorylation of MAPK could be restored by treatment with GM-CSF, proliferation assays were conducted with and without treatment with this growth factor. As noted above, in the absence of exogenous GM-CSF, the addition of SU5416 or SU5614 dramatically inhibited the proliferation of MV 4-11 (FLT3 ITD) cells with and IC50 of 250 nM and 100 nM, respectively (Figure 8A). However, in the presence of supraphysiologic doses (100 ng/mL) of GM-CSF, MV 4-11 (FLT3 ITD) cells were inhibited only by 60%, even in the presence of 10-µM concentrations of each inhibitor (Figure 8B). In the presence of GM-CSF, concentrations of 1 µM for SU5416 and 500 nM for SU5614 had no effect on cellular proliferation. The restoration of proliferation by exogenous GM-CSF further suggests that the antiproliferative effect of these compounds in this experimental system is due to specific inhibition of FLT3 kinase activity.
Treatment with SU5416 and SU5614 results in apoptosis of MV 4-11 (FLT3 ITD) cells In our proliferation assays, we observed not only a decrease in proliferation but also morphologic features consistent with cellular death (data not shown). On the basis of these observations, we hypothesized that FLT3 inhibition induced apoptosis of MV 4-11 (FLT3 ITD) cells. To test this hypothesis, MV 4-11 (FLT3 ITD) cells were incubated with SU5416 and SU5614 for 72 and 48 hours, respectively. Apoptosis was assayed by means of flow cytometry to measure cellular binding of an annexin V-FITC conjugate as well as uptake of the vital stain propidium iodide. A dose of 2.5 µM SU5416 induced approximately 40% of the MV 4-11 cells to undergo apoptosis (Figure 9). SU5614 was more potent; treatment with this compound resulted in apoptosis of 80% of the cells at 2.5 and 1 µM. The IC50 for this effect was approximately 500 nM.
Acute myeloid leukemia remains a difficult disease to treat. Patients typically respond to initial treatment with anthracycline and cytosine arabanoside-based induction chemotherapy, but most patients ultimately experience relapse and die of their disease. The situation is more dire for elderly patients. AML patients in this subset experience substantially greater treatment-related toxicities with fewer durable responses and are rarely cured. In addition, the elderly are usually not candidates for more aggressive therapy using stem cell transplantation. AML in older patients is typically associated with multiple adverse prognostic factors, including high-level multidrug resistance (MDR) expression, preceding myelodysplasia, multiple cytogenetic abnormalities, and FLT3 mutations. FLT3 ITD mutations, found in 20% to 30% of cases of de novo AML, are the most common molecular abnormality in AML, and these mutations may be more common in elderly patients.42 Although it is unclear if an FLT3 ITD mutation alone is sufficient to cause de novo leukemia, such a mutation can cause transformation in cell lines.9-11 Transplantation of murine bone marrow transduced with a retrovirus encoding for FLT3 ITD cDNA into lethally irradiated mice produces a fatal myeloproliferative syndrome.43 Mice receiving FLT3-ITD-transduced stem cells develop splenomegaly and bone marrow hypercellularity owing to massive expansion of myeloid lineage cells. Another model employing a synthetically generated TEL-FLT3 construct also produces splenomegaly and leukocytosis in transgenic mice.44 It should be noted, however, that a TEL-FLT3 fusion gene has never been documented in human disease. These findings suggest that mutations in FLT3 may play a significant, albeit not a singular, role in leukemogenesis, thus making such mutations a target for molecularly based therapy analogous to BCR-ABL in blast-crisis CML. In that disease, impressive response rates were reported in patients treated with a selective tyrosine kinase inhibitor, imatinib mesylate, as a single agent.45 We used 2 complementary cell-based systems to assay small molecules for activity against FLT3 kinase activity. The BaF3 model uses an IL-3-dependent murine cell line rendered factor-independent via transfection of an expression vector encoding an ITD-mutated FLT3 coding sequence. This model system provides a versatile platform for testing of potential FLT3 inhibitors against various classes of FLT3 mutation. Novel insertion or point mutations discovered from genotypic studies of the FLT3 gene in AML specimens can be synthetically generated by means of site-directed mutagenesis of FLT3 cDNA and expressed in BaF3 cells. Although the use of BaF3 cell-based models is useful in screening compounds for activity against mutant FLT3 isoforms, this model has several shortcomings. First, it is based on the use of murine factor-independent cell lines. Although the human and murine FLT3 proteins are highly conserved, there are a number of potentially confounding biologic differences in downstream signaling pathways.30,46,47 Thus, the expression of human or murine FLT3 in a murine cellular context may not be completely representative of the biology of human FLT3 in a human leukemic cell. In addition, the expression of activated FLT3 renders such cells artificially dependent upon this receptor tyrosine kinase for survival. However, in human AML, the genetic background is more complicated, and mutant FLT3 isoforms are expressed in a cellular context of other molecular abnormalities such as blocked cellular differentiation due to loss of functional activity of individual transcription factors (eg, AML1), RAS mutations, or loss of functional activity of p53 and/or other tumor