| |
|
|
|
|
|
|
|||
|
Prepublished online as a Blood First Edition Paper on July 5, 2002; DOI 10.1182/blood-2002-02-0638.
IMMUNOBIOLOGY
From the Laboratory for Immunological Research,
Schering-Plough, Dardilly, France.
Recent studies in humans have highlighted the importance of a
distinct cellular entity, the plasmacytoid dendritic cell (PDC). To
identify genes for which expression is restricted to human PDCs, a cDNA
subtraction technique was applied using cDNA from activated
monocyte-derived DCs (MDDCs) as competitor. In the 650 sequences
analyzed, 25% were for B-cell transcripts. We also found lymphoid-related genes, immunoglobulinlike transcript 7 (ILT7), granzyme B (GrB), Spi-B, and the receptor tyrosine kinase Eph-B1. Granzyme B was up-regulated on activation, and protein was detected only in PDCs. Eph-B1 protein was expressed in the cytoplasm and the
nuclei of PDCs and MDDCs, respectively. Interestingly, several novel
molecules have been identified that were predicted to encode for a type
2 transmembrane protein (BRI3), a putative cytokine (C-15,
a cysteine-rich-secreted protein), and a type 1 leucine-rich repeat
protein (MAPA). The identification of genes expressed in PDCs provides
new insights into their function and origin.
(Blood. 2002;100:3295-3303) Since their original identification, there
has been increasing evidence that dendritic cells (DCs) represent a
heterogeneous population of cells with distinct origins, stages of
differentiation/maturation, and specific functions.1,2 In
humans, a subset of immature CD11c To better characterize these cells, we performed a polymerase
chain reaction (PCR)-based subtraction technique on cDNA from PDCs
isolated from human tonsils (tester) and using cDNA from monocyte-derived DCs (MDDCs) as competitor. This approach is demanding because it requires high numbers of cells. MDDCs were chosen as competitor because they represent the prototype myeloid DCs, and they
can be generated in high numbers. In addition, MDDCs have been shown to
exert distinct effects compared with PDCs and thus were considered
appropriate candidates for identifying genes differentially regulated
in PDCs. Our aim was to identify transcripts preferentially overexpressed in PDCs, regardless of the stage of differentiation, compared with activated monocyte-derived DCs. One of the major drawbacks in the study of PDCs is the lack of markers specific for PDCs
that are maintained and that remain specific for PDCs at a mature
stage. For this purpose, we used a mixture of fresh, highly
purified, fluorescence-activated cell sorter analysis (FACS)-sorted PDCs pooled from different donors and IL-3 + CD40L-activated PDCs as tester. In the current study we describe the cloning of Spi-B, ILT7,
GrB, and Eph-B1 cDNA and the identification of novel transcripts such
as BRI3, C-15, and monocyte and plasmacytoid activated
molecule (MAPA). Comparison of the differential expression in MDDCs
versus PDCs of those newly identified genes gives new insights into
their origin and, interestingly, suggests uncovered functions of PDCs.
Cell preparations
RNA preparation
Construction of a subtracted PDC cDNA library To identify genes specifically expressed in PDCs, a subtracted hybridization technique was applied, as previously described,23 to 5 × 106 PDCs (tester) (composed of equal proportions freshly isolated and activated with IL-3 + CD40L) and to 108 CD40-activated MDDCs as competitor (driver). PDC mRNA (80 ng) was used as tester, and 1.5 µg MDDC mRNA was used as driver. Complementary DNA synthesis and subtraction were performed according to the PCR-select kit (Clontech, Palo Alto, CA) using Advantage KlenTaq polymerase (Clontech). The primary PCR reaction was for 28 cycles, and the second (nested) PCR was for 15 cycles on a thermal cycler 480 (Perkin-Elmer, Norwalk, CT). To clone subtracted PDC cDNA, 10 nested reactions were pooled and resolved on a 2% low-melting agarose. Aiming for individual bands, 12 gel slices in the 0.3- to 1.2-kb range were excised, DNA eluted, and cloned into a T/A-vector (pCRII; Invitrogen, San Diego, CA).DNA sequencing and analysis Inserts were sequenced in both strands by automatic sequencing (373 automated DNA sequencer; Applied Biosystems, Foster City, CA). Comparisons against GenBank and dbEST databases and protein homology prediction were obtained by BLAST.24 Sequences were analyzed using Sequencher (Genecodes, CA) and Lasergene (DNASTAR, London, United Kingdom). Prediction of signal sequences was made using pSORTII.25Analysis of gene expression by RT-PCR analysis First-strand cDNA was prepared using the Superscript kit (Pharmacia, Orsay, France). PCR reaction was subjected to 35 cycles of denaturing (30 seconds, 94°C), annealing (30 seconds), and extension (2 minutes, 72°C). Quantification of cDNA was performed by comparison with human glyceraldehyde-3-phosphate dehydrogenase (GAPDH)-PCR products, as follows GAPDH: sense, ACCACAGTCCATGCCATCAC; antisense,
