SEARCH:   Advanced

Prepublished online as a Blood First Edition Paper on June 7, 2002; DOI 10.1182/blood-2002-02-0654. This Article Abstract Full Text (PDF) All Versions of this Article: 2002-02-0654v1 100/8/3037    most recent Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Juszczynski, P. Articles by Warzocha, K. Search for Related Content PubMed PubMed Citation Articles by Juszczynski, P. Articles by Warzocha, K. Related Collections Neoplasia Brief Reports Social Bookmarking                   What's this?  Previous Article  |  Table of Contents  |  Next Article  Blood, 15 October 2002, Vol. 100, No. 8, pp. 3037-3040 BRIEF REPORT Human leukocyte antigens class II and tumor necrosis factor genetic polymorphisms are independent predictors of non-Hodgkin lymphoma outcome Przemyslaw Juszczynski, Ewa Kalinka, Jacques Bienvenu, Grzegorz Woszczek, Maciej Borowiec, Tadeusz Robak, Marek Kowalski, Ewa Lech-Maranda, Lucile Baseggio, Bertrand Coiffier, Gilles Salles, and Krzysztof Warzocha From the Department of Hematology and Department of Clinical Immunology, Medical University of Lodz, Poland, and Service d'Hematologie, Centre Hospitalier Lyon-Sud, and Jeune Equipe "Pathologie des Cellules Lymphoïdes" Université Claude Bernard, Lyon, France.     Abstract Top Abstract Introduction Study design Results and discussion References Tumor necrosis factor (TNF) production and non-Hodgkin lymphoma (NHL) outcome was found to be related to the TNF308 polymorphism. To explore whether this could be linked to neighboring polymorphisms, we genotyped the TNF376,308,238,163, lymphotoxin alpha (LT)+252, and HLA DRB1 alleles in 204 patients with NHL and 120 controls. TNF308A was the only allele associated with higher TNF and its p55 and p75 receptors' levels (P = .009, P = .03, and P = .007) and lower complete remission rates (P = .006). Freedom from progression (FFP) and overall survival (OS) were shorter in patients with TNF308A (P = .009 and P = .02), null HLA DRB1*02 allele (P = .007 and P = .14), or both genetic markers (P = .004 and P = .005). Multivariate analysis incorporating International Prognostic Index (IPI) identified TNF308A (P < .0001, relative risk [RR] = 1.63; P < .0001, RR = 1.51) and null HLA DRB1*02 alleles (P = .015, RR = 1.18; P < .0001, RR = 1.25) as independent factors for FFP and OS. These results indicate the existence of at least 2 inherited factors involved in NHL outcome. (Blood. 2002;100:3037-3040) © 2002 by The American Society of Hematology.     Introduction Top Abstract Introduction Study design Results and discussion References The tumor necrosis factor (TNF) gene lies within the human leukocyte antigen (HLA) class III region, located 850 kb telomeric to the class II HLA DR loci on chromosome 6p21.3. Several studies showed that individual differences in TNF production could be linked with the 8.1 major histocompatibility complex (MHC) ancestral haplotype, HLA A1-B8-DR3-DQ2-TNF308A-lymphotoxin alpha (LT)+252A, overrepresented in several inflammatory and autoimmune diseases.1-15 Other alleles within the TNF promoter, including single nucleotide polymorphisms at the position TNF376, TNF238, and TNF163 could also account for the observed variations in the TNF production and disease outcome.16-18 In our preliminary study, we showed that the TNF308A/LT+252A high-risk haplotype had significant impact on the non-Hodgkin lymphoma (NHL) outcome.19 The close association between these and neighboring "high-risk" alleles made it hard to say whether one or multiple alleles have a role in the biology of disease. To answer this question, we performed genetic analysis comparing the TNF376,308,238,163, LT+252, and HLA DRB1 allelic frequencies and distributions among 204 patients with NHL and 120 healthy controls.     