suppressor genes.42,48 In this respect, the MV 4-11 (FLT3 ITD) cell line serves as a useful experimental model of FLT3 ITD-positive AML. These cells express a homozygous in-frame ITD mutation of FLT3, consistent with those previously reported in 20% to 30% of AML patients.13,15,49,50 In our experiments, in vitro treatment of MV 4-11 (FLT3 ITD) cells with SU5416 and its sister compound SU5614 resulted in nearly complete inhibition of FLT3 autophosphorylation as well as a decrease in downstream FLT3 signal transduction through STAT5 and MAP kinase.9 STAT5 is constitutively phosphorylated in AML myeloblasts, and ITD mutations of FLT3 appear to be the cause of STAT5 activation in many of these cases.51 SU5416 and SU5614 decreased proliferation in similar dose range in terms of their effects on protein phosphorylation. The dose range of antiproliferative effects on MV 4-11 paralleled those of the generated BaF3 ITD cell line and the relative efficacy of the all 4 indolinone compounds in these 2 cell lines is remarkably similar. Treatment with SU5416 and SU5614 induced apoptosis of the MV 4-11 cells, which, although at 10-fold higher concentrations than doses required to inhibit proliferation, is still consistent with the hypothesis that FLT3 inhibition is linked to this event. GM-CSF treatment restored MAPK activation and cellular proliferation of MV 4-11 (FLT3 ITD) cells treated with SU5416 and SU5614, demonstrating that many intracellular signaling pathways remain intact after treatment with these inhibitors. It is conceivable that inhibition of an alternative kinase common to mutant ras and FLT3- but not GM-CSF-dependent signal transduction is responsible for our observations with SU5416 and SU5614. However the similar dose-effect range of these compounds for inhibition of FLT3 kinase activity, MAPK and STAT5 activation, and cellular proliferation suggests that FLT3 inhibition is largely responsible for the antiproliferative effect of these compounds on MV 4-11 (FLT3 ITD) cells. We therefore propose that the MV 4-11 (FLT3 ITD) cell line can serve as a model of an FLT3 ITD-mutant leukemia with uses similar to those of K-562 (chronic myelogenous leukemia)19 and NB4 (acute promyelocytic cell line).20 The finding that FLT3 inhibition using small molecule inhibitors can produce apoptosis of a human leukemia cell line is provocative. Unlike the synthetically generated BaF3 transfects, MV 4-11 (FLT3 ITD) has multiple mutations of the RAS proto-oncogene52 as well as chromosomal translocation involving the MLL gene (t(4;11)(q21:23)) and trisomy of chromosomes 8 and 19. Despite the presence of activating RAS mutations, constitutive MAPK activation in these cells is dependent upon FLT3 activation as inhibition of FLT3 phosphorylation by SU5416 and SU5614 completely blocks MAPK activation. Inhibition of FLT3 signaling in MV 4-11 (FLT3 ITD) cells by these compounds induces apoptosis despite the presence of multiple genetic abnormalities. These findings attest to the feasibility of targeting the FLT3 receptor in leukemic cells with complex genomic and cytogenetic abnormalities, such as are often present in human AML cells. A phase 2 trial of SU5416 in patients with AML with more than 30% KIT-positive cells in bone marrow or blood has been completed.53 In addition, a patient in second relapse of KIT-positive AML was treated with SU5416 on a compassionate-use protocol.54 The patient had normalization of bone marrow by morphology and flow cytometry and achieved a complete hematological remission (with the exception of a platelet count that rose only to 50 to 80 × 109/L). These data indicate that SU5416 has clinical activity in AML, but the mechanism of action needs to be further elucidated. Because SU5416 also inhibits KDR signaling, the observed responses may result from the antiangiogenic effects of SU5416 rather than its effects on FLT3 and/or KIT.55 SU5416 was the first tyrosine kinase inhibitor with known activity against FLT3 used in clinical trials of AML. Additional compounds that inhibit FLT3, from several companies, are now entering clinical development.21,56,57 These trials have been specifically designed to study the effects of FLT3 inhibition in patients with FLT3 ITD-positive AML and will help clarify the role of inhibiting FLT3 kinase activity in the treatment of this disease. As with other tyrosine kinase inhibitors tested in clinical trials, SU5416 monotherapy has been well tolerated without significant hematologic toxicity. Responses were seen in a limited number of patients, were of short duration, and were not complete. These results are analogous to blast-crisis CML where treatment with STI571 resulted in initial responses, but the vast majority of patients had a relapse of the disease.45 It is possible that combining targeted therapies with cytotoxic chemotherapy may improve clinical outcome. The most successful application of such a combination in acute leukemia to date has been the use of all-trans retinoic acid (ATRA) in the treatment of acute promyelocytic leukemia. Treatment with ATRA as a single agent results in early remission but unacceptably high relapse rates. However, the use of ATRA in combination with traditional chemotherapeutic agents produces the highest sustained remissions rate of any French-American-British (FAB) subtype of AML.58,59 In this manner, the targeting of FLT3 in combination with other agents may prove useful in the development of more effective therapy for patients with AML.
Submitted February 21, 2002; accepted May 18, 2002.
