|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Prepublished online as a Blood First Edition Paper on June 28, 2002; DOI 10.1182/blood-2002-02-0454.
PHAGOCYTES
From the Respiratory Medicine Division, Department of
Medicine, University of Cambridge School of Clinical Medicine,
Addenbrooke's and Papworth Hospitals, Cambridge; Respiratory Medicine
Unit, Department of Medicine, University of Edinburgh Medical School;
Respiratory Medicine Unit, Western General Hospital, Edinburgh; and
Institute of Molecular Medicine, John Radcliffe Hospital, Wellcome
Trust Centre for Human Genetics, Oxford, United Kingdom.
Neutrophil apoptosis represents a major mechanism involved in the
resolution of acute inflammation. In contrast to the effect of hypoxia
observed in many other cell types, oxygen deprivation, as we have
shown, causes a profound but reversible delay in the rate of
constitutive apoptosis in human neutrophils when aged in vitro. This
effect was mimicked by exposing cells to 2 structurally unrelated
iron-chelating agents, desferrioxamine (DFO) and
hydroxypyridines (CP-94), and it appeared specific for hypoxia
in that no modulation of apoptosis was observed with mitochondrial
electron transport inhibitors, glucose deprivation, or heat shock. The
involvement of chelatable iron in the oxygen-sensing mechanism was
confirmed by the abolition of the DFO and CP-94 survival effect by
Fe2+ ions. Although hypoxia inducible factor-1 Neutrophils are key effector cells of the innate
immune system and play a vital role in host defense against
gram-negative bacteria. However, excessive or sustained activation of
these cells can result in significant tissue damage, with injury
resulting from the release of histotoxic granule contents,
reactive-oxygen intermediates, and other proinflammatory
mediators.1 Persistent accumulation of primed and
activated neutrophils is a cardinal feature of a number of lung
diseases, including acute lung injury, bronchiectasis, and chronic
obstructive airways disease, and it is associated with disease
progression and destruction of lung tissue.2 Similarly, in
myocardial infarction, neutrophils have been implicated in extending
the area of primary myocardial injury by releasing protease-rich
granule contents into adjacent viable tissue,3 and, in
rheumatoid arthritis, neutrophil-derived reactive-oxygen species and
granule enzymes have been demonstrated in synovial fluid and again
implicated in disease pathogenesis.4,5 Understanding the
mechanisms that modulate neutrophil influx, activation, and longevity
is therefore of major pathophysiologic importance to a number of organ
systems. The latter 2 events are regulated in large part by the
capacity of senescent neutrophils to undergo spontaneous apoptosis,
which leads to inhibition of secretory function and to prompt ingestion
and removal by inflammatory macrophages.6,7
Apoptosis is a constitutive event in neutrophils and is proposed to be
a major mechanism underlying the resolution of granulocyte inflammation.8-11 Neutrophil apoptosis and subsequent
macrophage clearance have also been identified in a number of in vivo
settings, including pulmonary inflammation in neonates,12
resolution of experimental pneumonia,13 and resolution of
oleic-acid-induced acute lung injury.14 Interleukin-10
(IL-10) has also been shown to enhance the resolution of
lipopolysaccharide (LPS)-induced pulmonary inflammation in rats by
promoting granulocyte apoptosis,13 again lending support
to the importance of neutrophil apoptosis and clearance in the
resolution of inflammation.
It is now recognized that the rate of neutrophil apoptosis can be
profoundly influenced by certain inflammatory mediators including
granulocyte macrophage-colony-stimulating factor (GM-CSF), G-CSF,
IL-1 Tissue injury and inflammation can result in a significant decrease in
local oxygen tension, and it is essential that the normal mechanisms of
tissue protection and repair not be compromised by such conditions.
Clearly, the importance of neutrophil apoptosis in the resolution of
inflammation dictates that any ability of hypoxia to block this process
could have important adverse effects on the clearance of these cells in
vivo. Although the mean alveolar PO2 in healthy adults is
13.6 kPa, mean PO2 values of 3.5 kPa have been reported in
rheumatoid synovium,24 with even lower values recorded in
wound tissues (range, 0.8-1.5 kPa).25,26
To enable cells to respond to changes in oxygen tension, mechanisms for
cellular oxygen sensing must be present. Studies looking at the 3'
hypoxic response element of the EPO gene led to the identification of a transcriptional activator, hypoxia inducible factor-1 (HIF-1).27 HIF-1 is a heterodimeric member of the
basic helix-loop-helix Per-Arnt-Sim homology (PAS) proteins and
is composed of an HIF-1 In view of the importance of neutrophil apoptosis to the resolution of
inflammation and our previous observation that hypoxia can inhibit this
event, we wanted to explore the cellular events underlying this process
and the associated oxygen-sensing mechanisms. We demonstrate that the
apoptotic threshold in neutrophils is acutely but reversibly regulated
by the ambient PO2 and that the hypoxia-mediated survival
effect can be mimicked by the iron chelators DFO and CP-94, suggesting
the involvement of a similar ferroprotein-sensing mechanism as
described in other tissues. Of note, prolonged hypoxia (24 hours or
longer) appears to induce a more refractory survival effect. The
specificity of this effect is demonstrated in part by the inability of
mitochondrial electron chain inhibitors, glucose deprivation, or heat
shock to influence the rate of neutrophil apoptosis. Furthermore, the
antiapoptotic effect of hypoxia is shown to be dependent on
continuing protein synthesis, associated with the up-regulation of
HIF-1 Neutrophil isolation and culture
Neutrophils were routinely cultured in supplemented IMDM in the
presence or absence of test agents (1 µM-10 mM desferrioxamine [DFO], 3 mM FeCl2, 0.1-10 µg/mL cyclohexamide,
1 mM azide, 1 mM potassium cyanide, 100 ng/mL rotenone, 100 µM
cobaltous chloride, 0.1 µg/mL gliotoxin, 200 U/mL tumor necrosis
factor- To assess the effects of heat shock on the rate of neutrophil
apoptosis, cells were incubated at either 42°C or 4°C for 1 hour
before incubation at 37°C under normoxic or hypoxic
conditions.36,37 For glucose deprivation, cells were
incubated in IMDM without D-glucose or sodium pyruvate
(Gibco Life Technologies, Paisley, Scotland).