Study design Top Abstract Introduction Study design Results and discussion References Subjects The study comprised 204 newly diagnosed patients with NHL treated in the Service d'Hematologie, Centre Hospitalier Lyon-Sud, France. The inclusion criteria, initial medical evaluation, TNF and its soluble receptors' plasma levels, and response to therapy assessment are reported elsewhere.19 Therapeutic attitudes were defined according to histologic subtypes and prognostic factors.19,20 Among the 104 patients with diffuse large B-cell lymphoma (DLBCL), 46 received CHOP (cyclophosphamide, doxorubicin, vincristine, prednisone) or CHOP-like regimen, and 58 patients received ACVBP (doxorubicin, cyclophosphamide, vindesine, bleomycin, prednisolone) or ACVBP-like high-dose regimen. All patients were treated according to prospective trials. Characteristics of the patients enrolled in the present study are shown in Table 1.                                View this table: [in this window] [in a new window]   Table 1. Characteristics of 204 patients with non-Hodgkin lymphoma, including the association of initial plasma levels of tumor necrosis factor and its soluble receptors (p55 and p75) with other prognostic variables in 85 patients who provided samples available for enzyme-linked immunosorbent assay Random, anonymous blood samples from 120 ethnically-matched unrelated healthy controls were obtained from the Etablissement de Français du Sang, Lyon, France. Genotyping analyses Genomic DNA from peripherial blood mononuclear cells was extracted using the QIAmp extraction kit (Qiagen, Chatsworth, CA). The TNF promoter fragment spanning nucleotides 675 to 143 was amplified by polymerase chain reaction (PCR) using the primer pair F1 (5'TCTCGGTTTCTTCTCCATCG) and R1 (5'GAGTCTCCGGGTCAGAATGA). After heating at 95°C for 2 minutes, PCR reactions were performed for 35 cycles consisting of denaturation (95°C for 30 seconds), annealing (58°C for 30 seconds), and extension (72°C for 45 seconds). The last extension step was prolonged to 7 minutes. A quantity of 10 µL of the PCR-amplified product served as a template for PCR-labeling in 20 µL reaction volume containing 4 µL ABI Prism Big Dye Terminator Cycle Sequencing Ready Reaction Kit and 2 µL recommended buffer (PE Applied Biosystems, Foster City, CA), 15 pM of F1 primer, and deionized water. We performed 25 cycles of PCR-labeling DNA template with Big Dye dideoxynucleotides; each cycle consisted of denaturation (96°C for 10 seconds), annealing (50°C for 5 seconds), and extension (60°C for 4 minutes). The PCR-amplified product was analyzed by automated laser sequencer (ABI Prism 310 Genetic Analyzer; PE Applied Biosystems). The LT+252 polymorphism was genotyped by the PCR-based restriction fragment length polymorphism.19 A PCR-based reverse blot technology (RELI SSO HLA-DRB Test; Dynal, Oslo, Norway) was used for the HLA DRB genotyping according to the manufacturer's protocol. Statistical analysis The associations of the TNF and its soluble receptor plasma levels with other variables were compared by Mann-Whitney U test. Allele frequencies and their associations with other variables were compared using the 2 test (with Yates correction when a cell frequency was < 20) unless any expected frequency was less than 5 when the Fisher exact test was used. The deviation of an observed homozygosity rate from the Hardy-Weinberg expectations was tested by the 2-tailed Z-test for a single proportion. The freedom from progression (FFP) and overall survival (OS) were estimated by the Kaplan-Meier method and log-rank test. A multivariate regression analysis with the Cox proportional hazard model was used to adjust the effect of the TNF and HLA polymorphisms for potential independent prognostic factors. Statistical tests with P < .05 were considered significant. Statistical analysis was performed using the Statistica package (StatSoft, Tulsa, OK).     