|
|
Prepublished online as a Blood First Edition Paper on June 21, 2002; DOI 10.1182/blood-2002-01-0118.
 Previous Article | Table of Contents | Next Article 
Blood, 1 November 2002, Vol. 100, No. 9, pp. 3147-3154
GENE THERAPY
Transduction of donor hematopoietic stem-progenitor cells with
Fas ligand enhanced short-term engraftment in a murine model
of allogeneic bone marrow transplantation
Katharine A. Whartenby,
Erin E. Straley,
Heeje Kim,
Frederick Racke,
Vivek Tanavde,
Kevin S. Gorski,
Linzhao Cheng,
Drew M. Pardoll, and
Curt I. Civin
From the Departments of Oncology, Pathology, and
Pediatrics, Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins
University School of Medicine, Baltimore, MD.
 |
Abstract |
Fas-mediated apoptosis is a major physiologic mechanism by which
activated T cells are eliminated after antigen-stimulated clonal
expansion generates a specific cellular immune response. Because
activated T cells are the major effectors of allograft rejection, we
hypothesized that genetically modifying allogeneic bone marrow (BM)
cells prior to transplantation could provide some protection
from host T-cell attack, thus enhancing donor cell engraftment in bone
marrow transplantation (BMT). We undertook studies to determine the
outcome of lentiviral vector-mediated transduction of Fas ligand (FasL)
into lineage antigen-negative (lin ) mouse BM cells
(lin BMs), in an allogeneic BMT model. FasL-modified
lin BMs killed Fas-expressing T cells in vitro. Mice that
received transplants of allogeneic FasL+ lin
BMs had enhanced short-term engraftment, after nonmyeloablative conditioning, as compared to controls. We observed no major hepatic toxicity or hematopoietic or immune impairment in recipient mice at
these time points. These results suggest potential therapeutic approaches by manipulating lymphohematopoietic stem-progenitor cells to
express FasL or other immune-modulating genes in the context of BMT.
(Blood. 2002;100:3147-3154)
© 2002 by The American Society of Hematology.
| |
Introduction |
General radiopharmacologic immunosuppression is the
primary method used to decrease the immune rejection response of the
host against allogeneic donor hematopoietic and organ transplant
grafts. Development of more specific, cellular therapies designed to
induce antigen-specific tolerance would be widely applicable in many transplantation settings. Studies have begun to investigate potential avenues for novel cellular-based therapies by producing tolerance using
immature dendritic cells (DCs) alone,1,2 as well as DCs
genetically modified to express a number of immunoregulatory genes,
including interleukin 10 (IL-10),3 transforming growth factor  (TGF-),4 CTLA4-Ig,4 and
Fas ligand (FasL).5,6 These approaches confer tolerance in
certain defined experimental settings. The Fas pathway offers an
intriguing opportunity to manipulate the antidonor immune response in
the bone marrow transplantation (BMT) setting, because allograft
rejection is mediated primarily by activated host antidonor T cells and
because activated T cells generally express high levels of the Fas
receptor and are susceptible to Fas-mediated apoptosis, at least during
the later stages of activation ("activation-induced cell
death").7-9
Conflicting results have been obtained on the effects of expressing
FasL in experimental solid organ allografts. For pancreatic islet cell
allografts, the initial report found increased graft acceptance,10 but later studies indicated that
FasL+ pancreatic allografts became infiltrated with
neutrophils and suffered enhanced rejection.11 Tolerance
to FasL+ allografts was shown in thyroid12 and
lung13 models. FasL expression was also shown to inhibit
allogeneic recognition of tumor cells.14 The circumstances
leading to these conflicting results are complex, and there are
multiple differences among these model systems, including the strains
of mice and the immunosuppressive regimens. In addition, the local
environment may influence the nature of the response to FasL
expression. For example, TGF- inhibited the proinflammatory effects
of FasL in a tumor rejection model.15
In this initial investigation of this approach, we sought to determine
whether allogeneic hematopoietic grafts might be protected from acute
rejection, early after nonmyeloablative transplantation, by genetically
expressing FasL in donor lineage antigen-negative bone marrow (BM) cell
preparations (lin BMs) enriched in lymphohematopoietic
stem-progenitor cells. Allogeneic BMT is an important treatment option
for many cases of hematologic malignancies and blood diseases, as well
as selected nonhematologic cancers and inherited disorders, but is
limited by complications, including graft-versus-host disease (GVHD).
Rigorous isolation of transplanted lymphohematopoietic stem-progenitor
cells removes mature T cells and thereby prevents or reduces GVHD; but
in the absence of donor T cells, host-versus-graft (HVG) rejection
becomes a major problem. The effects of FasL expression have not been previously reported in a BMT model; "armed" FasL+ donor
lin BMs might engraft, and then they and their
multilineage FasL+ progeny could kill T cells that attack
them. This would tend to down-regulate the antidonor immune response
and protect the donor graft. FasL+ lymphohematopoietic
stem-progenitor cells for BMT might be more effective than
FasL+ DCs have been in organ transplant models, because
transduced lymphohematopoietic stem-progenitor cells could generate
large numbers of donor FasL+ progeny cells. On this basis,
we undertook studies to determine whether lentiviral transduction of
donor lin BMs with FasL protected the donor graft from
acute rejection, in an allogeneic mouse nonmyeloablative BMT model.