Assessment of neutrophil apoptosis
ELISA measurement of secreted IL-8 IL-8 released into culture supernatants was measured by enzyme-linked immunosorbent assay (ELISA). Following 6- and 20-hour incubations at 5 × 106/mL under normoxia, hypoxia, or anoxia, cells were removed by centrifugation (352g, 10 minutes), and supernatants were collected. Microlon 96-well ELISA plates (L Greiner, Stonehouse, Gloucester, United Kingdom) were coated overnight at 4°C with 50 µL mouse monoclonal antihuman IL-8 at 2 µg/mL. Following 3 washes with PBS + 0.05% Tween, plates were blocked with 100 µL of 5% fetal calf serum (FCS)/0.05% Tween/PBS for 1.5 hours, washed once with PBS + 0.05% Tween, and incubated overnight at 4°C with 50 µL recombinant human IL-8 standards at 0 to 100 000 pg/mL and 50 µL supernatant samples, each in duplicate. Plates were subsequently washed 3 times as described above, incubated for 3 hours at 37°C with 50 µL biotinylated antihuman IL-8 polyclonal antibody at 0.125 µg/mL, washed 3 more times, incubated with 50 µL extraavidin alkaline phosphatase conjugate at 1:400 for 3 hours at 37°C, and washed twice with PBS + 0.05% Tween and once with distilled water. ELISA reactions were developed in the dark at 37°C with 50 µL/well of 1 mg/mL p-nitrophenyl phosphate in diethanolamine buffer. Plates were read on a Bio-Rad 550 microplate reader (Bio-Rad Laboratories, Hercules, CA) at 405 lambda and were analyzed with MPM version 1.57 software (Bio-Rad).Identification of HIF-1  20°C, the RNA was pelleted (12 000g, 4°C, 10 minutes), washed in 6 mL 75% (vol/vol) ethanol, and recentrifuged (7500g, 4°C, 5 minutes). The final pellets were air dried
for 20 to 30 minutes, redissolved in a minimum amount of 0.5% sodium dodecyl sulfate (SDS), and stored at 80°C before analysis. RNA content was quantified using an RNA/DNA calculator (Pharmacia Biotech,
Herts, United Kingdom).
Total cellular RNA was extracted from HeLa cells as a positive control for endothelial PAS domain protein 1 (EPAS) using the above protocol. HeLa cells were grown in Dulbecco modified Eagle medium (DMEM) with 10% fetal calf serum, 1% glutamine, 100 U/mL penicillin, and 100 µg/mL streptomycin. Cells were used when they were 100% confluent and serially passaged. For the RNA protection assays, 40 µg total neutrophil RNA was
subjected to parallel hybridization with 32P-labeled
riboprobes for HIF-1 For detection of HIF-1 For immunoblotting, proteins were resolved in SDS/6% polyacrylamide
gels and transferred to Immobilon P (Millipore, Bedford, MA) overnight
in 10 mM glycine/10% methanol/0.05% SDS. Membranes were blocked with
PBS/5% fat-free dried milk/0.1% Tween 20. For HIF-1 Semiquantitative RT-PCR for adrenomedullin Semiquantitative reverse transcription-polymerase chain reaction (RT-PCR) was set up using an Access RT-PCR system from Promega (Southampton, United Kingdom). Primer sequences were designed using the published mRNA sequences in GenBank. Sequences were (all 5' to 3'): adrenomedullin forward, AAGAAGTGGAATAAGTGGGCT; adrenomedullin reverse, TGGCTTAGAAGACACCAGAGT; -actin forward, ATGAAGTGTGACGTTGACATCCG;
-actin reverse, GCTTGCTGATCCACATCTGCTG; glyceraldehyde-3-phosphate
dehydrogenase (GAPDH) forward, AGAACATCATCCCTGCCTC; and GAPDH reverse,
GCCAAATTCGTTGTCATACC. Each primer set produced a single band of the
expected size in RT-PCR reactions (410 bp adrenomedullin, 232 bp
-actin, 346 bp GAPDH). Neutrophil RNA was extracted as detailed
above following 3-hour incubation in normoxia, hypoxia, and anoxia.
Semiquantitative RT-PCR used an initial RT step at 48°C followed by
95°C for 5 minutes. PCR was then performed over 20 cycles using the
following conditions for all 3 PCR products: denaturation at 95°C for
60 seconds, annealing at 54°C for 90 seconds, and extension at 72°C
for 50 seconds. At the end of this protocol, a final elongation step of
72°C for 7 minutes was performed. All reactions contained 2 mM
MgSO4 and used 100 ng RNA for a 10-µL reaction volume.
PCR products were fractionated on a Tris borate EDTA/2% agarose gel.