Results and discussion Top Abstract Introduction Study design Results and discussion References TNF, LT, and HLA DRB1 polymorphisms in patients with NHL and healthy controls As could be expected, a strong linkage disequilibrium was found between the TNF308A and LT+252A (P < .005), TNF308A and HLA DRB1*03 (P < .0001), LT+252A and HLA DRB1*03 (P < .005), as well as between the TNF238A and TNF376A alleles (P < .0001).1,4,11,14,21 Similar to a previous report,14 we did not find any polymorphic variation in the TNF163, thus it was excluded from further analyses. The TNF376,308,238, LT+252, and HLA DRB1 allelic frequencies and distributions were consistent with Hardy-Weinberg equilibrium, and didn't differ significantly between patients and controls (Table 2). Because they were also similar to those previously reported in other Caucasian groups, it is unlikely that polymorphisms within the above-mentioned sites confer susceptibility for lymphoma occurrence.1,4,11,14,21                                View this table: [in this window] [in a new window]   Table 2. The TNF-376A,-308A,-238A, LT+252, and HLA DRB1 allelic frequencies in 120 healthy controls and 204 patients with non-Hodgkin lymphoma, including 104 patients with diffuse large B-cell lymphoma TNF, LT, and HLA DRB1 polymorphisms and TNF/soluble receptors plasma levels When analysis was restricted to the 85 patients with NHL available for both ELISA and genotyping assays, the TNF308A was the only allele associated with plasma levels of TNF (P = .009), p55 (P = .03), and p75 (P = .007) higher than median values (> 33.0 pg/mL, > 2.8 ng/mL, > 7.0 ng/mL, respectively). Similar results were obtained in patients with DLBCL (P = .04, P = .03, and P = .01, respectively). These results indicate that increased plasma levels of TNF and its soluble receptors in patients with NHL were related to the TNF308A and could not be explained by the remaining TNF, LT, or HLA DRB1 alleles. TNF, LT, and HLA DRB1 polymorphisms and NHL outcome Among 204 patients with NHL, 118 (58%) achieved complete remission (CR), 68 (33%) did not, and 18 (9%) were not yet available for the therapy response. Of 204 patients, 84 (41%) experienced disease progression and 45 (22%) died. Of 204 patients, the TNF308A was the only allele associated with the lower CR rates (P = .006), including 104 patients with DLBCL (P = .009). With a median follow-up of the surviving patients of 24 months (range, 1-91 months), the FFP survival was lower in patients carrying the TNF308A (P = .009), null HLA DRB1*02 allele (P = .007), or both genetic markers (P = .004), including patients with DLBCL (P = .04, P = .01, P = .003, respectively). The 2-year OS rate was significantly lower in patients with TNF308A (P = .02), null HLA DRB1*02 allele (P = .14), or both of them (P = .005), including patients with DLBCL (P = .03, P = .04, P = .005, respectively) (Figure 1). View larger version (20K): [in this window] [in a new window]   Figure 1. Progression-free and overall survival of 104 patients with diffuse large B-cell lymphoma according to the TNF308A and HLA DRB1*02 status. The initial number of patients at risk was 29 (28%) for the presence of the TNF308A and null HLA DRB1*02 allele and 75 (72%) for the remaining patients. (A) Progression-free survival. (B) Overall survival. P denotes the log-rank test value. After incorporating the International Prognostic Index22 as a unique parameter (0-2 versus 3-5 adverse factors) in multivariate analysis, the TNF308A (P < .0001, relative risk [RR] = 1.63; P < .0001, RR = 1.51) and null HLA DRB1*02 (P < .02, RR = 1.18; P < .0001, RR = 1.25) alleles remained independent prognostic factors for both FFP and OS (Table 3).                                