|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Prepublished online as a Blood First Edition Paper on June 21, 2002; DOI 10.1182/blood-2002-04-1174.
NEOPLASIA
From The Burnham Institute and University of
California-San Diego, La Jolla, CA; Tissue Proteomics Unit,
National Cancer Institute, National Institutes of Health, Bethesda, MD;
The University of Texas MD Anderson Cancer Center, Houston; ISIS
Pharmaceuticals, Carlsbad, CA; and Dartmouth Medical School, Hanover,
NH.
Chronic lymphocytic leukemia (CLL) cells develop chemo-resistance
over time. Most anticancer agents function through induction of
apoptosis, and therefore resistance against these agents is likely to
be caused by selection for CLL cells with defects in the particular
apoptosis pathway that is triggered by these drugs. Anticancer agents
that function through alternative apoptotic pathways might therefore be
useful in treating chemo-resistant CLL. Triterpenoids represent a class
of naturally occurring and synthetic compounds with demonstrated
antitumor activity. We examined the effects of CDDO (triterpenoid
2-cyano-3,12-dioxoolean-1,9-dien-28-oic acid) on CLL B cells in vitro.
CDDO induced apoptosis in a dose-dependent manner in all (n = 30) CLL
samples tested, including previously untreated and
chemo-resistant CLL specimens. CDDO induced rapid proteolytic
processing of caspase-8, but not caspase-9, in CLL B cells, suggesting
activation of a mitochondria-independent pathway. CDDO-induced
apoptosis of CLL B cells was blocked by cytokine response modifier A
(CrmA), a suppressor of caspase-8, but not by X-linked
inhibitor of apoptosis protein-baculovirus IAP
repeat-3 (XIAP-BIR3), a fragment of XIAP, which
selectively inhibits caspase-9. Examination of CDDO effects on
expression of several apoptosis-relevant genes demonstrated significant
reductions in the levels of caspase-8 homolog Fas-ligand
interleukin-1-converting enzyme (FLICE)-inhibitory protein
(c-FLIP), an endogenous antagonist of caspase-8. However, reductions of FLIP achieved by FLIP antisense oligonucleotides were
insufficient for triggering apoptosis, indicating that CDDO has other
targets in CLL B cells besides FLIP. These data suggest that the
synthetic triterpenoid CDDO should be further explored as a possible
therapeutic agent for treatment of chemo-resistant CLL.
(Blood. 2002;100:2965-2972) Susceptibility to apoptosis is an essential
prerequisite for successful eradication of tumor cells by cytotoxic T
lymphocytes, natural killer cells, radiation, or chemotherapy.
Consequently, resistance to apoptosis has been established as one of
the mechanisms responsible for the failure of therapeutic approaches in
many types of cancers, including hematopoietic malignancies. B-cell chronic lymphocytic leukemia (CLL) is the most common form of leukemia
in adults in the Western Hemisphere, with more than 12 000 new cases
diagnosed annually in the United States alone.1 CLL is
considered an incurable disease. Therefore, identifying new agents with
novel mechanisms of action that complement conventional cytotoxic
therapies and that abrogate chemo-resistance will be necessary if
further advances in the therapy of this disease are to be realized.
Apoptosis is caused by the activation in cells of a family of cysteine
proteases known as caspases.2 At least 2 major pathways for caspase activation have been delineated, including a pathway linked
to the tumor necrosis factor (TNF) family of death receptors ("extrinsic") and a pathway activated by mitochondria
("intrinsic").3,4 The mechanisms by which
antineoplastic drugs kill leukemia cells may be diverse, but most
cytotoxic agents seem to employ the intrinsic pathway for inducing
apoptosis.5 Consequently, when resistance develops,
defects in the mitochondria-initiated pathway for cell death are often
found. With the extrinsic pathway, ligand binding induces clustering of
TNF-family death receptors, causing recruitment of
caspase-binding adaptor proteins to their cytosolic domains, and
resulting in caspase activation by the "induced-proximity" mechanism.6 The intrinsic pathway is triggered by
cytochrome c release from mitochondria, which
binds the caspase-activating protein apoptotic protease-activating
factor-1 (Apaf-1), forming the apoptosome. The apical
proteases in the extrinsic and intrinsic pathways are caspase-8 and
caspase-9, respectively. Activation of both extrinsic and intrinsic
pathways results in the activation of downstream caspases such as
caspase-3, caspase-6, and caspase-7.7
CLL B cells are generally known to be resistant to apoptosis induced by
TNF-family death ligands, such as TNF- Triterpenoids represent a class of naturally occurring and synthetic
proximal proliferator-activated receptor- Patient specimens
Cell culture and apoptosis assay
Protein transduction by electroporation Apoptosis-inducing or apoptosis-inhibiting proteins were introduced into primary CLL B cells by electroporation. Proteins used for these experiments included recombinant purified caspase-8 and cytokine response modifier A (CrmA) (gifts of G. Salvesen, The Burnham Institute, La Jolla, CA), X-linked inhibitor of apoptosis protein (XIAP) (XIAP-baculovirus IAP repeat-3 [XIAP-BIR3]).21,22 Cytochrome c was obtained from Sigma (St Louis, MO). Briefly, cytochrome c (60 µM) or caspase-8 (12 nM), in the presence or absence of CrmA (10 µM) or XIAP-BIR3 (20 nM), was added to the cells (2 × 105) in 0.5 mL IMDM medium along with marker protein phycoerythrin-bovine serum albumin (PE-BSA) (4 µg/mL) (used to identify successfully transduced cells). The cell-protein suspensions were then transferred to electroporation cuvettes (0.4-cm diameter) (Biorad, Hercules, CA), kept on ice for 10 minutes, and then subjected to electroporation (Gene Pulser II; Biorad) with the use of 750 to 1250 V/cm and 900 µF capacitance, with voltage adjusted for each patient CLL sample to identify the conditions that gave the best uptake of PE-BSA while still preserving the viability of the majority of the cells. This protocol allowed delivery of proteins in most cells in patients' specimens (58% ± 18%), while preserving viability of the majority of the cells (68% ± 17% of 7-amino-actinomycin D-negative [7-AAD ]). Cells were
maintained on ice for an additional 10 minutes, transferred to 1.5-mL
microcentrifuge tubes (Eppendorf, Hamburg, Germany), and
cultured at 37°C in a CO2-air ratio of 5%:95% in humid
conditions for 1 hour as caspase activity was assessed. Normalization
of total protein concentration included during electroporation of
samples was accomplished by addition of unlabeled BSA, without affecting caspase activation.