Gel images were captured using a Stratagene Eagle Eye II system
(Stratagene Europe, Amsterdam, Netherlands), and band intensities were
calculated using the Scion Image program (Scion, Frederick,
MD). Adrenomedullin expression was corrected for GAPDH and
-actin.
Statistical analysis Results are expressed as mean ± SEM of (n) number of independent experiments; these were all conducted using neutrophils from separate donors, with each condition performed in triplicate. Statistical analysis was performed using analysis of variance, with comparisons between groups made using the Newman-Keuls procedure. Differences were considered significant when P < .05.
Effects of hypoxia on neutrophil apoptosis in vitro Incubation of isolated human peripheral blood neutrophils under hypoxic conditions (PO2 3.3 ± 0.3 kPa) caused a profound inhibition of neutrophil apoptosis. This effect was verified using 3 independent methods to assess apoptosis neutrophil morphology (Figure
1A,D), externalization of plasma membrane
phosphatidylserine (annexin V binding; Figure 1B), and DNA
fragmentation (propidium iodide staining; Figure 1C). Cell viability
(assessed by trypan blue exclusion) was more than 95% at all time
points examined (data not shown). Previous experimental work has
demonstrated that the inhibition of neutrophil apoptosis under hypoxic
conditions is concentration dependent, with a threshold effect observed
at a PO2 of 8.8 ± 0.5 kPa.19
Detailed kinetic analysis of the effects of hypoxia on neutrophil
apoptosis demonstrated that hypoxia could delay the rate of
constitutive apoptosis even when introduced at a late stage (eg, after
15 hours of normoxia when more than 50% of the cells had already
undergone apoptosis) (Figure 2A).
Similarly, when neutrophils were incubated initially under hypoxic
conditions and then transferred back to a normoxic environment, the
cells regained their ability to undergo apoptosis. This occurred at a
rate and to an extent identical to that observed in cells incubated for
the entire period under normoxic conditions (Figure 2B). This ability
of so-called hypoxic neutrophils to regain their ability to undergo
apoptosis at a normal rate when reoxygenated was, however, lost when
the initial period of hypoxic exposure was extended to 20 hours (Figure
3).
Inability of mitochondrial inhibitors, glucose deprivation, or heat shock to inhibit neutrophil apoptosis Subsequent experiments were undertaken to determine the specificity of the survival effect of hypoxia in neutrophils and particularly to determine whether such an effect could be observed when neutrophils were subjected to other forms of stress, namely heat shock, glucose deprivation, or inhibition of mitochondrial oxidative metabolism.In contrast to the marked survival effect of hypoxia, heat shock at
either 42°C or 4°C did not influence the rate of constitutive apoptosis at early (5 hours) or late (20 hours) times (Figure 4A). Western blot and flow
immunocytometric analysis of Hsp 70 expression in neutrophils
demonstrated no alteration in the level of Hsp 70 expression at 4 and
20 hours under normoxic or hypoxic conditions (data not shown).
Although glucose deprivation has been linked to the inhibition of apoptosis resistance in hemopoietic and breast cancer cells41 and it has been demonstrated that high glucose levels induce apoptosis in FRTL5 and endothelial cells,42,43 neither glucose removal nor glucose supplementation influenced the extent of neutrophil apoptosis at 20 hours under normoxic or hypoxic conditions (Figure 4B). The relatively low levels of apoptosis observed in this particular set of experiments reflected the need to replace normal 10% autologous serum with dialyzed (glucose-free) fetal calf serum (data not shown). Finally, neutrophils were incubated under normoxic (21% oxygen) or
hypoxic (3 kPa oxygen) conditions in the presence and absence of the
mitochondrial complex I inhibitor, rotenone (100 ng/mL), or the complex
IV inhibitors, sodium azide (1 mM) and potassium cyanide (1 mM). These
inhibitors were used at a concentration previously demonstrated to
modulate TNF- Protective effect of hypoxia on neutrophil apoptosis is protein synthesis dependent To investigate whether the inhibition of neutrophil apoptosis by hypoxia was protein synthesis dependent, the effect of cycloheximide (CHX) was studied. Initial time-course studies indicated that although the survival effect of hypoxia was completely lost in the presence of 50 µM CHX, this concentration of CHX also caused a major increase in the extent of apoptosis between 4 and 24 hours.46 In view of this, we tested the effect of lower concentrations of CHX (0.1-10 µg/mL), which, although they continue to interfere with protein synthesis,47 do not affect the basal rate of neutrophil apoptosis. Figure 5B demonstrates that CHX, even at these much lower concentrations (1-10 µg/mL), was able to inhibit the survival effect of hypoxia.
Hypoxia does not modulate neutrophil release of IL-8 To assess whether the hypoxic regulation of IL-8 release from neutrophils could in part explain the survival effect, IL-8 release into culture supernatants was measured using ELISA. Although IL-8 was detectable at all time points, there was no significant difference in IL-8 levels in cells incubated under normoxic, hypoxic, or anoxic conditions at either 6 or 20 hours (Figure 6).
Effect of the iron chelators DFO and CP-94 on neutrophil apoptosis To pursue the hypothesis that HIF-1 may be involved in the inhibition of neutrophil apoptosis by hypoxia, we examined the effect of 2 structurally distinct iron chelators, DFO and 1,2-diethyl-3-hydroxypyridine-4-1 (CP-94), on the rate of neutrophil apoptosis. These agents have been shown to mimic the cellular and biochemical effects of hypoxia in other cell types and to induce HIF-1 activation. DFO and CP-94 caused a concentration-dependent inhibition of neutrophil apoptosis and, at maximally effective (nontoxic) concentrations, were able to inhibit apoptosis to an extent similar to that observed under extreme hypoxia (Figure 7A). The survival effect of DFO, CP-94, and hypoxia were also nonadditive (data not shown), suggesting a common mechanism of action. Confirmation that the functional effects of DFO and CP-94 were caused by their iron-chelating properties was obtained by demonstrating that inclusion of a molar excess of iron (Fe2+) could fully block the survival effect of these agents (Figure 7B).