Results indicate that FasL+ lin BMs killed
activated antidonor T cells and enhanced short-term donor cell
engraftment, without producing major acute hepatotoxicity or
generalized acute myelosuppression or immunosuppression.
| |
Materials and methods |
Viral vector construction and production
The FasL gene expression vector was created by fusion of the
mouse FasL coding region to the 5' end of the enhanced green fluorescent protein (GFP) gene, and subsequent insertion into a
lentivirus vector under the control of the cytomegalovirus (CMV-)-actin fusion promoter. The control vector expresses only GFP. The lentivirus packaging system16 and the
self-inactivating lentiviral parent vector pRLL.hPGK.GFP
SIn-1817 have been described previously. The PGK promoter
was removed from the parent vector, and additional restriction sites
were added
(5'XhoI-EcoRV-BamHI-AgeI-NheI-KpnI-MluI-SpeI-HpaI-EcoRI-XBamHI) by insertion of a T4 kinase-treated oligonucleotide pair: (1) CGAGATATCGGATCCACCGGTGCTAGCGGTACCACGCGTACTAGTGTTAACGAATTC and (2)
GATCGAATTCGTTAACACTAGTACGCGTGGTACCGCTAGCACCGGTGGATCCGATATC. Next, the 1.75-kb CMV--actin fusion promoter (CAG) derived from the
pCAGGS vector from Dr J. Miyazaki (Osaka University Medical School,
Suita, Japan)18 was inserted into the modified
parent vector preceding the GFP reporter sequence, and the GFP was
removed. A plasmid containing the mouse full-length FasL cDNA coding
sequence, as an 880-bp insert in the p43 plasmid,19 was
obtained from Dr T. August (Johns Hopkins Medical Institutions
[JHMI]). The FasL cDNA was digested from the p43 plasmid using
BglII and SalI, then cloned into those sites of
the pEGFP-C2 plasmid (Clontech, Palo Alto, CA). The resulting FasL-EGFP
fusion sequence was digested from the plasmid with NheI and
MluI, then using these sites, inserted into the lentiviral
parent vector under the control of the CMV--actin fusion promoter.
The insert sequence was verified by DNA sequencing.
For generation of producer lines, 293T cells cultured in Dulbecco
modified Eagle medium (DMEM) containing 10% fetal calf serum (FCS;
Life Technologies, Carlsbad, CA) were transfected using Effectene
(Qiagen, Valencia, CA). Viral supernatants were collected for 3 days
and filtered (0.45-µM Millipore filter, Fisher Scientific, Pittsburgh, PA). Supernatants were titered on 293T cells by adding 100 µL supernatant to 2 × 105 cells/well in 1 mL DMEM
containing 10% FCS in a 6-well dish (Costar, Bedford, MA), incubating
for 2 days, then measuring the percent GFP+ cells by
fluorescence-activated cell sorting (FACS) analysis of 488-nm excited
fluorescence in the FL1 channel using a FACScan flow cytometer and
Cellquest software (Becton Dickinson, San Jose, CA). Supernatant from
293T cells was either used fresh for transduction or stored at  80°C
until use. Prior to use, supernatants were concentrated using Centricon
filters (100-kDa cutoff; Millipore, Bedford, MA). Sufficient
supernatant to achieve a multiplicity of infection (MOI) of 3 to 5 was
concentrated to a volume of 50 to 100 µL, then added to
lin BMs in the presence of 8 µg/mL polybrene (Sigma, St
Louis, MO).
BM harvest, DC cultures, lin BM enrichment, and
transduction
All animal studies were conducted under approved animal
protocols at JHMI. Mice were obtained from the National Cancer
Institute at 6 to 8 weeks of age, except for the 2C
transgenics,20 which were bred onto a C57BL/6 background
and kindly provided to us by Dr J. Schneck (JHMI). For BM harvest,
femurs and tibias were removed from mice that were killed,
flushed with ice-cold isotonic phosphate-buffered saline (PBS; pH 7.4, 0.05 M phosphate), and the resulting BM cells were washed and counted.
DCs were generated from BM cells as previously described.6
After transduction, DCs were evaluated on day 8 by FACS analysis for
expression of both the transgene (indicated by GFP fluorescence in the
FACScan FL1 channel) and DC markers (including phycoerythrin
[PE]-labeled major histocompatibility complex [MHC] class II,
CD80, CD86, and DEC-205, measured in the FL2 channel). PE-labeled
antibodies were obtained from Becton Dickinson-Pharmingen (San Diego,
CA), except DEC-205 was from Serotec (Raleigh, NC).
The Lin BMs were enriched from mouse BM by immunomagnetic
depletion of cells expressing mature hematopoietic "lineage"
antigens, following the manufacturer's procedure (Stem Cell
Technologies, Vancouver, BC, Canada), then plated at 106
cells/mL in RPMI 1640 with 5% serum (Life Technologies) containing recombinant flt-3 ligand (FL; 50 ng/mL; R & D Systems,
Minneapolis, MN), kit ligand (KL; 100 ng/mL; Peprotech, Rocky Hill,
NJ), and thrombopoietin (10 ng/mL; Peprotech). Lin BMs
were transduced 3 times, by addition of concentrated viral supernatant
(MOI 3-5) as described above, on days 1, 2, and 3 of culture. On day 4 or 5, aliquots of the transduced cells were analyzed by FACS for GFP
expression, plated for colony-forming cells (CFCs), or transplanted
intravenously (via the dorsal tail vein) into recipient mice. In
addition, transduced cells were analyzed for cytotoxic function by
coincubation with PKH26-labeled (PKH; Sigma) Jurkat target cells
(labeled according to the manufacturer's instructions), known to be
sensitive to Fas-mediated killing. Transduced lin BMs
were sorted for GFP expression, on a FACSVantage flow cytometer (Becton
Dickinson) for the dose-titration studies. Then, using multicolor flow
cytometry, labeled Jurkat target cells (PKH+) were
distinguished from (unlabeled) effector lin BMs by PKH
fluorescence (FACScan FL2 channel), and live versus dead
PKH+ Jurkat target cells were quantified using
7-aminoactinomycin (7-AAD; Becton Dickinson-Pharmingen) incorporation
(measured in FACScan FL3 channel), following the manufacturer's procedure.