TCCACCACCCTGTTGCTGTA; CD62L: sense, GGACCTGAGACCCTTGTGCT; antisense,
CCCATAGTACCCCACATCAC; CD123/IL-3R : sense, ATGCCGACTATTCTATGCCG; antisense, TGTCTCTGACCTGTTCTGTG; CXCR4: sense,
TGCTGACTATTCCCGACTTCATCT; antisense, GAATGTCCACCTCGCTTTCCTTTG; light chain: sense, CTCTGCAGTGAACATTCTGCAGGGGCCACCGT; antisense,
GGGAATTCATGAGGCCAGGGACAGGCCAG; germline light chain: sense,
CAGCTGACCCAGGACTCTGT; antisense, CTAACACTCTCCCCTGTTGAAGCTCTTTGTGACGGG; J chain: sense, GGGAGTCCTGGCGGTTTTTA; antisense, AGGCATCTGGGGTTAAGGCT; Spi-B: sense, ACCATGCTCGCCCTGGA; antisense, GGCTAGCGAAGTTCTCC; ILT7: sense, GCTACGGCTATGAAAACAACACCCC; antisense,
CAGTTGGGGAAGTGTCTGCTGAGAA; Eph-B1: sense, TTTAGGGGAAGGCTGATGAA;
antisense, GGGTGCCACTCCAGAATGAT; Granzyme B: sense,
ACCTCTCCCAGTGTAAATCT; antisense, GCGGTGGCTTCCTGATACAA; CD19: sense,
CGAGTTCTATGAGAACGACTC; antisense, ACTGGAAGTGTCACTGGCATG; and VH-Cµ:
sense, GACACGGCCGTGTATTACTG; antisense, ATCCGCGGCCGCGGAATTCTCACAGGAGACGA.
Northern blot analysis Hybridization of Northern blots (human immune system MTN blot 7768-1 and cancer cell line tissue blot 7757-1; Clontech) was with a 413-bp (C-15), a 515-bp (MAPA), and a 185-bp (BRI 3) DNA fragment corresponding to the original clone labeled with [ -32P]dCTP, using ready-to-go beads (Amersham
Pharmacia Biotech, Orsay, France).
Chromosomal localization Chromosomal localization of MAPA was performed with the Standford G3 RH medium resolution panel (Research Genetics, Huntsville, AL). PCR was as described above using oligonucleotides flanking a known intron (sense, CGAGAGCTTCCAGTGACCTTCT; antisense, CATGTTCTCATAGTCGGGAGTG). Results were scored manually, and analysis was performed with the Rhmapper program (http://shgc-www.stanford.edu).FACS analysis and immunostaining HSL2, HSL11, and HSL96 were kindly provided by Dr Karasuyama.26 HSL11 mAb and HSL96 mAb recognize -like
and V-pre-B proteins, respectively, whereas HSL2 mAb does not bind to
either component of the pre-BCR but binds only the completely assembled
pre-BCR complex. Anti-granzyme B-phycoerythrin (PE)-labeled antibody
(clone CLB-GB11) was from Research Diagnostics (INC, Flanders, NJ).
Eph-B1 goat polyclonal antibody generated against an intracytoplasmic peptide of Eph-B1 (M19:sc-9319) and its blocking peptide (sc-9319P) were from Santa Cruz Biotechnology (San Diego, CA). Cytospin slides were first stained with anti-Eph-B1, washed, incubated with secondary biotinylated antigoat antibody (Santa Cruz Biotechnology), and stained
by Vectastain ABC reagent (Vectastain ABC peroxidase kit; Vector
Laboratories, Burlingame, CA). Control slides were made with unrelated
antibody. Blocking peptide was added at the same time as antibody. For
intracytoplasmic stainings, cells were permeabilized with saponin
(0.1%) and paraformaldehyde (4%).
Genes identified by subtracted hybridization To identify genes specifically expressed in PDCs, a subtracted hybridization technique was applied because it combines normalization and subtraction in a single procedure.23,27 Thus, the resultant PCR products should represent restriction fragments of cDNA from PDCs absent, or at least rare, in MDDC used as competitor. PDC cDNA fragments were cloned (n = 736 clones), and clones with more than 300 bp cDNA insert were sequenced (n = 650), representing 80 different genes. Among these, 30% (n = 24 genes) were novel sequences. Three of these C-15, MAPA, and
BRI3 were retained for further analysis. Most of
the known genes were not previously associated with PDCs. Surprisingly,
approximately 25% of the sequences were for B-cell transcripts, such
as immunoglobulin and (2 of 12 clones rearranged) light chains,
the surrogate light chain,28 and the pentamer
immunoglobulin M (IgM)-joining component J chain (Table
1). They also included genes encoding for
cell surface molecules (CD62L, CD123/IL-3R , immunoglobulinlike
transcript ILT7, and receptor tyrosine kinase Eph-B1) and protein
kinases involved in signal transduction (such as Tyk2), MyD88 involved in the IL-1 receptor and TLR transduction pathways, enzymes (napsin, cathepsin B, scramblase), transcription factors (Spi-B, EIF3), and
genes involved in apoptosis (DR6, granzyme B) and migration (CXCR4)
(Table 1). The subtracted hybridization technique was not completely
efficient because some genes highly coexpressed in PDCs and
MDDCs were not totally subtracted (eg, major histocompatibility complex
class 2). In addition, 259 clones for which we were unable to identify
an open reading frame (ORF) were excluded from this analysis (Table 1,
miscellaneous).