Expression of HIF-1 in human neutrophils To explore the potential involvement of HIF-1 in hypoxic signaling in the neutrophil, we sought evidence for HIF-1 mRNA and protein expression. RNase protection assays were performed using total RNA extracted from freshly isolated neutrophils and monocytes to identify mRNA for HIF-1 and endothelial PAS domain protein 1 (EPAS-1). EPAS-1 shares 48% sequence homology with HIF-1 .48 HeLa cell RNA was used as a positive control
for the EPAS RNase protection assays. Figure
8A demonstrates the presence of HIF-1 mRNA in freshly isolated monocytes and neutrophils; this is in contrast
to EPAS, which was only identified in the HeLa cells. To demonstrate
whether hypoxia could modulate HIF-1 protein levels, neutrophils
were incubated for 3 hours in hypoxic conditions, ensuring that these
cells were initially resuspended in medium that had been
pre-equilibrated at 0% oxygen overnight. Thereafter, whole-cell
lysates were prepared using a TRIzol-based lysis method and were
analyzed for HIF-1 by Western blotting. As shown in Figure 8B,
HIF-1 was not detectable in the control cells but was found in cells
incubated under hypoxic conditions or in the presence of DFO.
Effect of hypoxia on adrenomedullin transcription To demonstrate that a HIF-1-dependent gene was
transcriptionally regulated by hypoxia in neutrophils, we examined the
effect of hypoxia and anoxia on adrenomedullin expression using
semiquantitative RT-PCR. After 3 hours of incubation, adrenomedullin
RNA expressioncorrected for -actin expressionwas increased by
28% in hypoxia and 20% in anoxia compared with normoxic controls.
Furthermore, when corrected for GAPDH expression, adrenomedullin RNA
was increased by 50% and 62% in hypoxia and anoxia, respectively
(data not shown).
Effect of cobalt on the extent of neutrophil apoptosis In contrast to the ability of cobalt ions to replicate the effect of hypoxia on erythropoietin expression in Hep3B cells,49,50 100 µM cobaltous chloride caused no mimicry of the hypoxic survival effect in neutrophils cultured for 20 hours and no additional survival advantage in the hypoxic cells (Figure 9).
Constitutive neutrophil apoptosis is not blocked by the caspase inhibitors ZVAD-fmk and Boc-D-fmk To address whether the survival effect of hypoxia might reflect an inhibition of caspase activity, we initially examined whether the inhibition of caspase activity could prevent constitutive neutrophil apoptosis. This was performed by incubating cells in the presence of 100 µM ZVAD-fmk or 25 µM Boc-D-fmk. These agents, although they abolished the proapoptotic effect of TNF- and gliotoxin (from 95%
to 9% at 2 hours; P = <.0001) (Figure
10A), had no effect on the extent of
constitutive apoptosis at 6 and 20 hours (Figure 10B,C,
respectively).
These experiments indicate that neutrophils have a ferroprotein
oxygen sensor that is able to induce a profound and
transcription-dependent inhibition of neutrophil apoptosis. This effect
seems to be specific for hypoxia and to display a striking resemblance
to the oxygen-dependent regulation of erythropoietin and angiogenic
growth-factor expression observed in other cell types.51
Hence, the ability of hypoxia to inhibit neutrophil apoptosis could be
mimicked by exposure of the cells to 2 discrete iron-chelating agents,
DFO and CP-94, in a manner that was blocked by the inclusion of an
excess of Fe2+ ions, and it was associated with the
induction of HIF-1 Detailed kinetic analysis revealed that aging neutrophils could also respond to hypoxia by delaying apoptosis and that reoxygenation caused a prompt reversal of the survival effect. After 20 hours, however, neutrophils were unable to regain their normal apoptotic potential, implying that a more long-term resetting of the cell's apoptotic threshold/steady state occurred with prolonged exposure of neutrophils to low-oxygen tension. The effect of hypoxia on neutrophil apoptosis appears distinct from the
effect of other stress-inducing stimuli. Hence, UV irradiation,
sphingosine treatment, and incubation of neutrophils under hyperosmolar
conditions17,18 all result in p38 mitogen-activated protein kinase (MAPK) activation, and specific inhibition of this pathway fully protects against the proapoptotic effects of these stimuli. The antiapoptotic effect of hypoxia, however, is not modulated
by the specific p38 MAPK inhibitor SB 203580 (K.M., E.R.C., unpublished
observations, January 1998) and is not influenced by glucose
deprivation. Moreover, the release of antiapoptotic cytokines,
including IL-8, seemed unlikely because we showed no significant
difference in IL-8 release between the different oxygen tensions and
found similar results for GM-CSF, IL-6, IL-1 Although up-regulation of heat-shock proteins, especially Hsp 70 and
Hsp 27, have been shown to increase the resistance of certain cells to
cytotoxic drug or Fas-induced apoptosis52 and although Hsp
70 is constitutively expressed in neutrophils,37 the rate
of neutrophil apoptosis was not sensitive to heat-shock treatment in
normoxia or under reduced-oxygen conditions. This argues against a role
for conventional heat-shock proteins in the inhibition of neutrophil
apoptosis by hypoxia and again lends support to a prosurvival effect of
hypoxia mediated through an independent pathway involving specific
oxygen sensors and, potentially, HIF-1 In normoxia, HIF-1 HIF-1 PHD1 has been shown to modify HIF-1 The role of caspase activity in the constitutive apoptosis of
hematopoietic cells remains uncertain. Hence, although caspase activation is identified in temperature-regulated65 and
TNF- In summary, we have shown that hypoxia causes a profound but reversible
inhibition of neutrophil apoptosis. This effect was specific for
hypoxia and mediated by a ferroprotein-sensing mechanism characteristic
of PHD-regulated events in other cell types. Although hypoxia also
caused a marked increase in HIF-1
We thank P. J. Ratcliffe and J. M. Gleadle (University of Oxford) for contributions to this work and for critical appraisal of the manuscript.