Mixed lymphocyte reactions and T-cell proliferation assays
Spleen responder cells were incubated with irradiated (3000 cGy)
DCs or spleen cell stimulators, depending on the experiment. 105 DC stimulators were incubated with 106
responders. Then, 2 × 106 spleen cell stimulators were
added to 2 × 106 responders. Cultures were incubated in
96-well U-bottom plates (Costar) for 4 days, then 1 µCi/mL (0.037 MBq) 3H-thymidine (Amersham, Piscataway, NJ) was
added for 16 hours, at which time the plates were harvested and counted.
Allogeneic BMT and engraftment analysis
For nonmyeloablative allogeneic BMT in a multiple minor
histocompatibility complex mismatch setting, B6.SJL
(CD45.1+) donor lin BMs were infused into
400-cGy irradiated recipient C3H.SW (CD45.2+) mice. These
mice are MHC matched (H2b), but differ at multiple
minor histocompatibility loci, many of which are still
undefined.21 Mice were killed at 3 to 24 weeks after
transplantation, then single-cell suspensions of organs were prepared
for FACS analysis (BM and spleen), CFC assays (BM), and MLR assays
including responsiveness to third-party stimulators (spleen). In these
FACS analyses, BM and spleen were evaluated for the numbers of donor
cells (CD45.1+) and transduced donor cells
(GFP+/CD45.1+). PE-CD45.1 monoclonal antibody
was obtained from Pharmingen.
CFC assays
Analysis of CFCs was conducted on BM cells prior to
transplantation by plating 3 × 103 transduced
lin BMs (in triplicate) in 1 mL Marrow-Gro
methylcellulose medium (generously provided by Quality Biologicals,
Gaithersburg, MD) supplemented with recombinant KL (50 ng/mL), IL-3 (10 ng/mL), granulocyte-monocyte colony-stimulating factor (GM-CSF; 10 ng/mL), and erythropoietin (Epo; 5 U/mL). Unless otherwise specified, growth factors were obtained from Peprotech. After 7 days incubation, CFC-Mix, CFC-granulocyte-macrophage (CFC-GM), and erythroid
burst-forming unit (BFU-E) colonies were counted. When the mice
receiving transplants were killed, 3 × 105 whole BM
cells were assayed for CFCs as above.
For the studies with soluble FasL (sFasL), BM cells were plated in
QBSF-58 (Quality Biologicals) containing KL, GM-CSF, and Epo, with a
range of concentrations of sFasL (Alexis Pharmaceuticals, San Diego,
CA) for 48 hours prior to plating in CFC assays.
Listeria monocytogenes challenge
BALB/c mice, known to be susceptible to
Listeria from preliminary studies, were lethally irradiated (850 cGy) and received transplants of syngeneic BALB/c lin BMs
that had been transduced with either the control GFP or the FasL-GFP
lentiviral vector. Three weeks later, the mice that underwent transplantation were tail bled to quantify GFP+ cells, then
injected intraperitoneally with 106 colony-forming units
(cfu) attenuated L monocytogenes bacteria.22 Four days after challenge, mice were killed. Livers and spleens were
removed, and portions were fixed in paraformaldehyde and analyzed
histologically. The remainders of these organs were crushed to obtain
single-cell suspensions that were stained with CD8 Cy-chrome and either
CD3-PE or CD4-PE monoclonal antibodies (Becton Dickinson-Pharmingen), then analyzed by FACS.
| |
Results |
Transduced lin BMs were analyzed for
expression of the transgene by (1) determination of GFP fluorescence
(which should be present in both control vector-transduced and
experimental vector-transduced groups because the experimental
lentivirus encodes FasL as a GFP-fusion) and (2) determination of
function by analyzing killing of FasL-sensitive Jurkat T cells by
transduced cells. Ten to 20% of the transduced lin BMs
used were GFP+, consistently in control and experimental
groups throughout the experiments described herein; specific
percentages are shown for representative experiments.
Transduced FasL+ lin BMs killed
activated T cells
For the functional assay, lin BMs were
incubated with PKH-labeled Jurkat cells, then the cocultured cells were
analyzed by FACS for the presence of 7-AAD (indicating cell
death) in PKH+ (Jurkat) cells (Figure
1A). To determine whether there was a dose-response effect for the killing of the Jurkat cells by
FasL+ cells, transduced lin BMs were FACS
sorted for GFP expression, then mixtures of FasL+ (ie,
based on GFP fluorescence) with FasL (ie,
GFP) cells were prepared and incubated for 24 hours with
PKH-labeled Jurkat target cells. Mixtures containing 1% or 5%
FasL+ cells mediated only a slight increase in killing
compared to negative control cultures. The mixture containing 20%
FasL+ lin BMs was markedly more effective at
killing Jurkat cells, and the mixture containing 80% FasL+
lin BMs was slightly more potent than the 20% mixture
(Figure 1A shows 1 of 2 similar experiments).