View this table: [in this window] [in a new window]   Table 3. Factors independently prognostic of freedom from progression and overall survival Since the clinical characteristics and allocated treatment regimens were well balanced among the allelic groups analyzed, these results indicate that adverse outcome of NHL was independently related to the TNF308 and HLA DRB*02 alleles and could not be explained by the remaining polymorphisms or previously defined TNF308A/LT+252A high-risk haplotype.19 These findings emphasize how innate immunity dramatically influences disease outcome. Its manipulation by boosting T-cell-mediated antitumor responses, passive immunomodulation with HLA DR monoclonal antibodies, or TNF inhibitors may offer a potential therapeutic strategy to achieve stable remissions in lymphoma.23     Acknowledgments The authors are indebted to Dr Dominique Rigal from the Etablissement de Français du Sang, Lyon, France, for providing DNA samples from healthy individuals.     Footnotes Submitted February 28, 2002; accepted May 27, 2002. Prepublished online as Blood First Edition Paper, June 7, 2002; DOI 10.1182/blood-2002-02-0654. Supported by a grant from the Ministry of Health, Warsaw, Poland (506-01-052) and the Medical University of Lodz, Poland (503-107-2 and 503-131-1). The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734. Reprints: Krzysztof Warzocha, Department of Hematology, Medical University of Lodz, 93-513 Lodz, Ciolkowskiego 2, Poland; e-mail: warzocha{at}psk2.am.lodz.pl.     References Top Abstract Introduction Study design Results and discussion References 1. McGuire W, Hill AV, Allsopp CE, Greenwood BM, Kwiatkowski D. Variation in the TNF-alpha promoter region associated with susceptibility to cerebral malaria. Nature. 1994;371:508-511[CrossRef][Medline] [Order article via Infotrieve]. 2. Westendorp RGJ, Langermans JAM, Huizinga TWJ, et al. Genetic influence on cytokine production and fatal meningococcal disease. Lancet. 1997;349:170-173[CrossRef][Medline] [Order article via Infotrieve]. 3. Wilson AG, de Vries N, Pociot F, di Giovine FS, van der Putte LB, Duff GW. An allelic polymorphism within the human tumor necrosis factor alpha promoter region is strongly associated with HLA A1, B8 and DR3 alleles. J Exp Med. 1993;177:557-560[Abstract/Free Full Text]. 4. Bouma G, Crusius JB, Oudkerk Pool M, et al. Secretion of tumour necrosis factor alpha and lymphotoxin alpha in relation to polymorphism in the TNF genes and HLA-DR alleles: relevance for inflammatory bowel disease. Scan J Immunol. 1996;43:456-463[CrossRef][Medline] [Order article via Infotrieve]. 5. Jacob CO, Fronek Z, Lewis GD, Koo M, Hansen JA, McDevitt HO. Heritable major histocompatibility complex class II-associated differences in production of tumor necrosis factor alpha: relevance to genetic predisposition to systemic lupus erythematosus. Proc Natl Acad Sci U S A. 1990;87:1233-1237[Abstract/Free Full Text]. 6. Pociot F, Briant L, Jongeneel CV, et al. Association of tumor necrosis factor (TNF) and class II major histocompatibility complex alleles with the secretion of TNF-alpha and TNF-beta by human mononuclear cells: a possible link to insulin-dependent diabetes mellitus. Eur J Immunol. 