Submitted February 12, 2002; accepted June 6, 2002.
Prepublished online as Blood First Edition Paper, June 28, 2002; DOI 10.1182/blood-2002-02-0454.
Supported by a Raymond and Beverly Sackler Studentship (S.R.W.), the MRC (S.R.W.), Wellcome Trust (E.R.C.), Faculty of Medicine, University of Edinburgh (K.I.M.), Chest, Heart and Stroke Association (Scotland) (E.R.C.), Papworth Hospital NHS Trust (E.R.C.), and British Lung Foundation (E.R.C.).
K.I.M. and S.R.W. are joint first authors.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Edwin R. Chilvers, Respiratory Medicine Division, Department of Medicine, Level 5, Box 157, Addenbrooke's Hospital, Hills Road, Cambridge, CB2 2QQ, United Kingdom; e-mail: erc24{at}hermes.cam.ac.uk.
1. Condliffe AM, Kitchen E, Chilvers ER. Neutrophil priming: pathophysiological consequences and underlying mechanisms. Clin Sci. 1998;94:461-471[Medline] [Order article via Infotrieve]. 2. Haslett C. Resolution of acute inflammation and the role of apoptosis in the tissue fate of granulocytes [editorial]. Clin Sci. 1992;83:639-648[Medline] [Order article via Infotrieve]. 3. Engler RL, Dahlgren MD, Peterson MA, Dobbs A, Schmid-Schonbein GW. Accumulation of polymorphonuclear leukocytes during 3-h experimental myocardial ischaemia. Am J Physiol. 1986;251:H93-H100[Medline] [Order article via Infotrieve]. 4. Grootveld MC, Henderson EB, Farrell A, Blake DR, Parkes HG, Haycock P. Oxidative damage to hyaluronate and glucose in synovial fluid during exercise of the inflamed rheumatoid joint: detection of abnormal low-molecular-mass metabolites by proton-n.m.r. spectroscopy. Biochem J. 1991;273:459-467[Medline] [Order article via Infotrieve]. 5. Parkes HG, Grootveld MC, Henderson EB, Farrell A, Blake DR. Oxidative damage to synovial fluid from the inflamed rheumatoid joint detected by 1H NMR spectroscopy. J Pharm Biomed Anal. 1991;9:75-82[CrossRef][Medline] [Order article via Infotrieve]. 6. Metchnikoff E. Lecture VII Pasteur Institute, 1891. In: Starling FA,Starling EH, eds. Lectures on the Comparative Pathology of Inflammation. New York, NY: Dover Publications; 1986. 7. Savill J, Henson JE, Wyllie AH, Walport MJ, Henson PM, Haslett C. Macrophage phagocytosis of aging neutrophils in inflammation: programmed cell death in the neutrophil leads to recognition by macrophages. J Clin Invest. 1989;83:865-875[Medline] [Order article via Infotrieve]. 8. Haslett C, Savill J, Meagher LC. The neutrophil. Curr Opin Immunol. 1989;2:10-18[CrossRef][Medline] [Order article via Infotrieve]. 9. Savill J, Dransfield I, Hogg N, Haslett C. Vitronectin receptor mediates phagocytosis of cells undergoing apoptosis. Nature. 1990;343:170-173[CrossRef][Medline] [Order article via Infotrieve]. 10. Savill J. Macrophage recognition of senescent neutrophils. Clin Sci. 1992;83:649-655[Medline] [Order article via Infotrieve]. 11. Haslett C, Savill J, Whyte M, Stern M, Dransfield I, Meagher LC. Granulocyte apoptosis and the control of inflammation. Phil Trans R Soc London. 1994;B:345-327. 12. Grigg JM, Savill J, Sarraf C, Haslett C, Silverman M. Neutrophil apoptosis and clearance by macrophages in the lungs of neonates with pulmonary inflammation. Lancet. 1991;338:720-722[CrossRef][Medline] [Order article via Infotrieve]. 13. Cox G, Crossley J, Xing Z. Macrophage engulfment of apoptotic neutrophils contributes to the resolution of acute pulmonary inflammation in vivo. Am J Respir Cell Mol Biol. 1995;12:232-237[Abstract].
14.
Hussain N, Wu F, Zhu L, Thrall RS, Kresch J.
Neutrophil apoptosis during the development and resolution of oleic acid-induced acute lung injury in the rat.
Am J Respir Cell Mol Biol.
1998;19:867-874 15. Cox G, Gauldie J, Jordana M. Bronchial epithelial cell-derived cytokines (G-CSF and GM-CSF) promote the survival of peripheral blood neutrophils in vitro. Am J Respir Cell Mol Biol. 1992;7:507-513[Medline] [Order article via Infotrieve].
16.