View larger version (9K):
[in this window]
[in a new window]
| Figure 1.
FasL in the transduced cells was functional.
FasL+ lin BMs killed Jurkat T cells in a
dose-dependent fashion, and FasL+ DCs decreased T-cell
proliferative responses. (A) B6.SJL lin BMs were
transduced 3 times to express either the control GFP vector or the
vector expressing the GFP-FasL fusion. On day 5 of ex vivo transduction
culture, the cells were FACS sorted into
(FasL+)GFP+ or
(FasL)GFP subsets. The
(FasL+)GFP+ subset expressed more than 10-fold
higher fluorescence than the (FasL)GFP
subset; the lin BMs with intermediate levels of
fluorescence were discarded. Sorted (FasL+)GFP+
cells were mixed in varying ratios with
(FasL)GFP cells for a total of
105 lin BMs, as indicated, in duplicate wells
of a 96-well plate containing 105 PKH-labeled Jurkat cells.
At 24 hours later, 7-AAD was added to the cultures, which were then
analyzed by FACS for the percent PKH+ (Jurkat) cells that
had incorporated 7-AAD. Shown are histograms of 7-AAD fluorescence
in-gated PKH+ (Jurkat) cells. Mixtures containing 1%, 5%,
20%, or 80% (FasL+)GFP+ lin
BMs, indicated by the graph labels, resulted in 5%, 9%, 36%, and
42% dead Jurkat cells, respectively. (B) Function of modified DCs was
tested in a standard T-cell proliferation assay. GFP control-transduced
or FasL-transduced B6.SJL or BALB/c DCs were generated as described,
then irradiated (3000 cGy) and incubated with responder spleen cells
(B6, transgenic 2C [on a B6 background] or BALB/c, as indicated in
the graph axis labels). Proliferation was determined by incorporation
of 3H-thymidine. This plot shows the averages (± SD) of 3 separate experiments. (C) T-cell proliferative responses are shown from
experiments in which allogeneic DCs were mixed with syngeneic DCs as
stimulators, with either the allogeneic DCs (B6) or the syngeneic DCs
(BALB/c) modified to express FasL. In this set of experiments,
106 BALB/c spleen cells were mixed with, from left to
right: 105 control B6 DCs; 105
FasL+ B6 DCs; 5 × 104 control B6 DCs plus
5 × 104 control BALB/c DCs; and 5 × 104
control B6 DCs plus 5 × 104 FasL+ BALB/c
DCs. After 3 days of incubation, 1 µCi (0.037MBq)
3H-thymidine was added for 24 hours, then cells were
harvested and proliferation was determined by 3H-thymidine
incorporation. The results are shown for 2 separate experiments, with
triplicates for each condition.
|
|
FasL+ DCs inhibited allogeneic T-cell proliferation
Untransduced DCs or DCs transduced with the FasL (-GFP
fusion) or the control GFP vector were irradiated and incubated
with responder spleen cells. In the allogeneic mixture (B6 DCs and BALB/c splenocyte responders), the control GFP+ DCs
stimulated a robust proliferative response, whereas the
FasL+ DCs failed to stimulate a response above background
(Figure 1B). 2C mice are transgenic for a CD8+ T-cell
receptor that recognizes H2 Ld (displayed on BALB/c
cells).18 Proliferation of 2C cells in response to BALB/c
stimulators was essentially eliminated with the FasL+ DCs.
To begin to address the question of the specificity of the effects of
FasL+ DCs, we tested whether proliferation of responder T
cells would be "nonspecifically" inhibited by FasL+
cells syngeneic to the responders. The results in Figure 1C indicate that the proliferative response of BALB/c T-responder cells was potently inhibited by FasL+ allogeneic B6 DCs. A mixed
population of B6 DC and FasL+ syngeneic BALB/c DC
stimulators resulted in some inhibition of the response of BALB/c T
cells to untransduced B6 DCs, but the inhibition was less. Thus,
although some nonspecific inhibition was observed with syngeneic
FasL+ cells, allogeneic FasL+ DCs mediated
nearly complete inhibition of the proliferative immune response.
Constitutive FasL expression by lin BMs did not
impair generation of CFCs
Lin BMs were enriched from mouse BM as described,
transduced with either the GFP or FasL vector (resulting in 10%-20%
GFP+ cells before BMT, determined by FACS analysis prior to
plating), and plated in CFC assays. Colonies were counted 7 days later. No significant difference was observed in numbers or types of CFCs from
the 2 groups (Figure 2A).
View larger version (8K):
[in this window]
[in a new window]
| Figure 2.
FasL expression in lin BMs did not inhibit
generation of CFCs or syngeneic in vivo engraftment, assessed early
after BMT.
(A) B6.SJL lin BMs were transduced with either the
FasL(-GFP fusion) or control GFP vector as described in
"Materials and methods," then 3 × 103 cells were
plated in CFC assay medium as described in "Materials and methods."