Prepublished online as Blood First Edition Paper, June 14, 2002; DOI 10.1182/blood-2002-02-0531.
Supported in part by a Merit Review Grant from the Department of Veterans Affairs (M.C.H.).
Several of the authors (A.O., B.D.S., J.M.C., G.M.) are employed by a company (SUGEN) whose product was studied in the present work.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Michael Heinrich, R&D-19 3710 SW US Veterans Hospital Rd, Portland, OR 97201; e-mail: heinrich{at}ohsu.edu.
1. Yarden Y, Kuang WJ, Yang-Feng T, et al. Human proto-oncogene c-kit: a new cell surface receptor tyrosine kinase for an unidentified ligand. EMBO J. 1987;6:3341-3351[Medline] [Order article via Infotrieve]. 2. Besmer P, Murphy JE, George PC, et al. A new acute transforming feline retrovirus and relationship of its oncogene v-kit with the protein kinase gene family. Nature. 1986;320:415-421[CrossRef][Medline] [Order article via Infotrieve].
3.
Small D, Levenstein M, Kim E, et al.
STK-1, the human homolog of Flk-2/Flt-3, is selectively expressed in CD34+ human bone marrow cells and is involved in the proliferation of early progenitor/stem cells.
Proc Natl Acad Sci U S A.
1994;91:459-463 4. Rousset D, Agnes F, Lachaume P, Andre C, Galibert F. Molecular evolution of the genes encoding receptor tyrosine kinase with immunoglobulinlike domains. J Mol Evol. 1995;41:421-429[CrossRef][Medline] [Order article via Infotrieve]. 5. Ishikawa K, Komuro T, Hirota S, Kitamura Y. Ultrastructural identification of the c-kit-expressing interstitial cells in the rat stomach: a comparison of control and Ws/Ws mutant rats. Cell Tissue Res. 1997;289:137-143[CrossRef][Medline] [Order article via Infotrieve]. 6. Russell ES. Hereditary anemias of the mouse: a review for geneticists. Adv Genet. 1979;20:357-459[Medline] [Order article via Infotrieve].
7.
Nocka K, Majumder S, Chabot B, et al.
Expression of c-kit gene products in known cellular targets of W mutations in normal and W mutant mice: evidence for an impaired c-kit kinase in mutant mice.
Genes Dev.
1989;3:816-826
8.
Yamamoto Y, Kiyoi H, Nakano Y, et al.
Activating mutation of D835 within the activation loop of FLT3 in human hematologic malignancies.
Blood.
2001;97:2434-2439
9.
Mizuki M, Fenski R, Halfter H, et al.
Flt3 mutations from patients with acute myeloid leukemia induce transformation of 32D cells mediated by the Ras and STAT5 pathways.
Blood.
2000;96:3907-3914 10. Fenski R, Flesch K, Serve S, et al. Constitutive activation of FLT3 in acute myeloid leukaemia and its consequences for growth of 32D cells. Br J Haematol. 2000;108:322-330[CrossRef][Medline] [Order article via Infotrieve]. 11. Tse KF, Mukherjee G, Small D. Constitutive activation of FLT3 stimulates multiple intracellular signal transducers and results in transformation. Leukemia. 2000;14:1766-1776[CrossRef][Medline] [Order article via Infotrieve]. 12. Zhao M, Kiyoi H, Yamamoto Y, et al. In vivo treatment of mutant FLT3-transformed murine leukemia with a tyrosine kinase inhibitor. Leukemia. 2000;14:374-378[CrossRef][Medline] [Order article via Infotrieve]. 13. Rombouts WJ, Blokland I, Lowenberg B, Ploemacher RE. Biological characteristics and prognosis of adult acute myeloid leukemia with internal tandem duplications in the Flt3 gene. Leukemia. 2000;14:675-683[CrossRef][Medline] [Order article via Infotrieve]. 14. Horiike S, Yokota S, Nakao M, et al. Tandem duplications of the FLT3 receptor gene are associated with leukemic transformation of myelodysplasia. Leukemia. 1997;11:1442-1446[CrossRef][Medline] [Order article via Infotrieve]. 15. Abu-Duhier FM, Goodeve AC, Wilson GA, et al. FLT3 internal tandem duplication mutations in adult acute myeloid leukaemia define a high-risk group. Br J Haematol. 2000;111:190-195[CrossRef][Medline] [Order article via Infotrieve].
16.
Kiyoi H, Naoe T, Nakano Y, et al.
Prognostic implication of FLT3 and N-RAS gene mutations in acute myeloid leukemia.
Blood.
1999;93:3074-3080
17.
Meshinchi S, Woods WG, Stirewalt DL, et al.
Prevalence and prognostic significance of Flt3 internal tandem duplication in pediatric acute myeloid leukemia.
Blood.
2001;97:89-94
18.
Whitman SP, Archer KJ, Feng L, et al.
Absence of the wild-type allele predicts poor prognosis in adult de novo acute myeloid leukemia with normal cytogenetics and the internal tandem duplication of FLT3: a cancer and leukemia group B study.
Cancer Res.