Caspase activity assays Cytosolic extracts were prepared from primary CLL cells as previously described.23,24 Briefly, cells were washed in phosphate-buffered saline (PBS) and then resuspended in an equal volume of hypotonic lysis buffer (20 mM HEPES [N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid] [pH 7.5], 10 mM KCl, 1.5 mM MgCL2, 1 mM EDTA, and 1 mM dithiothreitol [DTT]). Cells were incubated on ice for 20 minutes and then disrupted by 15 passages through a 30-gauge needle. Cell extracts were clarified by centrifugation at 16 000g for 30 minutes. To initiate caspase activation, 10 µM horse heart cytochrome c (Sigma) with 1 mM deoxyadenosine triphosphate (dATP) or purified recombinant caspase-8 (10 nM) was added to cell extracts (5 mg/mL total protein), and mixtures were incubated at 30°C for 30 minutes. Hydrolysis of fluorogenic peptide, acetyl-Asp-Glu-Val-Asp-7-amino-4-trifluoromethylcoumarin (Ac-Asp-Glu-Val-Asp-AFC), was measured as an indicator of caspase activation, as previously described.23,24 Activated extracts were added to Ac-Asp-Glu-Val-Asp-AFC in caspase buffer (50 mM HEPES [pH 7.4], 10% sucrose, 1 mM EDTA, 0.1% CHAPS {3-[(3-cholamidopropyl)dimethylammonio]-1-propane-sulfonic acid}, 100 mM NaCl, and 10 mM DTT). Hydrolysis was measured for 20 minutes by release of AFC (excitation at 405 nm; emission at 510 nm) by means of a spectrofluorometer (fMax; Molecular Devices, Sunnyvale, CA) in the kinetic mode.Caspase-3-like effector protease activity in intact CLL B cells was measured with CaspaTag (Invitrogen, New York, NY) according to the manufacturer's instructions. CaspaTag is a cell-permeable FITC-labeled peptide that selectively and irreversibly binds active caspase 3. The CaspaTag assay is based on the well-described observation that caspase activation occurs prior to loss of outer membrane integrity and positive staining with viability dyes. CLL B cells (5 × 105/mL) were incubated with CaspaTag for 1 hour, after introducing various apoptosis activators and/or inhibitors by electroporation, followed by analysis by flow cytometry. Flow cytometry CLL B cells were treated with CaspaTag and stained with the viability dye 7-AAD at a final concentration of 2 ng/µL (Sigma) for 5 minutes at room temperature just prior to flow cytometry analysis (FACScan; Becton Dickinson). FITC (channel 1), PE (channel 2), and 7-AAD (channel 3) fluorescence was measured, and the Cell Quest program was used to analyze the data. PE+ (uptake of PE-BSA marker) and 7-AAD (viable) cells were gated, and the percentage of
gated cells expressing FITC was determined. Cells to which the PE
marker was added but that were not electroporated were used to
determine the positive and negative cutoffs for the various
fluorescent labels.
Immunoblot analysis Cell lysates were prepared by means of RIPA buffer (10 mM Tris [pH 7.4], 150 mM NaCl, 1% Triton × 100, 0.5% deoxycholate, 0.1% SDS, 5 mM EDTA) containing protease inhibitors (complete tablets; Roche). Lysates were normalized for total protein (12.5 µg) and subjected to SDS-polyacrylamide gel electrophrosis (SDS-PAGE) (4% to 20% gradient gels; ISC BioExpress, Kaysville, UT) and immunoblot analysis.25 Primary antibodies included anti-DR4 (Millennium, Boston, MA), anti-DR5 (Alexis), anti-Fas-associated death domain protein (anti-FADD) (Pharmingen, Franklin Lakes, NJ), anti-death-associated protein 3 (anti-DAP3) (Transduction Laboratories, San Diego, CA), anti-Fas-ligand interleukin-1 (FLICE)-converting enzyme inhibitory protein (anti-FLIP) (NF-6) (generously provided by M. Peter and J. Tschopp),26,27 and -actin
(Sigma). Immunodetection was accomplished with the use of
horseradish peroxidase (HRPase)-conjugated secondary antibodies and an
enhanced chemiluminescence (ECL) method (Amersham, Arlington Heights,
IL) involving exposure to x-ray film (XAR; Kodak, Rochester, NY).
Flow cytometry analysis of surface antigens Cells were collected and washed twice in PBS. Cells were incubated with 50 µg/mL nonspecific human immunoglobulin G (IgG) (Cappel, New York, NY) on ice for 10 minutes to block Fc receptors. Cells were then incubated with PE-conjugated purified monoclonal antibodies against death receptor 3 (DR3), DR4, DR5, decoy receptor 1 (DcR1), and decoy receptor 2 (DcR2) (BioScience, San Diego, CA) on ice for 1 hour. After incubation, cells were washed once with PBS, and the relative level of surface antigens was assessed by FACS analysis, by means of the FL-1 or FL-2 channels of a flow cytometer (FACSort; Becton Dickinson).Electroporation of oligonucleotides Antisense (FLIP) or control oligonucleotides (300 nM) (antisense oligonucleotide, ISIS 23296 [ACTTGTCCCTGCTCCTTGAA] or control oligonucleotide, ISIS 132383 [AGTTCTCTCTGCCCCTAGAT]) were introduced into CLL B cells by electroporation. Briefly, 0.5 mL CLL B cells in IMDM medium (2 × 106/mL) were added to electroporation cuvettes (0.4 cm) and placed on ice for 10 minutes. As a control for assessing the percentage of uptake, FITC-labeled oligonucleotides (300 nM) were added to another cuvette with cells. Following electroporation (750 to 1250 V/cm and 900 µF), the cells were placed on ice for an additional 10 minutes and then analyzed for percentage of uptake of FITC-oligonucleotides among the viable 7-amino-actinomycin D-negative (7-AAD) cells.