Lymphoid-related gene expression in PDCs In a first set of experiments, we selected a panel of genes of immunological interest to verify by RT-PCR whether their expression pattern was restricted to PDCs. The same samples of cDNA were used for PDCs and MDDCs as those used as the starting material before subtraction. We confirmed that subtraction allowed us to amplify transcripts exclusively expressed in PDCs rather than in MDDCs such as CD62L, light chain, Spi-B, ILT7, and EphB1 and transcripts
preferentially expressed in PDCs such as surrogate light chain, J
chain, and granzyme B. However, genes such as CD123/IL-3R and CXCR4
were not eliminated during subtraction, even though they were
apparently equally expressed in the tester and the driver (Figure
1). CD62L is expressed at the protein
level on blood PDCs, whereas this protein is cleaved on PDC entry
through high endothelial venules in secondary lymphoid
organs.6 Thus, tonsil PDCs do not express CD62L at the
protein level, whereas our data indicated that CD62L mRNA is maintained
in PDCs and not expressed in MDDCs. Unlike the surface protein
expressed on PDCs but not on MDDCs, CD123/IL-3R mRNA was also
detected in MDDCs (Figure 1). Of note, the expression of CXCR4 in PDCs
is in agreement with their potent ability to respond to its ligand,
SDF-1.29 We also confirmed that PDCs expressed strong
levels of immunoglobulin transcripts, such as the light chain, the
J chain, and the surrogate light chain previously identified in
normal pre-B cells30 (Table 1, Figure 1). That this
expression was not caused by the presence of contaminating B cells
during preparation was assessed by the absence of transcripts for CD19
and VH-Cµ (Figure 1).
Even though we detected the expression of J chain and surrogate Among the known genes, we focused our attention on Spi-B, ILT7, Eph-B1,
and granzyme B, for which we found 8, 29, 4, and 64 clones,
respectively (Table 1). Spi-B, previously identified as a
lymphoid-restricted transcription factor,32 was uniquely expressed in PDCs (Figure 1). Moreover, unlike pre-T Expression of ILT7, Eph-B1, and granzyme B We then tested ILT7, Eph-B1, and granzyme B expression on different cell types and on PDCs and MDDCs at different stages of activation. For RT-PCR analysis presented in Figures 2-7, 8 and 10 different donors were used for tonsil PDCs and for MDDCs, respectively. These donors were not the same as those used for subtraction. ILT7 mRNA was highly expressed in PDCs but was rapidly down-regulated by IL-3 with or without CD40 activation (Figure 2). Except for PDCs, monocytes, and activated B lymphocytes, ILT7 mRNA was absent from the other cell types tested. Weak expression was observed on cDNA from thymus (not shown). In our hands, MDDCs (activated or not) did not express detectable levels of ILT7 mRNA in contrast to previous reports.33 ILT7 belongs to a family of ILT molecules that are highly homologous and functionally related to a group of NK cell receptors for HLA class 1 molecules. Because no antibodies specific for ILT7 were available, we could not ascertain whether PDC expressed ILT7 at their surfaces. ILT7 has a charged arginine amino acid in the transmembrane domain and a short cytoplasmic domain that is postulated to associate with the Fc R chain to transduce stimulatory signals.33 It
will thus be important to determine whether ILT7 can transduce an
activating stimulus in PDCs.
Receptor tyrosine kinase Eph-B1 mRNA was abundantly detected in PDCs whatever their stage of activation (Figure 3A). Eph receptors and their membrane-associated ligands (ephrins) mediate developmental vascular assembly and direct axonal guidance during central nervous system development.34-36 Weak mRNA expression was also observed in monocytes and at much lower intensity in MDDCs. B cells and CD34-derived DCs (activated or not) also expressed Eph-B1 mRNA. In addition, using a polyclonal antibody generated against an intracytoplasmic peptide of Eph-B1, we observed an expression on both permeabilized freshly isolated PDCs and nonactivated MDDCs by FACS analysis (Figure 3B). Eph-B1 protein labeling was further confirmed by immunohistochemistry on cytospins of PDCs and MDDCs and was specifically inhibited in the presence of Eph-B1 peptide (Figure 3C). Eph-B1 expression in PDCs was clearly seen in the cytoplasm of PDCs and in the dendritic pseudopods of activated PDCs. Granular staining within the nucleus was revealed in MDDCs (Figure 3C), but no staining was obtained using unrelated goat IgG (not shown). E-cadherin has been shown to be necessary for surface expression of certain EphR, whereas EphR remained perinuclear in cells that did not express E-cadherin.37 Thus, the differential staining for Eph-B1 in PDCs versus MDDCs might be related to the fact that PDCs, but not MDDCs, express E-cadherin.6 Activation of Eph receptors has been recently reported to regulate integrin-mediated cell adhesion,38,39 and it remains to be determined whether those receptors could be involved in the migratory process of PDCs. Regarding granzyme B mRNA, comparable high levels of mRNA were expressed in resting and activated PDCs, as observed in the positive control using activated T cells (Figure 4A). A faint band was observed in monocytes and activated MDDCs; however, expression was barely detectable in nonactivated MDDCs. In vitro CD34-derived