2001;61:7233-7239 19. Druker BJ, Tamura S, Buchdunger E, et al. Effects of a selective inhibitor of the Abl tyrosine kinase on the growth of Bcr-Abl positive cells. Nat Med. 1996;2:561-566[CrossRef][Medline] [Order article via Infotrieve].
20.
Daniel MT, Koken M, Romagne O, et al.
PML protein expression in hematopoietic and acute promyelocytic leukemia cells.
Blood.
1993;82:1858-1867
21.
Levis M, Allebach J, Tse KF, et al.
A FLT3-targeted tyrosine kinase inhibitor is cytotoxic to leukemia cells in vitro and in vivo.
Blood.
2002;99:3885-3891
22.
Mendel DB, Schreck RE, West DC, et al.
The angiogenesis inhibitor SU5416 has long-lasting effects on vascular endothelial growth factor receptor phosphorylation and function.
Clin Cancer Res.
2000;6:4848-4858
23.
Smolich BD, Yuen HA, West KA, Giles FJ, Albitar M, Cherrington JM.
The antiangiogenic protein kinase inhibitors SU5416 and SU6668 inhibit the SCF receptor (c-kit) in a human myeloid leukemia cell line and in acute myeloid leukemia blasts.
Blood.
2001;97:1413-1421 24. Tse KF, Novelli E, Civin CI, Bohmer FD, Small D. Inhibition of FLT3-mediated transformation by use of a tyrosine kinase inhibitor. Leukemia. 2001;15:1001-1010[CrossRef][Medline] [Order article via Infotrieve].
25.
Levis M, Tse KF, Smith BD, Garrett E, Small D.
A FLT3 tyrosine kinase inhibitor is selectively cytotoxic to acute myeloid leukemia blasts harboring FLT3 internal tandem duplication mutations.
Blood.
2001;98:885-887 26. Naoe T, Kiyoe H, Yamamoto Y, et al. FLT3 tyrosine kinase as a target molecule for selective antileukemia therapy. Cancer Chemother Pharmacol. 2001;48(suppl 1):S27-S30[Medline] [Order article via Infotrieve].
27.
Fong TA, Shawver LK, Sun L, et al.
SU5416 is a potent and selective inhibitor of the vascular endothelial growth factor receptor (Flk-1/KDR) that inhibits tyrosine kinase catalysis, tumor vascularization, and growth of multiple tumor types.
Cancer Res.
1999;59:99-106
28.
Heinrich MC, Griffith DJ, Druker BJ, Wait CL, Ott KA, Zigler AJ.
Inhibition of c-kit receptor tyrosine kinase activity by STI 571, a selective tyrosine kinase inhibitor.
Blood.
2000;96:925-932
29.
Lange B, Valtieri M, Santoli D, et al.
Growth factor requirements of childhood acute leukemia: establishment of GM-CSF-dependent cell lines.
Blood.
1987;70:192-199 30. Zhang S, Broxmeyer HE. Flt3 ligand induces tyrosine phosphorylation of gab1 and gab2 and their association with shp-2, grb2, and PI3 kinase. Biochem Biophys Res Commun. 2000;277:195-199[CrossRef][Medline] [Order article via Infotrieve]. 31. Kiyoi H, Towatari M, Yokota S, et al. Internal tandem duplication of the FLT3 gene is a novel modality of elongation mutation which causes constitutive activation of the product. Leukemia. 1998;12:1333-1337[CrossRef][Medline] [Order article via Infotrieve]. 32. Rader AE, Avery A, Wait CL, McGreevey LS, Faigel D, Heinrich MC. Fine-needle aspiration biopsy diagnosis of gastrointestinal stromal tumors using morphology, immunocytochemistry, and mutational analysis of c-kit. Cancer. 2001;93:269-275[CrossRef][Medline] [Order article via Infotrieve]. 33. Choy YS, Dabora SL, Hall F, et al. Superiority of denaturing high performance liquid chromatography over single-stranded conformation and conformation-sensitive gel electrophoresis for mutation detection in TSC2. Ann Hum Genet. 1999;63:383-391[CrossRef][Medline] [Order article via Infotrieve]. 34. Hoatlin ME, Christianson TA, Keeble WW. The Fanconi anemia group C gene product is located in both the nucleus and cytoplasm of human cells. Blood. 1998;84:1418-1425.
35.
Rosnet O, Schiff C, Pebusque MJ, et al.
Human FLT3/FLK2 gene: cDNA cloning and expression in hematopoietic cells.
Blood.
1993;82:1110-1119
36.
Krystal GW, Honsawek S, Kiewlich D, et al.
Indolinone tyrosine kinase inhibitors block Kit activation and growth of small cell lung cancer cells.
Cancer Res.
2001;61:3660-3668
37.
Laird AD, Vajkoczy P, Shawver LK, et al.
SU6668 is a potent antiangiogenic and antitumor agent that induces regression of established tumors.
Cancer Res.