As an additional control, the labeled oligonucleotides were added to a
cuvette containing cells without electroporation to determine the basal
uptake. The cells were washed once in IMDM medium containing 20%
FCS, 1 mM L-glutamine, and antibiotics, and were then
resuspended and cultured at 2 × 106 cells per milliliter
in the same medium for 24 hours. Cells were harvested, and
analysis for apoptosis was assessed by annexin V-FITC/PI
labeling (5 × 105 cells per assay), or cell
lysates were prepared for immunoblot analysis, as described in
"Immunoblot analysis."
Protein microarrays CLL B cells (2 × 106) were resuspended in 30 µL lysis buffer containing 2 × SDS electrophoresis buffer (125 mM Tris [pH 6.8], 4% SDS, 10% glycerol, 2%-mercaptoethanol)
for 2 hours at 70°C. After cell lysis, samples were boiled for 3 to 5 minutes each, and 3 nL lysate was arrayed onto nitrocellulose slides
with a glass backing (Schleicher and Schuell, Keene, NH), with
a pin and ring GMSE 470 microarrayer (Affymetrix, Santa Clara,
CA) with the use of a 375-µm pin. Spatial densities
of 980 spots per slides and greater can easily be accommodated on a
20 × 30 mm slide.
Staining was carried out on an automated slide stainer (Dako, Carpinteria, CA) by means of the catalyzed signal-amplification system per the manufacturer's recommendation (Dako). Briefly, after microapplication of cellular lysates, the slides were treated for 15 minutes with Reblot (Chemicon, Temecular, CA) and subsequently washed 3 times for 10 minutes each with a Tris-buffered saline (TBS) washing buffer (300 mM NaCl, 0.1% Tween20, 50 mM Tris [pH 7.6]). After treatment, the arrays were blocked in a 0.5% casein solution for 30 minutes under constant rocking. Before each of the following steps, arrayed slides were washed 3 times 5 minutes each in TBS washing buffer. Endogenous biotin was blocked with the use of the biotin-blocking kit (Dako) for 5 minutes, followed by application of protein block (Dako) for 5 minutes. The incubation with primary antibody was diluted in antibody diluent (Dako) at a concentration of 1:1000 for 30 minutes and, finally, secondary link-antibody (Dako) for 30 minutes, at a concentration of 1:100 for antimouse (diluted in antibody diluent) and neat for antirabbit. Amplification and staining was carried out as follows: the labeled
microarray was treated with a streptavidin-biotin complex (Dako)
solution for 15 minutes, amplification reagent (biotinyl tyramide and
hydrogen peroxidase) for 15 minutes, and streptavidin-peroxidase for 15 minutes, and was finally stained with the use of 3,3'-diaminobenzidine tetrahydrochloride as chromogen. Specificity of each antibody was
tested by immunoblotting. Antibodies (anti-cleaved caspase-3, anti-cleaved caspase-8, anti-cleaved caspase-9) (Cell Signaling Technology, Beverly, MA) and anti-
Sensitive and drug-resistant CLL patient specimens respond to CDDO To assess the effect of the triterpenoid CDDO on apoptosis of cultured CLL B cells, we obtained specimens from 5 newly diagnosed, previously untreated CLL patients and 8 fludarabine-refractory CLL patients. These CLL B cells were cultured for 24 hours, in the presence or absence of F-Ara-A (0.1 to 1.0 µM) or with CDDO (0.1 to 1.0 µM) (Figure 1). The induction of apoptosis was determined by annexin V-FITC/PI double staining with the use of flow cytometry analysis. Six of the 8 cases diagnosed with progressive disease after fludarabine treatment demonstrated resistance in vitro to F-Ara-A with respect to apoptosis induction. Two of the previously untreated CLL cases showed intrinsic resistance to F-Ara-A in vitro, although these patients had never been treated with this drug in the clinic. The remaining newly diagnosed CLL specimens responded to F-Ara-A in vitro, with robust induction of apoptosis (Figure 1B). Among the CLL B-cell specimens that were resistant to F-Ara-A in vitro, all 8 cases displayed sensitivity to CDDO, undergoing apoptosis in response to this drug at concentrations below 1 µM (Figure 1A). All 5 F-Ara-A-sensitive CLL B cell specimens also responded to CDDO in vitro by undergoing apoptosis at even lower concentrations of the drug (Figure 1B).