The results are the averages (and SEM) of 4 separate experiments. (B)
CFCs were assayed from untransduced B6.SJL lin BMs that
were exposed to sFasL in vitro, at the concentrations indicated, for 24 hours prior to plating in methylcellulose. Colonies were counted 7 days
later; shown are the averages of 2 separate experiments. (C)
BALB/c lin BMs were transduced with either the GFP
control or FasL vector, then 105 cells were transplanted
into 850-cGy irradiated syngeneic mice (5 mice/group). Shown is the
histogram of GFP expression in the starting population of transduced
lin BMs. (D) At 3 weeks after transplantation of the
cells shown in panel C, mice were tail bled to determine the percentage
of circulating transduced cells. Whole blood was collected by tail
bleeds and red cells removed by hypotonic lysis, then analyzed by FACS
for GFP expression. The graph shows the percent GFP+ blood
cells after transplantation (each point represents one
mouse).
|
|
sFasL pretreatment of untransduced lin BMs did
not affect CFCs
Because only 10% to 20% of the transduced BM cells in the
experiments above expressed FasL, we undertook experiments to determine the effect of exposing 100% of the BM cells to agonistic sFasL. A
range of concentrations of sFasL was added to cultures of untransduced lin BMs for 48 hours prior to plating in CFC assays as
shown. Pretreatment of lin BMs with sFasL did not inhibit
CFC numbers or alter the distribution of CFC types (Figure
2B).
Constitutive FasL expression by lin BMs did not
impair syngeneic engraftment, assessed early after BMT
To investigate the effect of FasL expression on the capacity of
transduced FasL+ lin BMs to engraft,
syngeneic transplantations were performed. BALB/c lin BMs
were transduced with either the GFP control or FasL vector, then
105 cells were transplanted into 850-cGy irradiated
syngeneic mice (BALB/c). Figure 2C shows GFP fluorescence of the
lin BMs prior to transplantation. The entire population
of cells (transduced and untransduced) was injected for transplantation.
Three weeks after BMT, mice were tail bled to determine the percentage
of circulating cells that expressed the transgene (Figure 2D). Both
groups had similar percentages of GFP+ cells, which were
also similar to the percent GFP+ input cells (Figure 2C).
FasL+ lin BMs generated enhanced
allogeneic engraftment early after BMT
A multiple minor mismatch (B6.SJL C3H.SW) was selected as an
MHC-matched nonmyeloablative BMT model. Lin BMs
from B6.SJL mice (CD45.1+) were transduced with either the
control (GFP) or experimental FasL (-GFP) vector. Figure
3A shows GFP
fluorescence of the B6.SJL lin BMs prior to
transplantation into sublethally irradiated recipient C3H.SW
mice.
View larger version (31K):
[in this window]
[in a new window]
| Figure 3.
Mice that received transplants
of FasL+ allogeneic lin BMs had enhanced
engraftment early after BMT.
(A) B6.SJL (CD45.1+) lin BMs were transduced
with either control GFP or FasL(-GFP) vector. Cells were
analyzed by FACS to determine the level of GFP fluorescence of the
transduced cells prior to transplantation. (B) 105
transduced lin BM cells were transplanted intravenously
into 400-cGy irradiated C3H.SW (CD45.2+) recipients. After
mice were killed at 3 weeks after BMT, mouse organs were analyzed by
FACS for correlated expression of CD45.1 and GFP. The graph shows the
compilation of data for all mice shown in Table 1, with the average
percentage of CD45.1+ cells in BM of each group.
(C) The figure shows a representative plot for CD45.1 for a mouse that
received a transplant of GFP-modified cells (top) and a mouse that
received a transplant of FasL-modified cells (bottom). (D) These
histograms show the GFP fluorescence of gated CD45.1+
(donor) cells (from panel B) of representative mice that
received transplants of lin BMs transduced with either
control GFP or FasL and analyzed at 3 weeks after BMT.
|
|
Approximately 3 weeks later, mice were killed and analyzed for donor
cell hematopoietic engraftment. Donor cells and transduced cells were
analyzed by correlated CD45.1 and GFP fluorescence. Table
1 shows the percentages of transplanted
mouse BM cells derived from donor (CD45.1+) cells or
transduced donor (CD45.1+/GFP+) cells. Mice
that received transplants of FasL+ lin BMs
had significantly higher levels of donor chimerism than those that
received the control lin BMs, in BMs
(P = .01; Table 1 and Figure 3B).
View this table:
[in this window]
[in a new window]
|
Table 1.
Percentage of donor chimerism in each mouse receiving
unmodified, GFP-modified, and FasL-modified grafts
|
|
FasL+ lin BMs generated enhanced allogeneic
engraftment early after BMT. BM from mice was analyzed by FACS 3 weeks
after BMT to determine the presence of both donor cells
(CD45.1+) and donor cells that were transduced
(GFP+ and CD45.1+). The graph (Figure 3B)
summarizes the averages and SEM of all the mice shown in Table 1. In
Table 1, each value is representative of a single mouse, with results
combined from 4 separate experiments. The first 3 columns are the total
percent CD45.1+ cells in mice receiving unmodified,
GFP-modified, and FasL-modified transplants as indicated; the last row
is the percentage of CD45.1+ cells that are
GFP+ also, in the FasL transplants
(CD45.1+/GFP+).
The BM cells from mice that underwent allotransplantation killed at 3 weeks after BMT (Table 1) were assessed for CFCs. No significant
differences were observed in numbers or types of CFCs from the
FasL-transduced versus control GFP-transduced groups of mice (Figure
4).
View larger version (12K):
[in this window]
[in a new window]
| Figure 4.
Mice that received transplants of FasL+
lin BMs did not have diminished numbers of BM CFCs early
after BMT.
After the mice described in Figure 3 were killed, whole BM
(3 × 105 cells) was assayed for CFCs (triplicates).