DCs do not express granzyme B mRNA. Weak expression could be seen in resting T cells, B cells, and activated granulocytes (Figure 4A). Furthermore, we showed that freshly isolated PDCs expressed intracytoplasmic granzyme B protein by FACS analysis. Higher expression was seen after overnight activation in IL-3 and CD40 or at a greater level with IL-3 alone that reached the intensity observed on NK cells (not shown). Conversely, only weak intensity of granzyme B staining was always detected in monocytes or in nonactivated or CD40-activated MDDCs (Figure 4B). Granzyme B is usually codeposited with perforin in cytoplasmic granules contained in immune cellular effectors. The granule secretory pathway is one of the mechanisms by which NK cells or cytotoxic T lymphocytes exert their cellular toxicity. We have been unable to show the expression of perforin in PDCs; thus, the physiological role of granzyme B in PDCs remains to be established. Identification of a putative type 2 cell surface receptor, BRI3, expressed in PDCs Four sequences were found to be identical to BRI3, a recently identified receptor, formerly known as E25A or IMT2A, that encodes for a protein that shares homology with the mouse E25B and the chicken E3-16 proteins.40 The nucleotide sequence of this transcript is 1256 bp long and contains an ORF of 900 nt. pSORT predicted a type 2 transmembrane protein, C-terminal extracellular and N-terminal cytosolic, with an uncleaved signal anchor sequence (from approximately nt 57-74). A mouse homolog of BRI3 expressed in brain was identified in GenBank (accession number AB030199) encoding for a putative 312 aa. Protein alignments indicated that the human and mouse sequences shared approximately 91% homology at the amino acid level (not shown). Levels of expression by RT-PCR of human BRI3 were higher in PDCs than in MDDCs and monocytes, and a faint band could be observed in CD34-derived DCs (Figure 5A). In the different leukocyte populations, essentially only granulocytes expressed this mRNA. Northern blot analysis showed one band at approximately 2.1 kb that was strongly expressed in appendix, peripheral blood leukocytes, bone marrow, fetal liver, and, to a lesser extent, in spleen, lymph nodes, and thymus. In cancer cell lines, weak expression was found in melanoma (G361) and chronic leukemia (MOLT4) cell lines (Figure 5B). The BRI3 gene belongs to a family of type 2 transmembrane proteins containing at least 3 members (BRI1, BRI2, BRI3).40 They represent conserved proteins for which no known motifs can be detected but that are rich in tyrosine in the extracellular domain. Mutations in BRI2 have been associated with dementia illnesses similar to Alzheimer disease,41 whereas BRI1 appears to be developmentally regulated in chondrogenesis, osteogenesis, and T-cell development.40,42 The role of such genes, and eventually that of BRI3, might be to regulate the expression of molecules that could contribute to the interactions between PDCs and their stromal partners during PDC development.16Identification of C-15, a putative novel-secreted molecule C-15 was represented by 84 of 650 sequenced clones. Contiguous sequences were identified in GenBank dbEST by BLAST, leading to a putative complete nucleotide sequence of 728 bp that contained an ORF of 348 nt. pSORT predicted a secreted protein without a transmembrane domain but with a cleavable signal peptide. The deduced polypeptide of human C-15 was composed of 112 aa, including a 23-aa signal peptide, and it contained 16 cysteines, 15 of which were conserved in 115 aa of the predicted mouse homolog. This sequence was identified based on the alignment of more than 80 ESTs from GenBank, corresponding to the mouse ortholog of C-15. Alignments indicated that the mouse protein has 83% homology to the human protein at the amino acid level (Figure 6A). Human C-15 was expressed in PDCs and in monocytes but was weakly expressed in MDDCs. Expression of C-15 seemed to be down-regulated on activation, particularly in DCs generated in vitro from CD34 progenitors. The expression pattern of this gene was not restricted to DCs because all leukocyte populations tested expressed C-15 mRNA (Figure 6B). Northern blot analysis showed one major band at 0.7 kb, detected at extremely high levels, and 2 bands with higher molecular weights at approximately 4.4 and 7 kb in different organs of the immune system (spleen, lymph nodes, peripheral blood leukocytes, bone marrow, and, to a lesser extent, in thymus, appendix, and fetal liver) (Figure 6C). The 0.7-kb band corresponds to the predicted cDNA sequence, whereas the 2 other bands could represent nonspliced nuclear pre-mRNA. By homology to the human BAC clone AC073840, we could localize the C-15 gene to chromosome 4q13-4q21. The gene contains 5 exons, all of which obey the GT-AG U2-type splice rules43 (data not shown). This novel gene encodes a putative cytokine because it can be secreted and is expressed in different hematopoietic cells. It could also be a member of the defensinlike molecules given that defensins are a family of small peptides with 3 or 4 intramolecular cysteine disulfide bonds.44Identification of a novel member of the leucine-rich repeat family, MAPA MAPA was represented by 4 sequences. An additional group of 42 sequences was identified within the GenBank database, which allowed an