In contrast to CLL B cells, normal B lymphocytes were largely resistant to CDDO (Figure 1C). For these experiments, normal B lymphocytes were purified from human tonsils and cultured in the presence of CDDO. Although relatively high rates of spontaneous apoptosis were observed in cultures of tonsillar B cells, the addition of CDDO at 0.1 to 1.0 µM induced little additional apoptosis (Figure 1C). Similar results were obtained when testing B lymphocytes isolated from peripheral blood of healthy individuals (data not shown). These results are in agreement with unpublished studies (M.B.S.) suggesting little toxic effect of CDDO on normal tissues. Since CDDO, being a weak PPAR
Defect in the intrinsic apoptosis pathway in fludarabine-refractory CLL samples The demonstration that CLL B cells that were resistant to a standard chemotherapeutic agent undergo apoptosis after culture with CDDO suggests that the cell death pathways triggered by CDDO and F-Ara-A are different. We therefore used a protein transduction method to compare the functional status of 2 caspase-activation pathways in CLL B cells: the mitochondria-dependent (intrinsic) and the death receptor-mediated (extrinsic) pathways. BSA, caspase-8, or cytochrome c was introduced into cells from an F-Ara-A-sensitive CLL patient by electroporation, and PE-BSA was used to determine the protein uptake efficiency in every condition. As shown in Figure 3A, electroporation efficiently delivered proteins into CLL cells. After electroporation, the induction of downstream effector caspase activity was measured by flow cytometry analysis with the use of the cell-permeable, caspase-3-specific, fluorogenic substrate CaspaTag, and the viability of the cells was determined by 7-AAD exclusion. Because each patient specimen differed in terms of optimal electroporation conditions, electroporation parameters were first optimized for each sample before proceeding to caspase activity assays. It is interesting to note that only a small percentage of the CLL cells that were successfully transduced with protein (gate R1 in Figure 3A) were positive for 7-AAD staining 1 hour after electroporation, although this percentage varied among CLL samples. This result further indicates that the majority of CLL cells remain viable after electroporation. As shown in Figure 3B, caspase-8 (Figure Bii) and cytochrome c (panel Biii), but not BSA (panel Bi), induced significant caspase-3 activity. This caspase-3 activity was observed as early as 1 hour after electroporation, whereas the CaspaTag-positive cells were still negative for 7-AAD staining, as is typical of cells in early stages of apoptosis. In contrast, a population of CaspaTag-positive and 7-AAD+ CLL cells was observed at 3 hours after electroporation, suggesting that these cells had progressed to the final stages of apoptosis. To further validate this method for assessing apoptosis pathways in CLL, cells from an F-Ara-A-sensitive CLL patient were electroporated with selective inhibitors of the intrinsic or extrinsic pathways, along with cytochrome c or caspase-8, respectively. Specifically, the caspase-8 inhibitor CrmA and the caspase-9 inhibitor XIAP-BIR3 were employed for these studies.20-22 As shown in Figure 3C, electroporation of CLL B cells with either cytochrome c or caspase-8 induced activation of effector caspases 1 hour after electroporation, as determined by an increase in the percentage of cells demonstrating CaspaTag positivity. Coelectroporation of CrmA blocked caspase activation induced by caspase-8 (Figure 3Ciii), but had comparatively less effect on cytochrome c (Figure 3Cvi). Conversely, coelectroporation of XIAP-BIR3 reduced caspase activation induced by cytochrome c (Figure 3Cv), but had relatively little effect on caspase-8 (Figure 3Cii). Introducing CrmA or XIAP-BIR alone did not induce CaspaTag activity (data not shown). These data therefore demonstrate the utility of the electroporation method of protein transduction for assessing integrity of caspase-activation pathways downstream of caspase-8 (extrinsic) and cytochrome c (intrinsic).
Next, we used the electroporation method to contrast the status of
caspase-activation pathways in F-Ara-A-resistant CLL B cells. In CLL B
cells from patients with fludarabine-sensitive disease, cytochrome
c and caspase-8 induced activation of effector caspases to
comparable extents (Figure 4A).
Furthermore, CrmA and XIAP-BIR3 partially suppressed caspase
activation induced by caspase-8 and cytochrome c,
respectively. In contrast, cytochrome c was
considerably less effective than caspase-8 at inducing caspase activation in CLL B cells from fludarabine-refractory patients (Figure
4B). This observation was confirmed by measuring caspase activity in
cell lysates in the 2 samples in which enough cells were obtained (data
not shown). These findings indicate the presence of a blockage of the
intrinsic apoptosis pathway in F-Ara-A-resistant leukemia cells. All
together, these findings suggest that resistance to chemotherapy can be
associated with a defect in the intrinsic apoptosis pathway,
whereas the extrinsic pathway remains functional in CLL B cells.
CDDO activates the extrinsic apoptosis pathway in CLL To determine if CDDO induces apoptosis in CLL through activation of the extrinsic pathway, we cultured CLL B cells with CDDO after introducing the caspase-8 inhibitor CrmA or the caspase-9 inhibitor XIAP-BIR3 by electroporation. For comparisons, CLL B cells were also electroporated with caspase-8. CDDO induced activation of effector caspases in the CLL B cells, as determined by CaspaTag-substrate positivity (Figure 5). Furthermore, CDDO-mediated activation of caspases was inhibited by CrmA but not by XIAP-BIR3. Similar results were obtained with electroporation of caspase-8 (used here as a comparative control), showing suppression of downstream caspases activated by CrmA but not XIAP-BIR3 (Figure 5).
To further explore the apoptosis pathways activated by CDDO in CLL B
cells, we also contrasted the kinetics of proteolytic processing
("activation") of procaspase-3, procaspase-8, and procaspase-9 using a semiquantitative protein dot-blot method in conjugation with
antibodies specific for the cleaved forms of these individual proteases. As shown in Figure 6, CDDO
induced rapid cleavage of procaspase-8, with maximal accumulation of
cleaved caspase-8 occurring within 1 hour after CDDO treatment.
Cleavage of caspase-3 peaked at approximately 2 hours of culture,
whereas cleaved caspase-9 slowly accumulated over time in CDDO-treated
CLL B cells. These data are thus consistent with the hypothesis that
CDDO triggers apoptosis of CLL B cells primarily through mechanisms
that engage the extrinsic pathway at or above the level of caspase-8.
CDDO down-regulates the antiapoptotic protein FLIP in CLL cells We examined the effects of CDDO and various PPAR modulators on
the expression in CLL B cells of apoptosis-regulatory proteins known to
operate within the extrinsic pathway, including DR4, DR5, FADD, DAP3,
and FLIP. CDDO potently reduced levels of the antiapoptotic FLIP
protein in all CLL B-cell samples analyzed (n = 15), while having no
effect on the levels of other proteins involved in the extrinsic
pathway (Figure 7A). CDDO-Me reduced FLIP
levels in some CLL B-cell samples (3 of 15), though it was less potent
than CDDO (Figure 7A; also data not shown). Troglitazone had no effect
on levels of FLIP or other extrinsic proteins tested (Figure 7A).
Dose-response experiments showed a correlation between CDDO
concentration, down-regulation of FLIP protein levels, and the extent
of apoptosis induction in cultured CLL B cells (Figure 7B).
FLIP reductions are inadequate to explain proapoptotic effect of CDDO To determine whether down-regulation of FLIP is sufficient to account for the apoptotic effect of CDDO in CLL B cells, we knocked down FLIP expression using antisense oligonucleotides. To this end, FLIP antisense or randomized-sequence control oligonucleotides were introduced into CLL B cells by electroporation. Immunoblot analysis of the cells performed 1 day later demonstrated antisense-specific reductions in the steady-state levels of FLIP protein (Figure 8A, top). Although potently reducing levels of FLIP protein, antisense FLIP oligonucleotides did not induce apoptosis of CLL B cells, implying that this alone is inadequate to explain the proapoptotic effect of CDDO (Figure 8A).