2000;60:4152-4160 38. Agnes F, Shamoon B, Dina C, Rosnet O, Birnbaum D, Galibert F. Genomic structure of the downstream part of the human FLT3 gene: exon/intron structure conservation among genes encoding receptor tyrosine kinases (RTK) of subclass III. Gene. 1994;145:283-288[CrossRef][Medline] [Order article via Infotrieve]. 39. Ullrich A, Schlessinger J. Signal transduction by receptors with tyrosine kinase activity. Cell. 1990;61:203-212[CrossRef][Medline] [Order article via Infotrieve]. 40. Andre C, Martin E, Cornu F, Hu WX, Wang XP, Galibert F. Genomic organization of the human c-kit gene: evolution of the receptor tyrosine kinase subclass III. Oncogene. 1992;7:685-691[Medline] [Order article via Infotrieve]. 41. Kiyoi H, Naoe T, Yokota S, et al. Internal tandem duplication of FLT3 associated with leukocytosis in acute promyelocytic leukemia. Leukemia Study Group of the Ministry of Health and Welfare (Kohseisho). Leukemia. 1997;11:1447-1452[CrossRef][Medline] [Order article via Infotrieve].
42.
Stirewalt DL, Kopecky KJ, Meshinchi S, et al.
FLT3, RAS, and TP53 mutations in elderly patients with acute myeloid leukemia.
Blood.
2001;97:3589-3595
43.
Kelly LM, Liu Q, Kutok JL, Williams IR, Boulton CL, Gilliland DG.
FLT3 internal tandem duplication mutations associated with human acute myeloid leukemias induce myeloproliferative disease in a murine bone marrow transplant model.
Blood.
2002;99:310-318 44. Baldwin B, Tse KF, Small D. Transgenic mice expressing a constitutively activated FLT3 receptor display a myeloproliferative disease phenotype [abstract 3331]. Blood. 2001;98:801a.
45.
Druker BJ, Sawyers CL, Kantarjian H, et al.
Activity of a specific inhibitor of the BCR-ABL tyrosine kinase in the blast crisis of chronic myeloid leukemia and acute lymphoblastic leukemia with the Philadelphia chromosome.
N Engl J Med.
2001;344:1038-1042
46.
Beslu N, LaRose J, Casteran N, et al.
Phosphatidylinositol-3' kinase is not required for mitogenesis or internalization of the Flt3/Flk2 receptor tyrosine kinase.
J Biol Chem.
1996;271:20075-20081 47. Zhang S, Broxmeyer HE. p85 subunit of PI3 kinase does not bind to human Flt3 receptor, but associates with SHP2, SHIP, and a tyrosine-phosphorylated 100-kDa protein in Flt3 ligand-stimulated hematopoietic cells. Biochem Biophys Res Commun. 1999;254:440-445[CrossRef][Medline] [Order article via Infotrieve]. 48. Hayashi Y. The molecular genetics of recurring chromosome abnormalities in acute myeloid leukemia. Semin Hematol. 2000;37:368-380[CrossRef][Medline] [Order article via Infotrieve]. 49. Yokota S, Kiyoi H, Nakao M, et al. Internal tandem duplication of the FLT3 gene is preferentially seen in acute myeloid leukemia and myelodysplastic syndrome among various hematological malignancies: a study on a large series of patients and cell lines. Leukemia. 1997;11:1605-1609[CrossRef][Medline] [Order article via Infotrieve]. 50. Xu F, Taki T, Yang HW, et al. Tandem duplication of the FLT3 gene is found in acute lymphoblastic leukaemia as well as acute myeloid leukaemia but not in myelodysplastic syndrome or juvenile chronic myelogenous leukaemia in children. Br J Haematol. 1999;105:155-162[CrossRef][Medline] [Order article via Infotrieve]. 51. Birkenkamp KU, Geugien M, Lemmink HH, Kruijer W, Vellenga E. Regulation of constitutive STAT5 phosphorylation in acute myeloid leukemia blasts. Leukemia. 2001;15:1923-1931[Medline] [Order article via Infotrieve].
52.
Morgan MA, Dolp O, Reuter CW.
Cell-cycle-dependent activation of mitogen-activated protein kinase kinase (MEK-1/2) in myeloid leukemia cell lines and induction of growth inhibition and apoptosis by inhibitors of RAS signaling.
Blood.
2001;97:1823-1834 53. Fiedler W, Mesters RM, Staib P, et al. SU5416, a novel receptor tyrosine kinase inhibitor, in the treatment of patients with refractory, c-kit positive, acute myeloid leukemia [abstract 521]. Blood. 2001;98:124a.
54.
Mesters RM, Padro T, Bieker R, et al.
Stable remission after administration of the receptor tyrosine kinase inhibitor SU5416 in a patient with refractory acute myeloid leukemia.
Blood.
2001;98:241-243 55. Gari M, Goodeve A, Wilson G, et al. c-kit proto-oncogene exon 8 in-frame deletion plus insertion mutations in acute myeloid leukaemia. Br J Haematol. 1999;105:894-900[CrossRef][Medline] [Order article via Infotrieve]. 56. O'Farrell A, Abrams T, Yuen H, et al. SUGEN compounds SU5416 and SU11248 inhibit Flt3 activity: therapeutic application in AML [abstract]. Blood. 2001;98:118a. 57. Yu J, Apatira M, Li J, et al. FLT3 antagonism as a strategy for the treatment of acute myloid leukemia (AML) [abstract 3011]. Blood. 2001;98:721a.