extension of 823 bp 5' and 117 bp 3', leading to a nucleotide sequence that contained an ORF of 918 bp. The deduced polypeptide of human MAPA was composed of 305 aa. A mouse homolog was predicted from the ESTs W85307, BG276490, and AI430301 and was completed by analysis of the mouse genomic clone AC073795. Protein alignments indicated that the mouse and human sequences share 41% identity. We were also able to identify 7 ESTs (accession numbers: AW477641, AW668983, AW427493, AW632293, BE752242, BF600409, and BI540463) from Bos taurus that appear to encode an ortholog of MAPA (Figure 7A). The genomic structure of human MAPA could be predicted from the human BAC clone AC008397. The gene has 3 exons, 2 of which are coding exons (Figure 7B). Interestingly, like other members of the LRR family, the extracellular domain and the transmembrane domain are coded by a single exon. The mouse gene has a similar organization. The human gene spans 6464 bp because of the insertion of Alu-type repeats in intron 2, in contrast to the mouse gene, which is 3895 bp in length. By RT-PCR, human MAPA was expressed in PDCs and in MDDCs but down-regulated in CD40-activated MDDCs. Expression of MAPA also seemed to be down-regulated during the activation of DCs generated in vitro from CD34 progenitors. The expression pattern of this gene was not restricted to DCs because granulocytes, monocytes, and B lymphocytes expressed MAPA mRNA (Figure 7C). Northern blot analysis showed 2 bands of 2.2 and 2.6 kb in the different organs of the immune system (peripheral blood leukocytes, spleen, bone marrow, and, to a lesser extent, lymph nodes, fetal liver, and appendix but not in thymus) (Figure 7D). In human ESTs that corresponded to MAPA, most were not spliced for intron 1. This difference of 480 bp probably accounts for the 2 observed mRNAs. None of the cancer cell lines tested expressed human MAPA (data not shown). Localization of the human MAPA gene to chromosome 19p13.2 to 19p12, in a region known as the leukocyte-receptor cluster, was identified by homology to human BAC clone AC008397 and was confirmed by radiation hybrid mapping. The predicted protein has 4 leucine-rich repeats often associated with protein-protein interactions, and 2 tyrosine-based motifs, one for interaction with phosphatidylinositol-3 (PI3) kinase (YENM) and an immunoreceptor tyrosine-based activation motif (ITAM; YXXI/L (7/8) YXXI/L).33,45 To our knowledge, this is the first example of a leucine-rich repeat protein with an ITAM motif. Therefore, MAPA may represent a novel type of pattern-recognition receptor involved in the activation of cells of innate and acquired immunity.In conclusion, using a subtracted hybridization technique, we have identified (1) genes previously characterized but never described as expressed in PDCs (eg, lymphoid-related transcripts, Spi-B, Eph-B1, granzyme B), (2) novel genes that encode for putative proteins for which the functions on PDCs remain to be established (eg, BRI3), and (3) novel sequences for which exact functions are not yet established (eg, C-15, MAPA). This is the first report on a genomic PDC approach. In spite of the technical difficulties of working with human PDCs, we have been able to characterize genes whose expression pattern was restricted mainly to PDCs. We also found genes overexpressed in PDCs (activated or not) and absent in MDDCs (eg, Spi-B). These may provide further understanding of the biological function of PDCs in the host defense system and their origin.
Nucleotide sequences data have been submitted to the EMBL Nucleotide Sequence Database, and accession numbers have been assigned: Homo sapiens mRNA for C15 protein (AJ422147), Mus musculus mRNA for C15 protein (AJ422151), H sapiens mRNA for MAPA protein (AJ422148), M musculus mRNA for MAPA protein (AJ422149), and Bos taurus mRNA for MAPA protein (AJ422150). We thank the doctors and colleagues from hospitals and clinics in Lyon who provided us with tonsils and umbilical cord blood samples. We also thank Isabelle Durand for FACS sorting and Olivier Clear and Bernadette Michat for maintenance support. We thank Dr Pierre Garrone and Pr Giorgio Trinchieri for their comments on the manuscript and Dr Karasuyama for his generous gift of anti-pre-BCR antibodies.
Submitted March 1, 2002; accepted June 13, 2002.
Prepublished online as Blood First Edition Paper, July 5, 2002; DOI 10.1182/blood-2002-02-0638.
Supported by a grant from Fondation Marcel Mérieux, Lyon, France (N.B.-V.).
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Francine Brière, Laboratory for Immunological Research, Schering-Plough, 27 Chemin des Peupliers, BP11, 69571 Dardilly, France; e-mail: francine.briere{at}spcorp.com.
1. Steinman RM. The dendritic cell system and its role in immunogenicity. Annu Rev Immunol. 1991;9:271-296[CrossRef][Medline] [Order article via Infotrieve]. 2. Banchereau J, Brière F, Caux C, et al. Immunobiology of dendritic cells. Annu Rev Immunol. 2000;18:767-811[CrossRef][Medline] [Order article via Infotrieve]. 3. O'Doherty U, Peng M, Gezelter S, et al. Human blood contains two subsets of dendritic cells, one immunologically mature and the other immature. Immunology. 1994;82:487-493[Medline] [Order article via Infotrieve].
4.
Sorg RV, Kogler G, Wernet P.
Identification of cord blood dendritic cells as an immature CD11c- population.