CDDO sensitizes some CLL B cells to TRAIL-induced apoptosis The modulation of FLIP in CLL B cells by CDDO raised the question of whether CDDO could be used to sensitize CLL B cells to TNF-family death receptor agents such as TRAIL. To explore this idea, we cultured CLL B cells in the presence or absence of 1 µM CDDO for 6 hours (which was determined to be adequate for reducing FLIP protein levels [not shown]) and then added 100 ng/mL TRAIL to the cultures. Apoptosis of the CLL B cells was then assessed 24 hours later by double staining with annexin V-FITC/PI, by means of flow cytometry analysis. The majority of CLL B cells (25 of 30) responded strongly to CDDO by itself, and in this group of patient samples no significant sensitization to TRAIL was observed, nor did TRAIL alone induce apoptosis (data not shown). However, for the few CLL samples in which CDDO induced less than 50% apoptosis, 2 of 5 patient specimens demonstrated sensitization to TRAIL-induced apoptosis (Figure 8B). In parallel experiments, we determined that CDDO did not change the levels of TRAIL surface receptors DR4, DR5, DcR1, and DcR2 as determined by flow cytometric analysis with the use of PE-labeled antibodies recognizing these receptors (data not shown). Taken together, these findings suggest that some leukemia cells from CLL patient specimens can be sensitized to TRAIL-induced apoptosis by treatment with CDDO.
CLL represents a quintessential example of a malignancy caused by defects in the regulation of apoptosis, as opposed to uncontrolled cell proliferation.29 Progression to chemoresistance in these patients is thought to be a consequence, at least in part, of an apoptosis-resistant phenotype of their CLL cells, given that cross-resistance to several cytotoxic agents is typically observed. Certainly, however, classical mechanisms can also make contributions to the problem of chemoresistance, such as altered drug uptake or metabolism.30 Identifying new agents with alternative mechanisms of action that complement conventional therapies and that can overcome CLL drug resistance will be necessary if further advances in the therapy of this disease are to be accomplished. In this study, we have analyzed the effect on CLLs of PPAR The demonstration that CLL resistant to standard anticancer agents
undergoes apoptosis after culture with CDDO indicates that CDDO induces
apoptosis through different mechanisms than those triggered by
cytotoxic chemotherapeutic drugs. To address this issue, we analyzed
the functional status of the 2 caspase-activation pathways It is thought that most anticancer drugs induce cytochrome c
release from mitochondria, thereby exerting their cell death effects
through the intrinsic apoptosis pathway.5,36 This hypothesis is supported by several findings. Caspase 9 To explore the mechanism by which CDDO triggers the extrinsic apoptosis
pathway in CLL B cells, we analyzed the effects of this compound on the
levels of various apoptosis-regulatory proteins. The levels of the
antiapoptotic protein FLIP were decreased by CDDO in a dose-dependent
manner, in contrast to other apoptosis-relevant proteins examined,
including FADD, DAP3, DR3, DR4, DR5, DcR1, and DcR2. The FLIP protein
is structurally very similar to procaspase-8 and procaspase-10, having
2 tandem death effector domains (DEDs) followed by a
caspase-protease-like domain. Unlike procaspase-8 and procaspase-10,
however, the caspaselike domain of FLIP is defective in protease
activity, and thus FLIP functions as a
trans-dominant inhibitor of caspase-8 and
caspase-10 in a variety of contexts.42 Overexpression of
FLIP has been associated with resistance to Fas, TNF- We found that while CDDO induced apoptosis of CLL B cells, the
thiazoladine-dione troglitazone did not, and the CDDO analog, CDDO-Me,
was less potent than CDDO. In this regard, troglitazone is a more
potent PPAR
We thank April C. Sawyer for manuscript preparation and the invaluable assistance from Ed Sausville and Kenneth Snader.
Submitted April 18, 2002; accepted June 3, 2002.
Prepublished online as Blood First Edition Paper, June 21, 2002; DOI 10.1182/blood-2002-04-1174.
Supported by RAID; NCI; the National Institutes of Health (CA-81534; CA-78814); National Foundation of Cancer Research (NFCR); and the Oliver and Jennie Donaldson Foundation.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: John C. Reed, The Burnham Institute, 10901 N Torrey Pines Rd, La Jolla, CA 92037; e-mail: jreed{at}burnham.org.
1. Parker SL, Tong T, Bolden S, Wingo PA. Cancer statistics. CA Cancer J Clin. 1997;47:5-27[Medline] [Order article via Infotrieve]. 2. Reed JC. Apoptosis-based therapies. Nat Drug Disc. 2002;1:111-121. 3. Green D. Apoptotic pathways: the roads to ruin. Cell. 1998;94:695-698[CrossRef][Medline] [Order article via Infotrieve]. 4. Salvesen GS, Dixit VM. Caspases: intracellular signaling by proteolysis. Cell. 1997;91:443-446[CrossRef][Medline] [Order article via Infotrieve]. 5. Kroemer G, Reed JC. Mitochondrial control of cell death. Nat Med. 2000;6:513-519[CrossRef][Medline] [Order article via Infotrieve].
6.
Salvesen GS, Dixit VM.
Caspase activation: the induced-proximity model.
Proc Natl Acad Sci U S A.
1999;96:10964-10967
7.
Thornberry NA, Lazebnik Y.
Caspases: enemies within.
Science.
1998;281:1312-1316 8. Panayiotidis P, Ganeshaguru K, Foroni L, Hoffbrand AV. Expression and function of the FAS antigen in B chronic lymphocytic leukemia and hairy cell leukemia. Leukemia. 1995;9:1227-1232[Medline] [Order article via Infotrieve]. 9. Wang D, Freeman GJ, Levine H, Ritz J, Robertson MJ. Role of the CD40 and CD95 (APO-1/Fas) antigens in the apoptosis of human B-cell malignancies. Br J Haematol. 1997;97:409-417[CrossRef][Medline] [Order article via Infotrieve].