Coxon A, Rieu P, Barklow FJ, et al.
A novel role for the
17.
Frasch SC, Nick JA, Fadok VA, Bratton DL, Worthen GS, Henson PM.
p38 mitogen-activated protein-kinase dependent and-independent intracellular signal transduction pathways leading to apoptosis in human neutrophils.
J Biol Chem.
1998;273:8389-8397 18. Mecklenburgh K, Murray J, Brazil T, Ward C, Rossi AG, Chilvers ER. Role of neutrophil apoptosis in the resolution of pulmonary inflammation. Monaldi Arch Chest Dis. 1999;54:345-349[Medline] [Order article via Infotrieve]. 19. Hannah S, Mecklenburgh K, Rahman I, et al. Hypoxia prolongs neutrophil survival in vitro. FEBS Lett. 1995;372:233-237[CrossRef][Medline] [Order article via Infotrieve]. 20. Leuenroth SJ, Grutkoski PS, Ayala A, Simms H. Suppression of PMN apoptosis by hypoxia is dependent on Mcl-1 and MAPK activity. Surgery. 2000;128:171-177[CrossRef][Medline] [Order article via Infotrieve]. 21. Rosenbaum DM, Michaelson M, Batter DK, Doshi P, Kessler JA. Evidence for hypoxia-induced, programmed cell death of cultured neurons. Ann Neurol. 1994;36:864-870[CrossRef][Medline] [Order article via Infotrieve].
22.
Yao KS, Clayton M, O'Dwyer PJ.
Apoptosis in human adenocarcinoma HT29 cells induced by exposure to hypoxia.
J Natl Cancer Inst.
1995;87:117-122 23. Graeber TG, Osmanian C, Jacks T, et al. Hypoxia-mediated selection of cells with diminished apoptotic potential in solid tumors. Nature. 1996;379:88-91[CrossRef][Medline] [Order article via Infotrieve]. 24. Ellis GA, Edmonds SE, Gaffney K, Williams RB, Blake D. Synovial tissue oxygenation profile in inflamed and non-inflamed knee joints [abstract]. Br J Rheumatol. 1994;33(suppl 1):172. 25. Niinikoski J, Hunt TK, Englebert Dunphy J. Oxygen supply in healing tissue. Am J Surg. 1972;123:247-252[CrossRef][Medline] [Order article via Infotrieve]. 26. Hunt TK, Twomey P, Zederfeldt B, Englebert Dunphy J. Respiratory gas tensions and pH in healing wounds. Am J Surg. 1967;114:302-307[CrossRef][Medline] [Order article via Infotrieve].
27.
Semenza GL, Wang GL.
A nuclear factor induced by hypoxia via de novo protein synthesis binds to the human erythropoietin gene.
Mol Cell Biol.
1992;12:5447-5454 28. Wang GL, Jiang B-H, Rue EA, Semenza GL. Hypoxia-inducible factor 1 is a basic-helix-loop-helix-PAS heterodimer regulated by cellular O2 tension. Proc Natl Acad Sci U S A. 1992;92:5510-5514.
29.
Wang GL, Semenza GL.
General involvement of hypoxia-inducible factor 1 in transcriptional response to hypoxia.
Proc Natl Acad Sci U S A.
1993;90:4304-4308 30. Wiener CM, Booth G, Semenza GL. In vivo expression of mRNAs encoding hypoxia-inducible factor 1. Biochem Biophys Res Comm. 1996;225:485-488[CrossRef][Medline] [Order article via Infotrieve].
31.
Cockman ME, Masson N, Mole DR, et al.
Hypoxia inducible factor-a binding and ubiquitylation by the von Hippel-Lindau tumour suppressor protein.
J Biol Chem.
2000;275:25733-25741 32. Epstein ACR, Gleadle JM, McNeill LA, et al. C. elegans EGL-9 and mammalian homologs define a family of dioxygenases that regulate HIF by prolyl hydroxylation. Cell. 2001;107:43-54[CrossRef][Medline] [Order article via Infotrieve]. 33. Haslett C, Guthrie LA, Kopamiak MM, Johnson RB, Henson PM. Modulation of multiple neutrophil functions by preparative methods or trace concentrations of bacterial lipopolysaccaride. Am J Pathol. 1985;119:101-110[Abstract]. 34. Condliffe AM, Chilvers ER, Haslett C, Dransfield I. Priming differentially regulates neutrophil adhesion molecule expression/function [abstract]. Immunology. 1996;89:105[CrossRef][Medline] [Order article via Infotrieve].
35.
Kitchen E, Rossi AG, Condliffe AM, Haslett C, Chilvers ER.
Demonstration of reversible priming of human neutrophils using platelet activating factor.
Blood.
1996;88:4330-4337
36.
Eid NS, Kravath RE, Lanks KW.
Heat-shock protein synthesis by human polymorphonuclear cells.
J Exp Med.
1987;165:1448-1452 37. Cox G, Moseley P, Hunninghake GW. Induction of heat-shock protein 70 in neutrophils during exposure to subphysiological temperatures. J Infect Dis. 1993;167:769-771[Medline] [Order article via Infotrieve]. 38. Ward C, Chilvers ER, Lawson mL, et al. NF-kB activation is a critical regulator of human granulocyte apoptosis in vitro [abstract]. J Biol Chem. 1999;274. 39. Nicoletti I, Migliorati G, Oagliacci MC, Grignani F, Riccardi C. A rapid and simple method for measuring thymocyte apoptosis by propidium iodide staining and flow cytometry. J Immunol Methods. 1991;139:271-279[CrossRef][Medline] [Order article via Infotrieve].