Blood.
1999;93:2302-2307
5.
Grouard G, Rissoan MC, Filgueira L, Durand I, Banchereau J, Liu YJ.
The enigmatic plasmacytoid T cells develop into dendritic cells with IL-3 and CD40-ligand.
J Exp Med.
1997;185:1101-1111 6. Cella M, Jarrossay D, Facchetti F, et al. Plasmacytoid monocytes migrate to inflamed lymph nodes and produce large amounts of type I interferon. Nat Med. 1999;5:919-923[CrossRef][Medline] [Order article via Infotrieve].
7.
Bendriss-Vermare N, Barthélémy C, Durand I, et al.
Human thymus contains IFN
8.
Siegal FP, Kadowaki N, Shodell M, et al.
The nature of the principal type 1 interferon-producing cells in human blood.
Science.
1999;284:1835-1837
9.
Kadowaki N, Antonenko S, Liu YJ.
Distinct CpG DNA and polyinosinic-polycytidylic acid double-stranded RNA, respectively, stimulate CD11c- type 2 dendritic cell precursors and CD11c+ dendritic cells to produce type I IFN.
J Immunol.
2001;166:2291-2295
10.
Bauer M, Redecke V, Ellwart JW, et al.
Bacterial CpG-DNA triggers activation and maturation of human CD11c 11. Krug A, Rothenfusser S, Hornung V, et al. Identification of CpG oligonucleotide sequences with high induction of IFN-alpha/beta in plasmacytoid dendritic cells. Eur J Immunol. 2001;31:2154-2163[CrossRef][Medline] [Order article via Infotrieve].
12.
Kadowaki N, Antonenko S, Lau JY, Liu YJ.
Natural interferon alpha/beta-producing cells link innate and adaptive immunity.
J Exp Med.
2000;192:219-226
13.
Rissoan MC, Soumelis V, Kadowaki N, et al.
Reciprocal control of T helper cell and dendritic cell differentiation.
Science.
1999;283:1183-1186 14. Cella M, Facchetti F, Lanzavecchia A, Colonna M. Plasmacytoid dendritic cells activated by influenza virus and CD40L drive a potent TH1 polarization. Nat Immunol. 2000;1:305-310[CrossRef][Medline] [Order article via Infotrieve].
15.
Blom B, Ho S, Antonenko S, Liu YJ.
Generation of interferon alpha-producing predendritic cell (Pre-DC)2 from human CD34(+) hematopoietic stem cells.
J Exp Med.
2000;192:1785-1796
16.
Spits H, Couwenberg F, Bakker AQ, Weijer K, Uittenbogaart CH.
Id2 and Id3 inhibit development of CD34(+) stem cells into predendritic cell (pre-DC)2 but not into pre-DC1: evidence for a lymphoid origin of pre-DC2.
J Exp Med.
2000;192:1775-1784
17.
Sallusto F, Lanzavecchia A.
Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor alpha.
J Exp Med.
1994;179:1109-1118
18.
Caux C, Dezutter-Dambuyant C, Schmitt D, Banchereau J.
GM-CSF and TNF- 19. Weiss A, Wiskocil RL, Stobo JD. The role of T3 surface molecules in the activation of human T cells: a two-stimulus requirement for IL-2 production reflects events occurring at a pretranslational level. J Immunol. 1984;133:123-128[Abstract]. 20. Renard N, Harada N, Callet-Bauchu E, et al. Heterogeneity of the inhibitory effects of IL-4 in two novel lineage acute lymphoblastic leukemia cell lines. Leuk Res. 1997;21:1037-1046[CrossRef][Medline] [Order article via Infotrieve]. 21. Sundstrom C, Nilsson K. Establishment and characterization of a human histiocytic lymphoma cell line (U-937). Int J Cancer. 1976;17:565-577[Medline] [Order article via Infotrieve]. 22. Bates EEM, Ravel O, Dieu MC, et al. Identification and analysis of a novel member of the ubiquitin family expressed in dendritic cells and mature B cells. Eur J Immunol. 1997;27:2471-2477[Medline] [Order article via Infotrieve].
23.
Mueller CGF, Rissoan MC, Salinas B, et al.
PCR selects a novel disintegrin-proteinase from CD40-activated germinal center dendritic cells.
J Exp Med.
1997;186:655-663
24.
Altschul SF, Madden TL, Schaffer AA, et al.
Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res.
1997;25:3389-3402 25. Nakai K, Horton P. PSORT: a program for detecting sorting signals in proteins and predicting their subcellular localization. Trends Biochem Sci. 1999;24:34-36[CrossRef][Medline] [Order article via Infotrieve].
26.
Tsuganezawa K, Kiyokawa N, Matsuo Y, et al.
Flow cytometric diagnosis of the cell lineage and developmental stage of acute lymphoblastic leukemia by novel monoclonal antibodies specific to human pre-B-cell receptor.
Blood.
1998;92:4317-4324
27.
Diatchenko L, Lau YF, Campbell AP, et al.
Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries.
Proc Natl Acad Sci U S A.
1996;93:6025-6030
28.
Francés V, Pandrau-Garcia D, Guret C, et al.