58.
Fenaux P, Chastang C, Chevret S, et al.
A randomized comparison of all transretinoic acid (ATRA) followed by chemotherapy and ATRA plus chemotherapy and the role of maintenance therapy in newly diagnosed acute promyelocytic leukemia. The European APL Group.
Blood.
1999;94:1192-1200 59. Advani SH, Nair R, Bapna A, et al. Acute promyelocytic leukemia: all-trans retinoic acid (ATRA) along with chemotherapy is superior to ATRA alone. Am J Hematol. 1999;60:87-93[CrossRef][Medline] [Order article via Infotrieve].
© 2002 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  P. P. Zarrinkar, R. N. Gunawardane, M. D. Cramer, M. F. Gardner, D. Brigham, B. Belli, M. W. Karaman, K. W. Pratz, G. Pallares, Q. Chao, et al. AC220 is a uniquely potent and selective inhibitor of FLT3 for the treatment of acute myeloid leukemia (AML) Blood, October 1, 2009; 114(14): 2984 - 2992. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Fukuda, P. Singh, A. Moh, M. Abe, E. M. Conway, H. S. Boswell, S. Yamaguchi, X.-Y. Fu, and L. M. Pelus Survivin mediates aberrant hematopoietic progenitor cell proliferation and acute leukemia in mice induced by internal tandem duplication of Flt3 Blood, July 9, 2009; 114(2): 394 - 403. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Breitenbuecher, B. Markova, S. Kasper, B. Carius, T. Stauder, F. D. Bohmer, K. Masson, L. Ronnstrand, C. Huber, T. Kindler, et al. A novel molecular mechanism of primary resistance to FLT3-kinase inhibitors in AML Blood, April 23, 2009; 113(17): 4063 - 4073. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. S. Lee, S. R. Kim, S. J. Park, K. H. Min, K. Y. Lee, Y. H. Choe, S. Y. Park, O. H. Chai, X. Zhang, C. H. Song, et al. Mast Cells Can Mediate Vascular Permeability through Regulation of the PI3K-HIF-1{alpha}-VEGF Axis Am. J. Respir. Crit. Care Med., October 15, 2008; 178(8): 787 - 797. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Vempati, C. Reindl, S. K. Kaza, R. Kern, T. Malamoussi, M. Dugas, G. Mellert, S. Schnittger, W. Hiddemann, and K. Spiekermann Arginine 595 is duplicated in patients with acute leukemias carrying internal tandem duplications of FLT3 and modulates its transforming potential Blood, July 15, 2007; 110(2): 686 - 694. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Q. Yao, B. Weigel, and J. Kersey Synergism between Etoposide and 17-AAG in Leukemia Cells: Critical Roles for Hsp90, FLT3, Topoisomerase II, Chk1, and Rad51 Clin. Cancer Res., March 1, 2007; 13(5): 1591 - 1600. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Piloto, M. Wright, P. Brown, K.-T. Kim, M. Levis, and D. Small Prolonged exposure to FLT3 inhibitors leads to resistance via activation of parallel signaling pathways Blood, February 15, 2007; 109(4): 1643 - 1652. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Mologni, E. Sala, S. Cazzaniga, R. Rostagno, T. Kuoni, M. Puttini, J. Bain, L. Cleris, S. Redaelli, B. Riva, et al. Inhibition of RET tyrosine kinase by SU5416. J. Mol. Endocrinol., October 1, 2006; 37(2): 199 - 212. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. S. Lee, K. H. Min, S. R. Kim, S. J. Park, H. S. Park, G. Y. Jin, and Y. C. Lee Vascular Endothelial Growth Factor Modulates Matrix Metalloproteinase-9 Expression in Asthma Am. J. Respir. Crit. Care Med., July 15, 2006; 174(2): 161 - 170. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Piloto, B. Nguyen, D. Huso, K.-T. Kim, Y. Li, L. Witte, D. J. Hicklin, P. Brown, and D. Small IMC-EB10, an Anti-FLT3 Monoclonal Antibody, Prolongs Survival and Reduces Nonobese Diabetic/Severe Combined Immunodeficient Engraftment of Some Acute Lymphoblastic Leukemia Cell Lines and Primary Leukemic Samples. Cancer Res., May 1, 2006; 66(9): 4843 - 4851. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Reindl, K. Bagrintseva, S. Vempati, S. Schnittger, J. W. Ellwart, K. Wenig, K.-P. Hopfner, W. Hiddemann, and K. Spiekermann Point mutations in the juxtamembrane domain of FLT3 define a new class of activating mutations in AML Blood, May 1, 2006; 107(9): 3700 - 3707. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. H. Albert, P. Tapang, T. J. Magoc, L. J. Pease, D. R. Reuter, R.-Q. Wei, J. Li, J. Guo, P. F. Bousquet, N. S. Ghoreishi-Haack, et al. Preclinical activity of ABT-869, a multitargeted receptor tyrosine kinase inhibitor. Mol. Cancer Ther., April 1, 2006; 5(4): 995 - 1006. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. M. Schittenhelm, S. Shiraga, A. Schroeder, A. S. Corbin, D. Griffith, F. Y. Lee, C. Bokemeyer, M. W.N. Deininger, B. J. Druker, and M. C. Heinrich Dasatinib (BMS-354825), a Dual SRC/ABL Kinase Inhibitor, Inhibits the Kinase Activity of Wild-Type, Juxtamembrane, and Activation Loop Mutant KIT Isoforms Associated with Human Malignancies Cancer Res., January 1, 2006; 66(1): 473 - 481. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. W. Stam, M. L. den Boer, P. Schneider, P. Nollau, M. Horstmann, H. B. Beverloo, E. van der Voort, M. G. Valsecchi, P. de Lorenzo, S. E. Sallan, et al. Targeting FLT3 in primary MLL-gene-rearranged infant acute lymphoblastic leukemia Blood, October 1, 2005; 106(7): 2484 - 2490. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Kirito, N. Fox, N. Komatsu, and K. Kaushansky Thrombopoietin enhances expression of vascular endothelial growth factor (VEGF) in primitive hematopoietic cells through induction of HIF-1{alpha} Blood, June 1, 2005; 105(11): 4258 - 4263. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D.-E. Schmidt-Arras, A. Bohmer, B. Markova, C. Choudhary, H. Serve, and F.-D. Bohmer Tyrosine Phosphorylation Regulates Maturation of Receptor Tyrosine Kinases Mol. Cell. Biol., May 1, 2005; 25(9): 3690 - 3703. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Fukuda, H. E. Broxmeyer, and L. M. Pelus Flt3 ligand and the Flt3 receptor regulate hematopoietic cell migration by modulating the SDF-1{alpha}(CXCL12)/CXCR4 axis Blood, April 15, 2005; 105(8): 3117 - 3126. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. K. Walters, E. P. Stoffregen, M. C. Heinrich, M. W. Deininger, and B. J. Druker RNAi-induced down-regulation of FLT3 expression in AML cell lines increases sensitivity to MLN518 Blood, April 1, 2005; 105(7): 2952 - 2954. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Piloto, M. Levis, D. Huso, Y. Li, H. Li, M.-N. Wang, R. Bassi, P. Balderes, D. L. Ludwig, L. Witte, et al. Inhibitory Anti-FLT3 Antibodies Are Capable of Mediating Antibody-Dependent Cell-Mediated Cytotoxicity and Reducing Engraftment of Acute Myelogenous Leukemia Blasts in Nonobese Diabetic/Severe Combined Immunodeficient Mice Cancer Res., February 15, 2005; 65(4): 1514 - 1522. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K.-T. Kim, K. Baird, J.-Y. Ahn, P. Meltzer, M. Lilly, M. Levis, and D. Small Pim-1 is up-regulated by constitutively activated FLT3 and plays a role in FLT3-mediated cell survival Blood, February 15, 2005; 105(4): 1759 - 1767. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Fiedler, H. Serve, H. Dohner, M. Schwittay, O. G. Ottmann, A.-M. O'Farrell, C. L. Bello, R. Allred, W. C. Manning, J. M. Cherrington, et al. A phase 1 study of SU11248 in the treatment of patients with refractory or resistant acute myeloid leukemia (AML) or not amenable to conventional therapy for the disease Blood, February 1, 2005; 105(3): 986 - 993. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Brown, M. Levis, S. Shurtleff, D. Campana, J. Downing, and D. Small FLT3 inhibition selectively kills childhood acute lymphoblastic leukemia cells with high levels of FLT3 expression Blood, January 15, 2005; 105(2): 812 - 820. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Wadleigh, D. J. DeAngelo, J. D. Griffin, and R. M. Stone After chronic myelogenous leukemia: tyrosine kinase inhibitors in other hematologic malignancies Blood, January 1, 2005; 105(1): 22 - 30. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. W. H. Yee, M. Schittenhelm, A.-M. O'Farrell, A. R. Town, L. McGreevey, T. Bainbridge, J. M. Cherrington, and M. C. Heinrich Synergistic effect of SU11248 with cytarabine or daunorubicin on FLT3 ITD-positive leukemic cells Blood, December 15, 2004; 104(13): 4202 - 4209. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. J. Griswold, L. J. Shen, P. La Rosee, S. Demehri, M. C. Heinrich, R. M. Braziel, L. McGreevey, A. D. Haley, N. Giese, B. J. Druker, et al. Effects of MLN518, a dual FLT3 and KIT inhibitor, on normal and malignant hematopoiesis Blood, November 1, 2004; 104(9): 2912 - 2918. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Cools, N. Mentens, P. Furet, D. Fabbro, J. J. Clark, J. D. Griffin, P. Marynen, and D. G. Gilliland Prediction of Resistance to Small Molecule FLT3 Inhibitors: Implications for Molecularly Targeted Therapy of Acute Leukemia Cancer Res., September 15, 2004; 64(18): 6385 - 6389. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Brown, S. Meshinchi, M. Levis, T. A. Alonzo, R. Gerbing, B. Lange, R. Arceci, and D. Small Pediatric AML primary samples with FLT3/ITD mutations are preferentially killed by FLT3 inhibition Blood, September 15, 2004; 104(6): 1841 - 1849. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Li, H. Li, M.