10.
Jones DT, Ganeshaguru K, Virchis AE, et al.
Caspase 8 activation independent of Fas (CD95/APO-1) signaling may mediate killing of B-chronic lymphocytic leukemia cells by cytotoxic drugs or 11. Snell V, Clodi K, Zhao S, et al. Activity of TNF-related apoptosis-inducing ligand (TRAIL) in haematological malignancies. Br J Haematol. 1997;99:618-624[CrossRef][Medline] [Order article via Infotrieve].
12.
Wang Y, Porter WW, Suh N, et al.
A synthetic triterpenoid, 2-cyano-3,12-dioxooleana-1,9-dien-28-oic acid (CDDO), is a ligand for the peroxisome proliferator-activated receptor
13.
Stadheim TA, Suh N, Ganju N, Sporn M, Eastman A.
The novel triterpenoid 2-cyano-3,12-dioxooleana-1,9-dien-28-oic acid (CDDO) potently enhances apoptosis induced by tumor necrosis factor in human leukemia cells.
J Biol Chem.
2002;277:16448-16455 14. Honda T, Gribble GW, Suh N, et al. Novel synthetic oleanane and ursane triterpenoids with various enone functionalities in ring A as inhibitors of nitric oxide production in mouse macrophages. J Med Chem. 2000;43:1866-1877[CrossRef][Medline] [Order article via Infotrieve].
15.
Suh N, Honda T, Finlay HJ, et al.
Novel triterpenoids suppress inducible nitric oxide synthase (iNOS) and inducible cyclooxygenase (COX-2) in mouse macrophages.
Cancer Res.
1998;58:717-723
16.
Ito Y, Pandey P, Place A, et al.
The novel triterpenoid 2-cyano-3,12-dioxoolean-1,9-dien-28-oic acid induces apoptosis of human myeloid leukemia cells by a caspase-8-dependent mechanism.
Cell Growth Differ.
2000;11:261-267
17.
Ito Y, Pandey P, Sporn MB, Datta R, Kharbanda S, Kufe D.
The novel triterpenoid CDDO induced apoptosis and differentiation of human osteosarcoma cells by a caspase-8 dependent mechanism.
Mol Pharmacol.
2001;59:1094-1099
18.
Cheson BD, Bennett JM, Grever M, et al.
National Cancer Institute-sponsored Working Group guidelines for chronic lymphocytic leukemia: revised guidelines for diagnosis and treatment.
Blood.
1996;87:4990-4997 19. Honda T, Rounds BA, Gribble GW, Suh N, Wang N, Sporn MB. Design and synthesis of 2-cyano-3,12-dioxoolean-1,9-dien-28-oic acid, a novel and highly active inhibitor of nitric oxide producion in mouse macrophages. Bioorg Med Chem Lett. 1998;8:2711-2714[CrossRef][Medline] [Order article via Infotrieve]. 20. Zhou Q, Salvesen GS. Viral caspase inhibitors CrmA and p53. Methods Enzymol. 2000;322:143-154[CrossRef][Medline] [Order article via Infotrieve].
21.
Takahashi R, Deveraux QL, Tamm I, et al.
A single BIR domain of XIAP sufficient for inhibiting caspases.
J Biol Chem.
1998;273:7787-7790 22. Deveraux QL, Leo E, Stennicke HR, Welsh K, Salvesen GS, Reed JC. Cleavage of human inhibitor of apoptosis protein XIAP results in fragments with distinct specificities for caspases. EMBO J. 1999;18:5242-5251[CrossRef][Medline] [Order article via Infotrieve]. 23. Liu X, Kim CN, Yang J, Jemmerson R, Wang X. Induction of apoptotic program in cell-free extracts: requirement for dATP and cytochrome c. Cell. 1996;86:147-157[CrossRef][Medline] [Order article via Infotrieve]. 24. Deveraux QL, Takahashi R, Salvesen GS, Reed JC. X-linked IAP is a direct inhibitor of cell death proteases. Nature. 1997;388:300-304[CrossRef][Medline] [Order article via Infotrieve]. 25. Krajewski S, Zapata JM, Reed JC. Detection of multiple antigens on Western blots. Anal Biochem. 1996;236:221-228[CrossRef][Medline] [Order article via Infotrieve].
26.
Scaffidi C, Medema JP, Krammer PH, Peter ME.
FLICE is predominantly expressed as two functionally active isoforms, caspase-8/a and caspase-8/b.
J Biol Chem.
1997;272:26953-26958 27. Irmler M, Thome M, Hahne M, et al. Inhibition of death receptor signals by cellular FLIP. Nature. 1997;388:190-195[CrossRef][Medline] [Order article via Infotrieve]. 28. Sporn MB, Suh N, Mangelsdorf DJ. Prospects for prevention and treatment of cancer with selective PPARgamma modulators (SPARMs). Trends Mol Med. 2001;7:395-400[CrossRef][Medline] [Order article via Infotrieve]. 29. Reed JC. Molecular biology of chronic lymphocytic leukemia: implications for therapy. Semin Hematol. 1998;35:3-13[Medline] [Order article via Infotrieve]. 30. Plunkett W, Gandhi V. Pharmacology of purine nucleoside analogues. Hematol Cell Ther. 1996;38(suppl2):S67-S74[Medline] [Order article via Infotrieve].
31.
Suh N, Wang Y, Honda T, et al.
A novel synthetic oleanane triterpenoid, 2-cyano-3,12-dioxoolean-1,9-dien-28-oic acid, with potent differentiating, antiproliferative, and anti-inflammatory activity.
Cancer Res.
1999;59:336-341
32.
Sarraf P, Mueller E, Jones D, et al.
Differentiation and reversal of malignant changes in colon cancer through PPAR
33.
Elstner E, Muller C, Koshizuka K, et al.
Ligands for peroxisome proliferator-activated receptor
34.
Kim Y, Suh N, Sporn M, Reed JC.
An inducible pathway for degradation of FLIP protein sensitizes tumor cells to TRAIL-induced apoptosis.
J Biol Chem.
2002;277:22320-22329
35.
Genini D, Adachi S, Chao Q, et al.