40.
Murray J, Barbara J, Dunkley SA, et al.
Regulation of neutrophil apoptosis by tumour necrosis factor-
41.
McCormick TS, McColl KS, Distelhorst C.
Mouse lymphoma cells destined to undergo apoptosis in response to thapsigargin treatment fail to generate a calcium-mediated grp78/grp94 stress response.
J Biol Chem.
1997;272:6087-6092 42. Donnini D, Zambito AM, Perrella G, Ambesi-Impiombata FS, Curcio F. Glucose may induce death through a free radical-mediated mechanism. Biochem Biophys Res Comm. 1996;219:412-417[CrossRef][Medline] [Order article via Infotrieve]. 43. Baumgartner-Parzer SM, Wagner L, Pettermann M, Grillari J, Gessel A, Waldhaus W. High-glucose-triggered apoptosis in cultured endothelial cells. Diabetes. 1995;44:1323-1327[Abstract].
44.
Schulze-Osthoff K, Bakker AC, Vanhaesebroeck B, Beyaert R, Jacob WA, Fiers W.
Cytotoxic activity of tumour necrosis factor is mediated by early damage of mitochondrial function: evidence for the involvement of mitochondrial radical generation.
J Biol Chem.
1992;267:5317-5323 45. Nunn JF. Nunn's Applied Respiratory Physiology. Cambridge United Kingdom: The University Press; 1993. 46. Whyte M, Savill J, Meagher LC, Haslett C. Coupling of neutrophil apoptosis to recognition by macrophages: coordinated acceleration by protein synthesis inhibitors. J Leuk Biol. 1997;62:195-202[Abstract]. 47. Cox G, Oberley LW, Hunninghake GW. Manganese superoxide dismutase and heat shock protein 70 are not necessary for suppression of apoptosis in human peripheral blood neutrophils. Am J Respir Cell Mol Biol. 1994;10:493-498[Abstract].
48.
Tian H, McKnight SL, Russel DW.
Endothelial PAS domain protein 1 (EPAS 1), a transcriptional factor selectively expressed in endothelial cells.
Genes Dev.
1997;11:72-82
49.
Goldberg MA, Dunning SP, Bunn HF.
Regulation of the erythropoietin gene: evidence that the oxygen sensor is a heme protein.
Science.
1988;242:1412-1415 50. Huang LE, Ho V, Arany Z, et al. Erythropoietin gene regulation depends on heme-dependent oxygen sensing and assembly of interacting transcription factors. Kidney Int. 1997;51:548-552[Medline] [Order article via Infotrieve]. 51. Gleadle JM, Ebert BL, Ratcliffe PJ. Regulation of angiogenic growth factor expression by hypoxia, transition metals and chelating agents. Am J Physiol. 1995;268:C1362-C1368[Medline] [Order article via Infotrieve]. 52. Samali A, Cotter TG. Heat shock proteins increase resistance to apoptosis. Exp Cell Res. 1996;223:163-170[CrossRef][Medline] [Order article via Infotrieve].
53.
Huang LE, Gu J, Schau M, Bunn H.
Regulation of hypoxia-inducible factor 1
54.
Kallio PJ, Wilson WJ, O'Brien S, Makino Y, Poellinger L.
Regulation of the hypoxia-inducible transcription factor 1a by the ubiquitin-proteasome pathway.
J Biol Chem.
1999;274:6519-6525
55.
Salceda S, Caro J.
Hypoxia-inducible factor 1
56.
Sutter CH, Laughner E, Semenza GL.
Hypoxia-inducible factor 1a protein expression is controlled by oxygen-regulated ubiquitination that is disrupted by deletions and missense mutations.
Proc Natl Acad Sci U S A.
2000;97:4748-4753 57. Garayoa M, Martinez A, Lee S, et al. Hypoxia-inducible factor-1 (HIF-1) up-regulates adrenomedullin expression in human tumor cell lines during oxygen deprivation: a possible promotion mechanism of carcinogenesis. Mol Cell Endocrinol. 2000;14:848-862.
58.
Jaakkola P, Mole DR, Tian Y-M, et al.
Targeting of HIF-a to the von Hippel-Lindau ubiquitylation complex by O2-regulated prolyly hydroxylation.
Science.
2001;292:468-472
59.
Ivan M, Kondo K, Yang H, et al.
HIF
60.
Masson N, William C, Maxwell P, Pugh CW, Ratcliffe PJ.
Independent function of two destruction domains in hypoxia-inducible factor-
61.
Wax SD, Rosenfield CL, Taubman MB.
Identification of a novel growth factor-responsive gene in vascular smooth muscle cells.
J Biol Chem.
1994;269:13041-13047 62. Dupuy D, Aubert I, Duperat VG, et al. Mapping, characterization, and expression analysis of the SM-20 human homologue, c1orf12, and identification of a novel related gene, SCAND2. Genomics. 2000;69:348-354[CrossRef][Medline] [Order article via Infotrieve].
63.
Lipscomb EA, Sarmiere PD, Freeman RS.
SM-20 is a novel mitochondrial protein that causes caspase-dependent cell death in nerve growth factor-dependent neurons.
J Biol Chem.
2001;276:5085-5092
64.
Madden SL, Galella EA, Riley D, Bertelsen AH, Beaudy GA.
Induction of cell growth regulatory genes by p53.
Cancer Res.
1996;56:5384-5390
65.
Pryde JG, Walker A, Rossi AG, Hannah S, Haslett C.
Temperature-dependent arrest of neutrophil apoptosis.