-N. Wang, D. Lu, R. Bassi, Y. Wu, H. Zhang, P. Balderes, D. L. Ludwig, B. Pytowski, et al. Suppression of leukemia expressing wild-type or ITD-mutant FLT3 receptor by a fully human anti-FLT3 neutralizing antibody Blood, August 15, 2004; 104(4): 1137 - 1144. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Levis, R. Pham, B. D. Smith, and D. Small In vitro studies of a FLT3 inhibitor combined with chemotherapy: sequence of administration is important to achieve synergistic cytotoxic effects Blood, August 15, 2004; 104(4): 1145 - 1150. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. D. Smith, M. Levis, M. Beran, F. Giles, H. Kantarjian, K. Berg, K. M. Murphy, T. Dauses, J. Allebach, and D. Small Single-agent CEP-701, a novel FLT3 inhibitor, shows biologic and clinical activity in patients with relapsed or refractory acute myeloid leukemia Blood, May 15, 2004; 103(10): 3669 - 3676. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. A. Armstrong, M. E. Mabon, L. B. Silverman, A. Li, J. G. Gribben, E. A. Fox, S. E. Sallan, and S. J. Korsmeyer FLT3 mutations in childhood acute lymphoblastic leukemia Blood, May 1, 2004; 103(9): 3544 - 3546. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Cools, H. Quentmeier, B. J. P. Huntly, P. Marynen, J. D. Griffin, H. G. Drexler, and D. G. Gilliland The EOL-1 cell line as an in vitro model for the study of FIP1L1-PDGFRA-positive chronic eosinophilic leukemia Blood, April 1, 2004; 103(7): 2802 - 2805. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Bagrintseva, R. Schwab, T. M. Kohl, S. Schnittger, S. Eichenlaub, J. W. Ellwart, W. Hiddemann, and K. Spiekermann Mutations in the tyrosine kinase domain of FLT3 define a new molecular mechanism of acquired drug resistance to PTK inhibitors in FLT3-ITD-transformed hematopoietic cells Blood, March 15, 2004; 103(6): 2266 - 2275. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A.-M. O'Farrell, J. M. Foran, W. Fiedler, H. Serve, R. L. Paquette, M. A. Cooper, H. A. Yuen, S. G. Louie, H. Kim, S. Nicholas, et al. An Innovative Phase I Clinical Study Demonstrates Inhibition of FLT3 Phosphorylation by SU11248 in Acute Myeloid Leukemia Patients Clin. Cancer Res., November 15, 2003; 9(15): 5465 - 5476. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Fiedler, R. Mesters, H. Tinnefeld, S. Loges, P. Staib, U. Duhrsen, M. Flasshove, O. G. Ottmann, W. Jung, F. Cavalli, et al. A phase 2 clinical study of SU5416 in patients with refractory acute myeloid leukemia Blood, October 15, 2003; 102(8): 2763 - 2767. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Q. Yao, R. Nishiuchi, Q. Li, A. R. Kumar, W. A. Hudson, and J. H. Kersey FLT3 Expressing Leukemias Are Selectively Sensitive to Inhibitors of the Molecular Chaperone Heat Shock Protein 90 through Destabilization of Signal Transduction-Associated Kinases Clin. Cancer Res., October 1, 2003; 9(12): 4483 - 4493. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. J. Giles, A. T. Stopeck, L. R. Silverman, J. E. Lancet, M. A. Cooper, A. L. Hannah, J. M. Cherrington, A.-M. O'Farrell, H. A. Yuen, S. G. Louie, et al. SU5416, a small molecule tyrosine kinase receptor inhibitor, has biologic activity in patients with refractory acute myeloid leukemia or myelodysplastic syndromes Blood, August 1, 2003; 102(3): 795 - 801. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Grundler, C. Thiede, C. Miething, C. Steudel, C. Peschel, and J. Duyster Sensitivity toward tyrosine kinase inhibitors varies between different activating mutations of the FLT3 receptor Blood, July 15, 2003; 102(2): 646 - 651. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A.-M. O'Farrell, T. J. Abrams, H. A. Yuen, T. J. Ngai, S. G. Louie, K. W. H. Yee, L. M. Wong, W. Hong, L. B. Lee, A. Town, et al. SU11248 is a novel FLT3 tyrosine kinase inhibitor with potent activity in vitro and in vivo Blood, May 1, 2003; 101(9): 3597 - 3605. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Sohal, V. T. Phan, P. V. Chan, E. M. Davis, B. Patel, L. M. Kelly, T. J. Abrams, A. M. O'Farrell, D. G. Gilliland, M. M. Le Beau, et al. A model of APL with FLT3 mutation is responsive to retinoic acid and a receptor tyrosine kinase inhibitor, SU11657 Blood, April 15, 2003; 101(8): 3188 - 3197. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Lowenberg, J. D. Griffin, and M. S. Tallman Acute Myeloid Leukemia and Acute Promyelocytic Leukemia Hematology, January 1, 2003; 2003(1): 82 - 101. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2002 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