1993;23:224-231[Medline] [Order article via Infotrieve]. 7. Brinkman BM, Huizinga TW, Kurban SS, et al. Tumour necrosis factor alpha gene polymorphisms in rheumatoid arthritis: association with susceptibility to, or severity of, disease? Br J Rheumatol. 1997;36:516-521[Abstract/Free Full Text]. 8. Verjans GM, Brinkman BM, Van Doornik CE, Kijlstra A, Verweij CL. Polymorphism of tumor necrosis factor-alpha (TNF) at position -308 in relation to ankylosing spondylitis. Clin Exp Immunol. 1994;97:45-47[Medline] [Order article via Infotrieve]. 9. Kaslow RA, Carrington M, Apple R, et al. Influence of combinations of human major histocompatibility complex genes on the course of HIV-1 infection. Nature Med. 1996;2:405-411[CrossRef][Medline] [Order article via Infotrieve]. 10. Garcia-Merino A, Alper CA, Usuku K, et al. Tumor necrosis factor (TNF) microsatellite haplotypes in relation to extended haplotypes, susceptibility to disease associated with the major histocompatibility complex and TNF secretion. Hum Immunol. 1996;50:11-21[CrossRef][Medline] [Order article via Infotrieve]. 11. Peruccio D, D'Alfonso S, Borelli I, et al. Distribution of tumor necrosis factor alleles (NcoI RFLP) and their relationship to HLA haplotypes in an Italian population. Hum Hered. 1993;43:103-110[CrossRef][Medline] [Order article via Infotrieve]. 12. Abraham LJ, French MA, Dawkins RL. Polymorphic MHC haplotypes affect the activity of tumor necrosis factor alpha. Clin Exp Immunol. 1993;92:14-18[Medline] [Order article via Infotrieve]. 13. Cox A, Gonzalez AM, Wilson AG, et al. Comparative analysis of the genetic associations of HLA-DR3 and tumour necrosis factor alpha with human IDDM. Diabetologia. 1994;37:500-503[CrossRef][Medline] [Order article via Infotrieve]. 14. Brinkman BMN, Keet IPM, Miedema F, Verweij CL, Klein MR. Polymorphisms within the human tumor necrosis factor- promoter region in human immunodeficiency virus type 1-seropositive persons. J Infect Dis. 1997;175:188-190[Medline] [Order article via Infotrieve]. 15. Middleton PG, Taylor PRA, Jackson G, Proctor SJ, Dickinson AM. Cytokine gene polymorphisms associating with severe acute graft-versus-host disease in HLA-identical sibling transplants. Blood. 1998;92:3943-3948[Abstract/Free Full Text]. 16. Wilson AG, Symons JA, McDowell TL, McDevitt HO, Duff GW. Effects of a polymorphism in the human tumor necrosis factor alpha promoter on transcriptional activation. Proc Natl Acad Sci U S A. 1997;94:3195-3199[Abstract/Free Full Text]. 17. Udalova IA, Nedospasov SA, Webb GC, Chaplin DD, Turetskaya RL. Highly informative typing of the human TNF locus using six adjacent polymorphic markers. Genomics. 1993;16:180-186[CrossRef][Medline] [Order article via Infotrieve]. 18. Takashiba S, Shapira L, Amar S, Van Dyke TE. Cloning and characterization of human TNF promoter region. Gene. 1993;131:307-308[CrossRef][Medline] [Order article via Infotrieve]. 19. Warzocha K, Ribeiro P, Bienvenu J, et al. Genetic polymorphisms in the tumor necrosis factor locus influence non-Hodgkin's lymphoma outcome. Blood. 1998;91:3574-3581[Abstract/Free Full Text]. 20. Coiffier B, Gisselbrecht C, Herbrecht R, Tilly H, Bosly A, Brousse N. LNH-84 regimen: a multicenter study of intensive chemotherapy in 737 patients with aggressive malignant lymphoma. J Clin Oncol. 1989;7:1018-1026[Abstract]. 21. Dorak MT, Lawson T, Machulla HKG, Darke C, Mills KI, Burnett AK. Unravelling an HLA-DR association in childhood acute lymphoblastic leukemia. Blood. 1999;94:694-700[Abstract/Free Full Text]. 22. The International Non-Hodgkin's Lymphoma Project. a predictive model for aggressive non-Hodgkin lymphoma. N Engl J Med. 1993;329:987-994[Abstract/Free Full Text]. 