J Biol Chem.
2000;275:33574-33584
66.
Kettritz R, Scheumann J, Xu Y, Luft FC, Haller H.
TNF-
67.
Niwa M, Hara A, Kanamori Y, et al.
Nuclear factor- 68. Nishiyama J, Yi X, Venkatachalam MA, Dong Z. cDNA cloning and promoter analysis of rat caspase-9. Biochem J. 2001;360:49-56[CrossRef][Medline] [Order article via Infotrieve].
© 2002 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  S. H. Wong, N. Francis, H. Chahal, K. Raza, M. Salmon, D. Scheel-Toellner, and J. M. Lord Lactoferrin is a survival factor for neutrophils in rheumatoid synovial fluid Rheumatology, January 1, 2009; 48(1): 39 - 44. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. R. Walmsley, N. N. McGovern, M. K. B. Whyte, and E. R. Chilvers The HIF/VHL Pathway: From Oxygen Sensing to Innate Immunity Am. J. Respir. Cell Mol. Biol., March 1, 2008; 38(3): 251 - 255. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Dyugovskaya, A. Polyakov, P. Lavie, and L. Lavie Delayed Neutrophil Apoptosis in Patients with Sleep Apnea Am. J. Respir. Crit. Care Med., March 1, 2008; 177(5): 544 - 554. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. C. M. Vissers and R. P. Wilkie Ascorbate deficiency results in impaired neutrophil apoptosis and clearance and is associated with up-regulation of hypoxia-inducible factor 1{alpha} J. Leukoc. Biol., May 1, 2007; 81(5): 1236 - 1244. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. R. Walmsley, A. S. Cowburn, M. R. Clatworthy, N. W. Morrell, E. C. Roper, V. Singleton, P. Maxwell, M. K. B. Whyte, and E. R. Chilvers Neutrophils from patients with heterozygous germline mutations in the von Hippel Lindau protein (pVHL) display delayed apoptosis and enhanced bacterial phagocytosis Blood, November 1, 2006; 108(9): 3176 - 3178. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. T. Palmer, R. McNeill-Love, J. R. Poole, D. Coggon, A. J. Frew, C. H. Linaker, and J. K. Shute Inflammatory responses to the occupational inhalation of metal fume Eur. Respir. J., February 1, 2006; 27(2): 366 - 373. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. A. Ross, M. R. Douglas, S. H. Wong, E. J. Ross, S. J. Curnow, G. B. Nash, E. Rainger, D. Scheel-Toellner, J. M. Lord, M. Salmon, et al. Interaction between integrin {alpha}9beta1 and vascular cell adhesion molecule-1 (VCAM-1) inhibits neutrophil apoptosis Blood, February 1, 2006; 107(3): 1178 - 1183. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Sim, T.-S. Yong, S.-J. Park, K.-i. Im, Y. Kong, J.-S. Ryu, D.-Y. Min, and M. H. Shin NADPH Oxidase-Derived Reactive Oxygen Species-Mediated Activation of ERK1/2 Is Required for Apoptosis of Human Neutrophils Induced by Entamoeba histolytica J. Immunol., April 1, 2005; 174(7): 4279 - 4288. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. S. Cowburn, J. F. White, J. Deighton, S. R. Walmsley, and E. R. Chilvers z-VAD-fmk augmentation of TNF{alpha}-stimulated neutrophil apoptosis is compound specific and does not involve the generation of reactive oxygen species Blood, April 1, 2005; 105(7): 2970 - 2972. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. R. Walmsley, C. Print, N. Farahi, C. Peyssonnaux, R. S. Johnson, T. Cramer, A. Sobolewski, A. M. Condliffe, A. S. Cowburn, N. Johnson, et al. Hypoxia-induced neutrophil survival is mediated by HIF-1{alpha}-dependent NF-{kappa}B activity J. Exp. Med., January 3, 2005; 201(1): 105 - 115. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Scheel-Toellner, K. Wang, R. Craddock, P. R. Webb, H. M. McGettrick, L. K. Assi, N. Parkes, L. E. Clough, E. Gulbins, M. Salmon, et al. Reactive oxygen species limit neutrophil life span by activating death receptor signaling Blood, October 15, 2004; 104(8): 2557 - 2564. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. A. Maianski, D. Roos, and T. W. Kuijpers Bid Truncation, Bid/Bax Targeting to the Mitochondria, and Caspase Activation Associated with Neutrophil Apoptosis Are Inhibited by Granulocyte Colony-Stimulating Factor J. Immunol., June 1, 2004; 172(11): 7024 - 7030. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S R Walmsley, K K K Sheares, A Sobolewski, N W Morrell, and E R Chilvers New insights into oxygen sensing at a cellular level Thorax, February 1, 2004; 59(2): 90 - 92. [Full Text] [PDF]
|
|
|
|
 |
|
 A.-L. Paul, A. C. Schuerger, M. P. Popp, J. T. Richards, M. S. Manak, and R. J. Ferl Hypobaric Biology: Arabidopsis Gene Expression at Low Atmospheric Pressure Plant Physiology, January 1, 2004; 134(1): 215 - 223. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2002 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
(IFN-
) or 3%
(
) oxygen, and apoptosis was assessed morphologically on
cytocentrifuge preparations. In addition, the extent of apoptosis was
assessed in cells initially incubated in 3% oxygen for 20 hours before
transfer to 21% oxygen (
). Data are expressed as mean ± SEM
of 5 separate experiments, each performed in triplicate.
B activates dual inhibition sites in the regulation of tumor necrosis factor-