Seven days after plating, colonies were counted (averages ± SEM
are shown).
|
|
Additional mice underwent transplantations as above in separate
experiments; the transduction efficiency before BMT averaged 17%
(Table 2). In 2 experiments
(combined results), BM cells from mice were analyzed by FACS at 20 to
24 weeks after BMT for correlated expression of CD45.1 (representing
donor) and GFP (representing transduced) cells. Each value shows the
result for an individual mouse. The first column is the percent of
donor cells in BM from mice that received GFP-modified transplants. The
second column is the percent of donor cells in BM from mice that
received FasL-modified transplants. The third column correlates with
the second and shows the percent of donor cells that also are
GFP+. None of 7 mice that received transplants of control
GFP transduced lin BMs, but 4 of 7 mice that received
transplants of FasL-transduced lin BMs, had more than 2%
donor cells in BM. None of the mice in either group had detectable
GFP+ BM cells.
Mice that received transplants of FasL+
lin BMs did not have significant hepatic toxicity or
immune impairment
A significant concern with expressing FasL in lin
BMs is the potential for in vivo toxicity due to FasL. The mice that
received transplants of syngeneic or allogeneic FasL+
lin BMs were not different from control groups in overall
health, or on gross pathology at autopsy. Because hepatic cells express high levels of Fas and because hepatotoxicity was reported after administration of one, but not another, anti-Fas
antibody,23 we evaluated whether transplant with
FasL+ lin BMs produced histologic
hepatotoxicity. Histologic analysis of hematoxylin and eosin-stained
slides by a pathologist (F.K.R.) revealed no detectable injury to
hepatic cells of mice that had received a transplant of
FasL+ versus control GFP+ lin BMs
(Figure 5A,B). Mild hepatic inflammation
was noted in both groups but there was no difference in the levels of
hepatic inflammation between the 2 groups. In the groups followed for 4 to 6 months, inflammation persisted to varying degrees in the mice that
underwent transplantation; 1 of 4 FasL mice that were analyzed had
detectably worse inflammation.
View larger version (72K):
[in this window]
[in a new window]
| Figure 5.
Mice that received transplants of FasL+
lin BMs did not have hepatocellular injury or enhanced
hepatic inflammation and retained immune responsiveness to a
third-party alloantigen.
(A,B) Livers from mice shown in Figure 3
were fixed in formaldehyde, cut into paraffin blocks, then stained with
hematoxylin and eosin for evaluation of inflammation. Panel A is a
representative section from a control mouse that underwent GFP
transplantation, and panel B is from the liver of a representative
mouse that underwent FasL+ transplantation. (C) Splenocytes
from mice that underwent transplantation were incubated as responders
with irradiated (3000 cGy) allogeneic third-party stimulator (BALB/c)
spleen cells. Four days after adding stimulators,
3H-thymidine was added overnight. Cells were then
harvested, and incorporation of 3H-thymidine was
determined. This panel shows the proliferative responses
(group averages ± SEM) from 8 mice that received transplants of
FasL-transduced lin BMs, 7 mice that received transplants
of control GFP-transduced lin BMs, 4 mice that received
transplants of untransduced lin BMs, and 3 control C3H.SW
mice that did not undergo transplantation, taken from 3 separate
experiments.
|
|
To assess the immune responsiveness of the mice that underwent
allotransplantation, splenocytes were taken at the time of killing and
used as responders in an MLR to a third-party antigen stimulator
(BALB/c, H2d). No significant difference was observed
between the 2 groups in the level of proliferation. (Figure 5C).
To further evaluate hepatotoxicity and to test the immune
responsiveness of the mice that underwent transplantation, we
challenged mice that underwent transplantation with a sublethal dose of
L monocytogenes as a model infectious agent. Listeria
was selected because it is known to produce hepatic inflammation,
and thus any inflammatory or hepatic in vivo toxicity of
FasL+ lin BMs or their progeny might be
highlighted by this challenge. In addition, because T cells have been
reported to die in the liver based on Fas-FasL
interactions,24 significant Fas-mediated toxicity should
prevent accumulation of T cells recruited in response to this
challenge. BALB/c lin BMs were transduced with FasL or
GFP as above, and transplanted into lethally irradiated syngeneic
BALB/c recipients. All mice were then injected intraperitoneally with a
sublethal dose of Listeria, observed for 4 days, and killed.
All mice in both groups exhibited decreased activity, starting 1 day
after Listeria injection. On pathologic examination, all
mice had mild inflammation in the liver, with no gross differences
between the 2 groups (Figure 6A). All
mice had high numbers of T cells in the livers in response to this
challenge (Figure 6B).
View larger version (77K):
[in this window]
[in a new window]
| Figure 6.
Mice that received transplants of syngeneic
FasL+ lin BMs responded to an antigenic
infectious challenge.