A surrogate 15 kDa KC 29. Zou W, Machelon V, Coulomb-L'Hermin A, et al. Stromal-derived factor-1 in human tumors recruits and alters the function of plasmacytoid precursor dendritic cells. Nat Med. 2001;7:1339-1346[CrossRef][Medline] [Order article via Infotrieve].
30.
Thompson A, Timmers E, Kenter MJH, Kraakman MEM, Hendriks RW, Schuurman RKB.
Immunoglobulin
31.
Res PC, Couwenberg F, Vyth-Dreese FA, Spits H.
Expression of pT
32.
Chen HM, Zhang P, Voso MT, et al.
Neutrophils and monocytes express high levels of PU.1 (Spi-1) but not Spi-B.
Blood.
1995;85:2918-2928 33. Colonna M, Nakajima H, Cella M. A family of inhibitory and activating Ig-like receptors that modulate function of lymphoid and myeloid cells. Semin Immunol. 2000;12:121-127[CrossRef][Medline] [Order article via Infotrieve]. 34. Wang HU, Chen ZF, Anderson DJ. Molecular distinction and angiogenic interaction between embryonic arteries and veins revealed by ephrin-B2 and its receptor Eph-B4. Cell. 1998;93:741-753[CrossRef][Medline] [Order article via Infotrieve]. 35. Cheng HJ, Nakamoto M, Bergemann AD, Flanagan JG. Complementary gradients in expression and binding of ELF-1 and Mek4 in development of the topographic retinotectal projection map. Cell. 1995;82:371-381[CrossRef][Medline] [Order article via Infotrieve]. 36. Gale NW, Holland SJ, Valenzuela DM, et al. Eph receptors and ligands comprise two major specificity subclasses and are reciprocally compartmentalized during embryogenesis. Neuron. 1996;17:9-19[CrossRef][Medline] [Order article via Infotrieve]. 37. Orsulic S, Kemler R. Expression of Eph receptors and ephrins is differentially regulated by Ecadherin. J Cell Sci. 2000;113:1793-1802[Abstract].
38.
Huynh-Do U, Stein E, Lane AA, Liu H, Cerretti DP, Daniel TO.
Surface densities of ephrin-B1 determine EphB1-coupled activation of cell attachment through 39. Miao H, Burnett E, Kinch M, Simon E, Wang B. Activation of EphA2 kinase suppresses integrin function and causes focal-adhesion-kinase dephosphorylation. Nat Cell Biol. 2000;2:62-69[CrossRef][Medline] [Order article via Infotrieve]. 40. Vidal R, Calero M, Revesz T, Plant G, Ghiso J, Frangione B. Sequence, genomic structure and tissue expression of Human BRI3, a member of the BRI gene family. Gene. 2001;266:95-102[CrossRef][Medline] [Order article via Infotrieve]. 41. Vidal R, Frangione B, Rostagno A, et al. A stop-codon mutation in the BRI gene associated with familial British dementia. Nature. 1999;399:776-781[CrossRef][Medline] [Order article via Infotrieve].
42.
Kirchner J, Bevan MJ.
ITM2A is induced during thymocyte selection and T cell activation and causes downregulation of CD8 when overexpressed in CD4(+)CD8(+) double positive thymocytes.
J Exp Med.
1999;190:217-228 43. Burge CB, Padgett RA, Sharp PA. Evolutionary fates and origins of U12-type introns. Mol Cell. 1998;2:773-785[CrossRef][Medline] [Order article via Infotrieve].
44.
Hoover DM, Chertov O, Lubkowski J.
The structure of human beta-defensin-1: new insights into structural properties of beta-defensins.
J Biol Chem.
2001;276:39021-39026 45. Borges L, Cosman D. LIRs/ILTs/MIRs, inhibitory and stimulatory Ig-superfamily receptors expressed in myeloid and lymphoid cells. Cytokine Growth Factor Rev. 2000;11:209-217[CrossRef][Medline] [Order article via Infotrieve].