Deoxyadenosine analogs induce programmed cell death in chronic lymphocytic leukemia cells by damaging the DNA and by directly affecting the mitochondria.
Blood.
2000;96:3537-3543
36.
Herr I, Debatin K-M.
Cellular stress response and apoptosis in cancer therapy.
Blood.
2001;98:2603-2614 37. Hakem R, Hakem A, Duncan GS, et al. Differential requirement for caspase 9 in apoptotic pathways in vivo. Cell. 1998;94:339-352[CrossRef][Medline] [Order article via Infotrieve]. 38. Kuida K, Haydar TF, Kuan C-Y, et al. Reduced apoptosis and cytochrome c-mediated caspase activation in mice lacking caspase 9. Cell. 1998;94:325-337[CrossRef][Medline] [Order article via Infotrieve]. 39. Cecconi F, Alvarez-Bolado G, Meyer BI, Roth KA, Gruss P. Apaf1 (CED-4 homolog) regulates programmed cell death in mammalian development. Cell. 1998;94:727-737[CrossRef][Medline] [Order article via Infotrieve]. 40. Yoshida H, Kong YY, Yoshida R, et al. Apaf1 is required for mitochondrial pathways of apoptosis and brain development. Cell. 1998;94:739-750[CrossRef][Medline] [Order article via Infotrieve].
41.
Tang D, Lahti JM, Kidd VJ.
Caspase-8 activation and bid cleavage contribute to MCF7 cellular execution in a caspase-3-dependent manner during staurosporine-mediated apoptosis.
J Biol Chem.
2000;275:9303-9307 42. Tschopp J, Irmler M, Thome M. Inhibition of Fas death signals by FLIPs. Curr Opin Immunol. 1998;10:552-558[CrossRef][Medline] [Order article via Infotrieve]. 43. Schneider P, Tschopp J. Apoptosis induced by death receptors. Pharm Acta Helv. 2000;74:281-286[CrossRef][Medline] [Order article via Infotrieve].
44.
Konopleva M, Tsao T, Ruvolo P, et al.
Novel triterpenoid CDDO-Me is a potent inducer of apoptosis and differentiation in acute myelogenous leukemia.
Blood.
2002;99:326-335
© 2002 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  A. L. Groeger and B. A. Freeman Signaling Actions of Electrophiles: Anti-inflammatory Therapeutic Candidates Mol. Interv., February 1, 2010; 10(1): 39 - 50. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. L. Hyer, R. Shi, M. Krajewska, C. Meyer, I. V. Lebedeva, P. B. Fisher, and J. C. Reed Apoptotic Activity and Mechanism of 2-Cyano-3,12-Dioxoolean-1,9-Dien-28-Oic-Acid and Related Synthetic Triterpenoids in Prostate Cancer Cancer Res., April 15, 2008; 68(8): 2927 - 2933. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. S. Brookes, K. Morse, D. Ray, A. Tompkins, S. M. Young, S. Hilchey, S. Salim, M. Konopleva, M. Andreeff, R. Phipps, et al. The Triterpenoid 2-Cyano-3,12-dioxooleana-1,9-dien-28-oic Acid and Its Derivatives Elicit Human Lymphoid Cell Apoptosis through a Novel Pathway Involving the Unregulated Mitochondrial Permeability Transition Pore Cancer Res., February 15, 2007; 67(4): 1793 - 1802. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. M. Yore, K. T. Liby, T. Honda, G. W. Gribble, and M. B. Sporn The synthetic triterpenoid 1-[2-cyano-3,12-dioxooleana-1,9(11)-dien-28-oyl]imidazole blocks nuclear factor-{kappa}B activation through direct inhibition of I{kappa}B kinase {beta} Mol. Cancer Ther., December 1, 2006; 5(12): 3232 - 3239. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. D. Couch, N. J. Ganem, M. Zhou, V. M. Popov, T. Honda, T. D. Veenstra, M. B. Sporn, and A. C. Anderson 2-Cyano-3,12-dioxooleana-1,9(11)-diene-28-oic Acid Disrupts Microtubule Polymerization: A Possible Mechanism Contributing to Apoptosis Mol. Pharmacol., April 1, 2006; 69(4): 1158 - 1165. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. S. Ricci and W.-X. Zong Chemotherapeutic approaches for targeting cell death pathways. Oncologist, April 1, 2006; 11(4): 342 - 357. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. D. Schimmer, M. P. Thomas, R. Hurren, M. Gronda, M. Pellecchia, G. R. Pond, M. Konopleva, D. Gurfinkel, I. A. Mawji, E. Brown, et al. Identification of Small Molecules that Sensitize Resistant Tumor Cells to Tumor Necrosis Factor-Family Death Receptors Cancer Res., February 15, 2006; 66(4): 2367 - 2375. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. C. Reed and M. Pellecchia Apoptosis-based therapies for hematologic malignancies Blood, July 15, 2005; 106(2): 408 - 418. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Chintharlapalli, S. Papineni, M. Konopleva, M. Andreef, I. Samudio, and S. Safe 2-Cyano-3,12-dioxoolean-1,9-dien-28-oic Acid and Related Compounds Inhibit Growth of Colon Cancer Cells through Peroxisome Proliferator-Activated Receptor {gamma}-Dependent and -Independent Pathways Mol. Pharmacol., July 1, 2005; 68(1): 119 - 128. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Re, R. K. Thomas, K. Behringer, and V. Diehl From Hodgkin disease to Hodgkin lymphoma: biologic insights and therapeutic potential Blood, June 15, 2005; 105(12): 4553 - 4560. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. L. Hyer, R. Croxton, M. Krajewska, S. Krajewski, C. L. Kress, M. Lu, N. Suh, M. B. Sporn, V. L. Cryns, J. M. Zapata, et al. Synthetic Triterpenoids Cooperate with Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand to Induce Apoptosis of Breast Cancer Cells Cancer Res., June 1, 2005; 65(11): 4799 - 4808. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. T. Dinkova-Kostova, K. T. Liby, K. K. Stephenson, W. D. Holtzclaw, X. Gao, N. Suh, C. Williams, R. Risingsong, T. Honda, G. W. Gribble, et al. Extremely potent triterpenoid inducers of the phase 2 response: Correlations of protection against oxidant and inflammatory stress PNAS, March 22, 2005; 102(12): 4584 - 4589. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Starczynski, C. Pepper, G. Pratt, L. Hooper, A. Thomas, D. Milligan, P. Bentley, and C. Fegan Common Polymorphism G(-248)A in the Promoter Region of the bax Gene Results in Significantly Shorter Survival in Patients With Chronic Lymphocytic Leukemia Once Treatment Is Initiated J. Clin. Oncol., March 1, 2005; 23(7): 1514 - 1521. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Zou, X. Liu, P. Yue, Z. Zhou, M. B. Sporn, R. Lotan, F. R. Khuri, and S.-Y. Sun c-Jun NH2-Terminal Kinase-Mediated Up-regulation of Death Receptor 5 Contributes to Induction of Apoptosis by the Novel Synthetic Triterpenoid Methyl-2-Cyano-3,12-Dioxooleana-1, 9-Dien-28-Oate in Human Lung Cancer Cells Cancer Res., October 15, 2004; 64(20): 7570 - 7578. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. A. Svingen, D. Loegering, J. Rodriquez, X. W. Meng, P. W. Mesner Jr., S. Holbeck, A. Monks, S. Krajewski, D. A. Scudiero, E. A. Sausville, et al. Components of the Cell Death Machine and Drug Sensitivity of the National Cancer Institute Cell Line Panel Clin. Cancer Res., October 15, 2004; 10(20): 6807 - 6820. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Chauhan, G. Li, K. Podar, T. Hideshima, C. Mitsiades, R. Schlossman, N. Munshi, P. Richardson, F. E. Cotter, and K. C. Anderson Targeting mitochondria to overcome conventional and bortezomib/proteasome inhibitor PS-341 resistance in multiple myeloma (MM) cells Blood, October 15, 2004; 104(8): 2458 - 2466. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Konopleva, E. Elstner, T. J. McQueen, T. Tsao, A. Sudarikov, W. Hu, W. D. Schober, R.-Y. Wang, D. Chism, S. M. Kornblau, et al. Peroxisome proliferator-activated receptor {gamma} and retinoid X receptor ligands are potent inducers of differentiation and apoptosis in leukemias Mol. Cancer Ther., October 1, 2004; 3(10): 1249 - 1262. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Chauhan, G. Li, K. Podar, T. Hideshima, R. Shringarpure, L. Catley, C. Mitsiades, N. Munshi, Y. T. Tai, N. Suh, et al. The bortezomib/proteasome inhibitor PS-341 and triterpenoid CDDO-Im induce synergistic anti-multiple myeloma (MM) activity and overcome bortezomib resistance Blood, April 15, 2004; 103(8): 3158 - 3166. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Hail Jr., M. Konopleva, M. Sporn, R. Lotan, and M. Andreeff Evidence Supporting a Role for Calcium in Apoptosis Induction by the Synthetic Triterpenoid 2-Cyano-3,12-dioxooleana-1,9-dien-28-oic Acid (CDDO) J. Biol. Chem., March 19, 2004; 279(12): 11179 - 11187. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. T. Jones, E. Addison, J. M. North, M. W. Lowdell, A. V. Hoffbrand, A. B. Mehta, K. Ganeshaguru, N. I. Folarin, and R. G. Wickremasinghe Geldanamycin and herbimycin A induce apoptotic killing of B chronic lymphocytic leukemia cells and augment the cells' sensitivity to cytotoxic drugs Blood, March 1, 2004; 103(5): 1855 - 1861. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Ikeda, Y. Nakata, F. Kimura, K. Sato, K. Anderson, K. Motoyoshi, M. Sporn, and D. Kufe Induction of redox imbalance and apoptosis in multiple myeloma cells by the novel triterpenoid 2-cyano-3,12-dioxoolean-1,9-dien-28-oic acid Mol. Cancer Ther., January 1, 2004; 3(1): 39 - 45. [Abstract] [Full Text]
|
|
|
|
|
|
T. Ikeda, M. Sporn, T. Honda, G. W. Gribble, and D. Kufe The Novel Triterpenoid CDDO and its Derivatives Induce Apoptosis by Disruption of Intracellular Redox Balance Cancer Res., September 1, 2003; 63(17): 5551 - 5558. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Greil, G. Anether, K. Johrer, and I. Tinhofer Tracking death dealing by Fas and TRAIL in lymphatic neoplastic disorders: pathways, targets, and therapeutic tools J. Leukoc. Biol., September 1, 2003; 74(3): 311 - 330. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. E. Place, N. Suh, C. R. Williams, R. Risingsong, T. Honda, Y. Honda, G. W. Gribble, L. M. Leesnitzer, J. B. Stimmel, T. M. Willson, et al. The Novel Synthetic Triterpenoid, CDDO-Imidazolide, Inhibits Inflammatory Response and Tumor Growth in Vivo Clin. Cancer Res., July 1, 2003; 9(7): 2798 - 2806. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Wajant Targeting the FLICE Inhibitory Protein (FLIP) in Cancer Therapy Mol. Interv., May 1, 2003; 3(3): 124 - 127. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. D. Schimmer, I. M. Pedersen, S. Kitada, E. Eksioglu-Demiralp, M. D. Minden, R. Pinto, K. Mah, M. Andreeff, Y. Kim, W. S. Suh, et al. Functional Blocks in Caspase Activation Pathways Are Common in Leukemia and Predict Patient Response to Induction Chemotherapy Cancer Res., March 15, 2003; 63(6): 1242 - 1248. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. L. Carroll, D. Bhojwani, D.-J. Min, E. Raetz, M. Relling, S. Davies, J. R. Downing, C. L. Willman, and J. C. Reed Pediatric Acute Lymphoblastic Leukemia Hematology, January 1, 2003; 2003(1): 102 - 131. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2002 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
, Fas ligand (FasL), and TNF-related apoptosis-inducing ligand
(TRAIL)
B (NF-
the
mitochondria-mediated (intrinsic) pathway and the death
receptor-mediated (extrinsic) pathway