(A) Representative liver histologies of mice 4 days after
L monocytogenes injection. Some hepatic inflammation was
seen in all mice in both control (top) and experimental (bottom)
groups. (B) Livers were analyzed for T-cell infiltration by
making single-cell suspensions from a portion of the liver and staining
for T-cell markers. Shown are representative FACS plots of correlated
CD4 and CD8 staining of the liver cells from a normal uninfected mouse
liver, a liver from a mouse that received a transplant of control
GFP+ lin BMs, and a liver from a mouse that
received a transplant of FasL+ lin
BMs.
|
|
| |
Discussion |
Results of this study suggest that HVG rejection was
inhibited at time points early after transplantation when FasL was
genetically expressed in a fraction of the transplanted donor BM
cells. Increased levels of donor cells were detected in the
host early after nonmyeloablative BMT, and no significant toxicity to
the recipient mice was detected. These results may serve as a paradigm
for developing systems in which immune modulatory genes may be inserted
into donor lin BMs prior to BMT to engineer the
recipient's immune response after BMT. Insertion of immunomodulatory
genes into BM prior to transplantation has the potential to be applied
to diseases for which BMT is already used, to enhance the
transplantation effects, or to develop new therapies in which
transplantation could be used for the purpose of introducing such
genes. Thus, the capacity to modify immune responses through BMT would
provide a significant potential for improvement of therapies for a
number of diseases.
In the present experiments, transduced FasL+
lin BMs killed Fas-sensitive T cells in vitro. Expression
of FasL in mouse lin BMs did not appear to be toxic to BM
function because (1) there was no difference in the CFC numbers or
types from FasL+ lin BMs compared to
controls, and (2) FasL+ donor lin BMs
engrafted to as high (in syngeneic transplants) or higher (in
allogeneic transplants) levels than did control lin BMs.
Although syngeneic engraftment was assessed at only the early time
point of 3 weeks after BMT, this finding is consistent with other
studies in which human CD34+ cells were shown to not be
susceptible to Fas-mediated apoptosis, possibly due to high level
expression of the caspase pathway inhibitor, FLICE inhibitory protein
(FLIP).25
FasL+ lin BMs directly killed Fas-sensitive
Jurkat target cells, and FasL+ DCs inhibited allogeneic
T-cell proliferation. Transplanted FasL+ lin
BMs have the potential to differentiate in vivo into DCs, which could
potentiate the tolerizing effect mediated by the FasL+
lin BMs, per se. Our observation that FasL+
DCs decreased an immune response is consistent with findings in
multiple other in vitro and model organ transplant systems. Mice that
received transplants of FasL+ donor lin BMs
had significantly higher levels of donor hematopoietic cell chimerism
than did those that received transplants of control donor
lin BMs. This was likely the result of inhibition of HVG
attack by the FasL+ lin BMs and progeny,
because in the syngeneic transplantations conducted for the
Listeria challenge, no significant differences in levels of
total or GFP+ cells were observed between the
FasL+ and control groups. Presumably, FasL expression would
confer no selective advantage in a syngeneic transplantation. In the nonmyeloablative allogeneic BMT recipient hematopoietic chimeras, not
all of the donor cells were transduced or expressed high levels of
FasL, as assessed by GFP fluorescence from the fusion protein. Thus,
HVG rejection was significantly down-regulated, even though only a
fraction of the donor cells were FasL+. It is possible that
FasL+ cells generated donor tolerance, and once tolerance
to donor cells was achieved, the FasL+ cells no longer had
a selective advantage over the untransduced donor cells. Over time, the
percent FasL+ cells appeared to decrease, consistent with
this hypothesis. Because the percent donor cells decreased somewhat
over time, ongoing studies will address relative contribution of the
graft in longer term experiments using this approach, as compared to (or combined with) other nonmyeloablative approaches. The goal of the
present studies was to determine effects on acute allograft rejection.
In addition, these studies do not address the potential for long-term
nonspecific toxicity, for example, late GVHD or late nonspecific
immunosuppression. However, it appears that the FasL expression
provides bystander protection and that not all the cells need to
express FasL. In these experiments, clonal expansion of
FasL+ cells did not occur. Thus, it may be possible to
translate the effects of FasL+ cells to clinical use in the
future using only a low percent FasL+ cells that
express FasL for a relatively short time. However, more extensive
analysis of long-term transplants will be necessary to determine the
full extent of the beneficial and potential toxic effects.
These results are consistent with other model systems in which organs
modified to express FasL have been protected from rejection, as
discussed above. One still unresolved issue in the use of FasL is the
results from studies in which FasL generated enhanced rejection of
organs and inflammatory responses. The conditioning regimen may affect
the level of engraftment or rejection and the degree of nonspecific
immunosuppression. For example, BMT preparative radiation may
nonspecifically sensitize cells that may up-regulate Fas, potentially
leading to nonspecific killing by FasL+ cells. It is likely
that the microenvironment surrounding the FasL+ cells may
contribute to differences in published results, because FasL has been
shown to have different effects depending on the cytokines present in
the host. A greater understanding of these phenomena would increase the
utility of FasL in vivo.
One significant potential for a limitation in this approach of using
FasL+ BM cells is that constitutive hematopoietic cellular
expression of FasL might be toxic to the host. For example, many
subsets of immune cells express Fas and so might be nonspecifically
killed by FasL+ BM cells and their progeny.26
Long-term effects of constitutively expressed FasL by donor cells could
lead to chronic GVHD or potentially generate cells that would be
inappropriately resistant to killing. Inducible vector systems would be
one potential method to address these limitations. In addition, Fas is
not the sole determinant of sensitivity to FasL-mediated
apoptosis.27-30 As examples, DCs may express Fas but are
protected by high levels of FLIP, and T cells are only highly sensitive
to FasL on activation.31 In addition, we have recently
found that CD34+ cells are resistant to Fas-mediated
cytotoxicity and express low levels of Fas and high levels of
FLIP.25 However, because the detailed long-term effects of
in vivo administered transduced FasL+ BM cells are not
fully known, this significant concern must be investigated. In these
studies, the mice that received transplants of FasL+
lin BMs appeared as healthy as the controls. No
significant difference was observed in BM cellularity or CFCs of mice
that received transplants of FasL+ versus control
lin BMs. Because FasL has been shown to produce acute
hepatotoxicity in some systems, we analyzed livers histologically from
mice that underwent transplantation. Although there was
minimal inflammation in both experimental and control mice (mild
inflammation might be expected after a BMT), no difference was noted
between the groups.