© 2002 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
D. A. Ngan, S. V. Vickerman, D. J. Granville, S. F. P. Man, and D. D. Sin The possible role of granzyme B in the pathogenesis of chronic obstructive pulmonary disease Therapeutic Advances in Respiratory Disease, June 1, 2009; 3(3): 113 - 129. [Abstract] [PDF] |
||||
![]() |
T. Matsui, J. E. Connolly, M. Michnevitz, D. Chaussabel, C.-I Yu, C. Glaser, S. Tindle, M. Pypaert, H. Freitas, B. Piqueras, et al. CD2 Distinguishes Two Subsets of Human Plasmacytoid Dendritic Cells with Distinct Phenotype and Functions J. Immunol., June 1, 2009; 182(11): 6815 - 6823. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Chauvin and R. Josien Dendritic Cells as Killers: Mechanistic Aspects and Potential Roles J. Immunol., July 1, 2008; 181(1): 11 - 16. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Marafioti, J. C. Paterson, E. Ballabio, K. K. Reichard, S. Tedoldi, K. Hollowood, M. Dictor, M.-L. Hansmann, S. A. Pileri, M. J. Dyer, et al. Novel markers of normal and neoplastic human plasmacytoid dendritic cells Blood, April 1, 2008; 111(7): 3778 - 3792. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Cho, K. Ishida, J. Chen, J. Ohkawa, W. Chen, S. Namiki, A. Kotaki, N. Arai, K.-i. Arai, and Y. Kamogawa-Schifter SAGE library screening reveals ILT7 as a specific plasmacytoid dendritic cell marker that regulates type I IFN production Int. Immunol., January 1, 2008; 20(1): 155 - 164. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Stary, C. Bangert, M. Tauber, R. Strohal, T. Kopp, and G. Stingl Tumoricidal activity of TLR7/8-activated inflammatory dendritic cells J. Exp. Med., June 11, 2007; 204(6): 1441 - 1451. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. G. Ledford, M. Kovarova, and B. H. Koller Impaired Host Defense in Mice Lacking ONZIN J. Immunol., April 15, 2007; 178(8): 5132 - 5143. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Pfaff, U. Fiedler, and H. G. Augustin Emerging roles of the Angiopoietin-Tie and the ephrin-Eph systems as regulators of cell trafficking J. Leukoc. Biol., October 1, 2006; 80(4): 719 - 726. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Tschopp, N. Spiegl, S. Didichenko, W. Lutmann, P. Julius, J. C. Virchow, C. E. Hack, and C. A. Dahinden Granzyme B, a novel mediator of allergic inflammation: its induction and release in blood basophils and human asthma Blood, October 1, 2006; 108(7): 2290 - 2299. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Cao, D. B. Rosen, T. Ito, L. Bover, M. Bao, G. Watanabe, Z. Yao, L. Zhang, L. L. Lanier, and Y.-J. Liu Plasmacytoid dendritic cell-specific receptor ILT7-Fc{varepsilon}RI{gamma} inhibits Toll-like receptor-induced interferon production J. Exp. Med., June 12, 2006; 203(6): 1399 - 1405. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Ito, H. Kanzler, O. Duramad, W. Cao, and Y.-J. Liu Specialization, kinetics, and repertoire of type 1 interferon responses by human plasmacytoid predendritic cells Blood, March 15, 2006; 107(6): 2423 - 2431. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Gautier, B. de Saint-Vis, B. Senechal, J.-J. Pin, E. E.M. Bates, C. Caux, F. Geissmann, and P. Garrone The Class 6 Semaphorin SEMA6A Is Induced by Interferon-{gamma} and Defines an Activation Status of Langerhans Cells Observed in Pathological Situations Am. J. Pathol., February 1, 2006; 168(2): 453 - 465. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Fuchs, M. Cella, T. Kondo, and M. Colonna Paradoxic inhibition of human natural interferon-producing cells by the activating receptor NKp44 Blood, September 15, 2005; 106(6): 2076 - 2082. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Trinite, C. Chauvin, H. Peche, C. Voisine, M. Heslan, and R. Josien Immature CD4-CD103+ Rat Dendritic Cells Induce Rapid Caspase-Independent Apoptosis-Like Cell Death in Various Tumor and Nontumor Cells and Phagocytose Their Victims J. Immunol., August 15, 2005; 175(4): 2408 - 2417. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Buzza, L. Zamurs, J. Sun, C. H. Bird, A. I. Smith, J. A. Trapani, C. J. Froelich, E. C. Nice, and P. I. Bird Extracellular Matrix Remodeling by Human Granzyme B via Cleavage of Vitronectin, Fibronectin, and Laminin J. Biol. Chem., June 24, 2005; 280(25): 23549 - 23558. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Garnache-Ottou, L. Chaperot, S. Biichle, C. Ferrand, J.-P. Remy-Martin, E. Deconinck, P. D. de Tailly, B. Bulabois, J. Poulet, E. Kuhlein, et al. Expression of the myeloid-associated marker CD33 is not an exclusive factor for leukemic plasmacytoid dendritic cells Blood, February 1, 2005; 105(3): 1256 - 1264. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. de Saint-Vis, C. Bouchet, G. Gautier, J. Valladeau, C. Caux, and P. Garrone Human dendritic cells express neuronal Eph receptor tyrosine kinases: role of EphA2 in regulating adhesion to fibronectin Blood, December 15, 2003; 102(13): 4431 - 4440. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Yu, H. Luo, Y. Wu, and J. Wu Mouse EphrinB3 Augments T-cell Signaling and Responses to T-cell Receptor Ligation J. Biol. Chem., November 21, 2003; 278(47): 47209 - 47216. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Tarte, F. Zhan, J. De Vos, B. Klein, and J. Shaughnessy Jr Gene expression profiling of plasma cells and plasmablasts: toward a better understanding of the late stages of B-cell differentiation Blood, July 15, 2003; 102(2): 592 - 600. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Yu, H. Luo, Y. Wu, and J. Wu Ephrin B2 Induces T Cell Costimulation J. Immunol., July 1, 2003; 171(1): 106 - 114. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Corcoran, I. Ferrero, D. Vremec, K. Lucas, J. Waithman, M. O'Keeffe, L. Wu, A. Wilson, and K. Shortman The Lymphoid Past of Mouse Plasmacytoid Cells and Thymic Dendritic Cells J. Immunol., May 15, 2003; 170(10): 4926 - 4932. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2002 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||