23. Caligaris-Cappio F. How immunology is reshaping clinical disciplines: the example of haematology. Lancet. 2001;358:49-55[CrossRef][Medline] [Order article via Infotrieve]. © 2002 by The American Society of Hematology.   CiteULike    Connotea    Del.icio.us    Digg    Reddit    Technorati    What's this? This article has been cited by other articles: A. J. Novak, S. L. Slager, Z. S. Fredericksen, A. H. Wang, M. M. Manske, S. Ziesmer, M. Liebow, W. R. Macon, S. R. Dillon, T. E. Witzig, et al. Genetic Variation in B-Cell-Activating Factor Is Associated with an Increased Risk of Developing B-Cell Non-Hodgkin Lymphoma Cancer Res., May 15, 2009; 69(10): 4217 - 4224. [Abstract] [Full Text] [PDF] J. R. Cerhan, S. M. Ansell, Z. S. Fredericksen, N. E. Kay, M. Liebow, T. G. Call, A. Dogan, J. M. Cunningham, A. H. Wang, W. Liu-Mares, et al. Genetic variation in 1253 immune and inflammation genes and risk of non-Hodgkin lymphoma Blood, December 15, 2007; 110(13): 4455 - 4463. [Abstract] [Full Text] [PDF] A. Diepstra, G. W. van Imhoff, H. E. Karim-Kos, A. van den Berg, G. J. te Meerman, M. Niens, I. M. Nolte, E. Bastiaannet, M. Schaapveld, E. Vellenga, et al. HLA Class II Expression by Hodgkin Reed-Sternberg Cells Is an Independent Prognostic Factor in Classical Hodgkin's Lymphoma J. Clin. Oncol., July 20, 2007; 25(21): 3101 - 3108. [Abstract] [Full Text] [PDF] J. R. Cerhan, S. Wang, M. J. Maurer, S. M. Ansell, S. M. Geyer, W. Cozen, L. M. Morton, S. Davis, R. K. Severson, N. Rothman, et al. Prognostic significance of host immune gene polymorphisms in follicular lymphoma survival Blood, June 15, 2007; 109(12): 5439 - 5446. [Abstract] [Full Text] [PDF] E. Lech-Maranda, P. Juszczynski, A. Szmigielska-Kaplon, K. Jamroziak, E. Balcerczak, and T. Robak Human leukocyte antigens HLA DRB1 influence clinical outcome of chronic lymphocytic leukemia Haematologica, May 1, 2007; 92(5): 710 - 711. [Abstract] [Full Text] [PDF] C. Deans, M. Rose-Zerilli, S. Wigmore, J. Ross, M. Howell, A. Jackson, R. Grimble, and K. Fearon Host Cytokine Genotype is Related to Adverse Prognosis and Systemic Inflammation in Gastro-Oesophageal Cancer Ann. Surg. Oncol., February 1, 2007; 14(2): 329 - 339. [Abstract] [Full Text] [PDF] S. S. Wang, J. R. Cerhan, P. Hartge, S. Davis, W. Cozen, R. K. Severson, N. Chatterjee, M. Yeager, S. J. Chanock, and N. Rothman Common Genetic Variants in Proinflammatory and Other Immunoregulatory Genes and Risk for Non-Hodgkin Lymphoma Cancer Res., October 1, 2006; 66(19): 9771 - 9780. [Abstract] [Full Text] [PDF] E. Lech-Maranda, L. Baseggio, J. Bienvenu, C. Charlot, F. Berger, D. Rigal, K. Warzocha, B. Coiffier, and G. Salles Interleukin-10 gene promoter polymorphisms influence the clinical outcome of diffuse large B-cell lymphoma Blood, May 1, 2004; 103(9): 3529 - 3534. [Abstract] [Full Text] [PDF] Y. J. Kim, H.-S. Lee, J.-H. Yoon, C. Y. Kim, M. H. Park, L. H. Kim, B. L. Park, and H. D. Shin Association of TNF-{alpha} promoter polymorphisms with the clearance of hepatitis B virus infection Hum. Mol. Genet., October 1, 2003; 12(19): 2541 - 2546. [Abstract] [Full Text] [PDF] This Article Abstract Full Text (PDF) All Versions of this Article: 2002-02-0654v1 100/8/3037    most recent Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Juszczynski, P. Articles by Warzocha, K. Search for Related Content PubMed PubMed Citation Articles by Juszczynski, P. Articles by Warzocha, K. Related Collections Neoplasia Brief Reports Social Bookmarking                   What's this?

	Copyright © 2002 by American Society of Hematology         Online ISSN: 1528-0020