An evaluation of immune function of mice that underwent transplantation
was conducted in 2 separate ways. First, spleen cells from the mice
that underwent transplantation were used as responders in an MLR at the
time of killing, as a general determinant of intact immune
responsiveness to an alloantigen. Mice that were received transplants
of FasL+ lin BMs had no decrease in the
ability to respond to allogeneic third-party stimulation. Second, mice
were evaluated for their ability to respond to an infectious agent
(L monocytogenes) at a dose that was determined empirically
to produce severe but sublethal toxicity (A. Jain, R. Schulick, D. Pardoll, unpublished observations, February 2001). Mice that
were significantly immunocompromised would be unable to mount an immune
response to the agent and succumb. At 1 to 4 days after injection of
the Listeria, all mice were alive but lethargic. At this
time, they were killed, and livers were analyzed by FACS for T-cell
infiltration and by histology. Because each liver had a significant
T-cell infiltrate, the ability to mobilize T cells in response to an
infectious antigen appeared to be intact in all mice.
These studies provide a novel approach to down-regulate graft rejection
in BMT. Because FasL has the potential to kill multiple cell types and
to produce organ toxicity, comprehensive analysis of potential toxicity
in long-term engrafted recipients of FasL+ BM cells needs
to be conducted prior to clinical application, and results at longer
time points are needed, for example, for assessment of potential
effects on long-term engrafting lymphohematopoietic stem cells or
chronic hepatotoxicity. In addition, the percentages of cells that
express the FasL may need to be titrated to achieve effective killing
of T cells with the minimum toxicity. Our results in vitro showed that
only marginal killing of T cells was achieved if 1% to 5% of the
effector cells expressed FasL. Therefore, values below this would not
likely result in an effective decrease in graft rejection. Additional
studies are currently under way, both to assess the long-term stability
of a nonmyeloablative transplant and for the expression of FasL. The
present studies tested the acute effects mediated by FasL expression in
lin BMs In potential future application in BMT, permanent
immunosuppression may not be necessary to achieve stable hematopoietic
engraftment and tolerance. If so, one might minimize exposure of the
recipient to FasL by coengineering the FasL+ BM cells with
a suicide gene so that the FasL+ cells could be deleted as
soon as engraftment and tolerance were observed.
| |
Acknowledgments |
Thanks to Ajay Jain and Richard Schulick for providing
Listeria monocytogenes and to Ephraim Fuchs and Leo Luznik
for bone marrow transplantation expertise.
| |
Footnotes |
Submitted January 15, 2002; accepted June 10, 2002.
Prepublished online
as Blood First Edition Paper, June 21, 2002; DOI
10.1182/blood-2002-01-0118.
Supported in part by grant 6663 from The Leukemia & Lymphoma Society
and a grant from the National Foundation for Cancer Research.
The Johns Hopkins University holds patents on CD34 monoclonal
antibodies and related inventions. C.I.C. is entitled to a share of the
sales royalty received by the University under licensing agreements
between the University, Becton Dickinson Corporation, and Baxter Health
Care Corporation. This arrangement is being managed by the University
in accordance with its conflict of interest policies.
The publication costs of this
article were defrayed in part by
page charge payment. Therefore,
and solely to indicate this fact,
this article is hereby marked
"advertisement"
in accordance with 18 U.S.C.
section 1734.
Reprints: Katharine A, Whartenby, Sidney Kimmel
Comprehensive Cancer Center at Johns Hopkins Bunting-Blaustein Cancer
Research Bldg, Room 2M44, 1650 Orleans St, Baltimore, MD 21231; e-mail:
whartka{at}jhmi.edu.
| |
References |
1.
Dhodapkar MV, Steinman RM, Krasovsky J, Munz C, Bhardwaj N.
Antigen-specific inhibition of effector T cell function in humans after injection of immature dendritic cells.
J Exp Med.
2001;193:233-238[Abstract/Free Full Text].
2.
Lutz MB, Suri RM, Niimi M, et al.
Immature dendritic cells generated with low doses of GM-CSF in the absence of IL-4 are maturation resistant and prolong allograft survival in vivo.
Eur J Immunol.
2000;30:1813-1822[CrossRef][Medline]
[Order article via Infotrieve].
3.
Lu L, Lee WC, Takayama T, et al.
Genetic engineering of dendritic cells to express immunosuppressive molecules (viral IL-10, TGF-beta, and CTLA4Ig).
J Leukoc Biol.
1999;66:293-296[Abstract].
4.
Lu L, Gambotto A, Lee WC, et al.
Adenoviral delivery of CTLA4Ig into myeloid dendritic cells promotes their in vitro tolerogenicity and survival in allogeneic recipients.
Gene Ther.
1999;6:554-563[CrossRef][Medline]
[Order article via Infotrieve].
5.
Matsue H, Matsue K, Walters M, Okumura K, Yagita H, Takashima A.
Induction of antigen-specific immunosuppression by CD95L cDNA-transfected "killer" dendritic cells.
Nat Med.
1999;5:930-937 |
Top
Abstract
Introduction