| |
|
|
|
|
|
|
|||
|
Prepublished online as a Blood First Edition Paper on August 15, 2002; DOI 10.1182/blood-2002-06-1869.
GENE THERAPY
From the Curriculum in Genetics and Molecular Biology,
University of North Carolina Gene Therapy Center, Department of
Pharmacology and Lineberger Comprehensive Cancer Center, University of
North Carolina, Chapel Hill; International Agency for Research on
Cancer, Lyon, France; and Istituto di Genetica e Biofisica
Adriano Buzzati Traverso-Consiglio Nazionale delle Ricerche, Naples,
Italy.
Mutations at nucleotides 654, 705, or 745 in intron 2 of the human
Using HeLa cell lines that model expression of thalassemic
To lay a foundation for in vivo studies, we chose to incorporate U7
constructs into integrating viral vectors, which can confer permanent
correction of the splicing defects in the ultimate target, the
hematopoietic stem cell (HSC). In this respect, the lentiviral vectors
appeared to be the obvious choice (for a review, see
Kafri22). The ability of these vectors to efficiently
transduce human and nonhuman HSCs without cytokine stimulation has been
demonstrated by a number of research groups.23,24
Lentiviral vector-transduced HSCs engrafted efficiently into
irradiated host bone marrow and maintained long-term transgene
expression in all hematopoietic lineages following primary and
secondary transplantation.25,26 More importantly,
lentiviral vectors have been used successfully to correct
genetic deficiencies by gene replacement in cellular models of Fanconi
anemia group C27 and chronic granulomatous disease
(CGD),28 as well as in a mouse model of
In this report, a modified U7 snRNA, either in the context of a plasmid
or a lentiviral vector, was used to correct aberrant splicing of
thalassemic pre-mRNA. This U7 snRNA was targeted not to the aberrant
splice sites but to a recently identified splicing enhancer sequence
located between them.29 This retargeting enhanced the
antisense effects of the snRNA. Transfection with U7 constructs as well
as transduction with a U7 lentiviral vector of HeLa cells modeling
IVS2-654, IVS2-705, and IVS2-745 thalassemic splicing mutations led to effective pre-mRNA repair and restoration of expression of full-length Cell lines
Erythroid progenitor cells
Recombinant plasmid constructs All the modified U7 snRNA genes contained their respective promoter and terminator sequences (Figure 1A). The modified U7.324 construct, in which the natural 18-nucleotide sequence complementary to the 3' processing site of histone pre-mRNA was replaced with a 24-nucleotide sequence (AUCAUUAUUGCCCUGAAAGAAAGA) antisense to the 3' cryptic splice site activated in intron 2 of IVS2-654 mutant -globin
gene, was described previously.18 In U7.623, this
antisense sequence was replaced with a 25-nucleotide sequence (UGUUAUUCUUUAGAAUGGUGCAAAG) antisense to position 623 of intron 2 of
-globin pre-mRNA.
pTKU7 plasmids, the lentivirus-derived constructs, carried the modified U7 inserts between the central polypurine track and the downstream long terminal repeat (LTR) of the pTK134 plasmid (T.K., unpublished plasmid; Figure 4). The forward orientation U7 lentivirus-derived plasmid (pTKU7.324) was constructed by inserting the 605 bp Ecl136/XbaI fragment, containing the entire modified U7 coding region of the snRNA, into Eco47/XbaI-cleaved pTK134. The reverse orientation U7 lentivirus-derived plasmids (pTKU7.324r, pTKU7.623r) were constructed by inserting the 765 bp PvuII/BamHI fragment into BamHI/HpaI-cleaved pTK134. Transfections For all transfection experiments, HeLa cells were plated 24 hours before treatment at 0.8 × 105 cells/mL in 2-cm2 wells. The cells were treated for 72 hours with plasmid (0.05, 0.1, 0.25, 0.5, 1 µg/mL) complexed with 2.5 µg/mL Lipofectamine 2000, as suggested by the supplier (Invitrogen, Carlsbad, CA).Production and assays of viral vector The lentiviral vector was produced by a transient 3-plasmid transfection as described.32,33 Briefly, 7.0 × 106 human kidney 293T cells were transfected by calcium phosphate precipitation with 5 µg of the pMDG envelope plasmid and 15 and 10 µg of the packaging ( NRF)34 and
vector plasmids, respectively. After 62 hours the conditioned medium
was harvested, centrifuged at low speed, and filtered through a
0.45-µm (pore size) filter. Vector titers were determined by
p24gag enzyme-linked immunosorbent assay (ELISA). Further
vector concentration was achieved by ultracentrifugation at
50 000g for 2 hours.
Lentiviral vector transduction HeLa cells were transduced with lentiviral vector particles containing 100 ng p24gag 24 hours after the cells had been seeded at 2 × 105 cells/2.5 mL in 9.6-cm2 wells. Cells were split on days 3, 7, 10, and 12. On day 12 a cell sample was removed for analysis. Mononuclear cells from peripheral blood were seeded 4.0 × 106 cells/mL in 2-cm2 wells and transduced for 5 hours on days 1 and 2 with lentiviral vector particles containing 8 µg p24gag in serum-free medium (SFM) composed of IMDM supplemented with 10% BIT 9500 serum substitute (Stem Cell Technologies). Following transduction, the SFM was supplemented with the culture media described above and replated in methylcellulose as described above.FACS and fluorescence microscopy For fluorescence-activated cell sorter analysis (FACS), transfected HeLa EGFP-654 and EGFP-705U cells were trypsinized and resuspended in media, whereas transduced cells were trypsinized and fixed with 4% paraformaldehyde, washed, and resuspended in media. Approximately 104 cells were subjected to analysis in a Becton Dickinson FACScan (San Jose, CA). Gating of side versus forward scatter allowed the exclusion of dead or abnormal cells from analysis. The remaining cells were used to generate semilog single variety histograms (EGFP intensity versus cell number). Total mean fluorescence of untreated samples was set to 101, and the brightest 2.5% of that sample constituted background fluorescence. Treated samples were analyzed in terms of the percentage of cells fluorescing above background and mean fluorescence intensity of cell populations. Fluorescence index (FI), that is, mean fluorescence intensity × percentage of cells fluorescing above background, was calculated. For fluorescence microscopy, bright-field and UV images were taken with an inverted Olympus microscope. Images were digitized and processed with Adobe Photoshop software.Isolation and analysis of -32P] deoxyadenosine
triphosphate (dATP) per sample at 18 cycles. Correction of
human IVS2-654, IVS2-705, and IVS2-745 -globin pre-mRNA splicing was
detected with forward and reverse primers spanning positions 21-43 of
exon 2 and positions 6-28 of exon 3, respectively, in -globin mRNA
(Figure 1B). The RT-PCR products were separated by electrophoresis on
nondenaturing 8% polyacrylamide gel and detected by autoradiography.
No product was detectable without the reverse transcription step.
Immunoblot analysis of hemoglobin The cultured mononuclear cells (1.5 × 106) were washed twice with phosphate-buffered saline (PBS), suspended in 20 µL hemolysate reagent, and centrifuged at 14 000 rpm to remove the cell membranes. Approximately 3 µL supernatant was applied on Titan III-H cellulose acetate strips (76 × 60 mm) alongside with standard hemoglobins. Electrophoresis was performed with Supre-Heme buffer, pH 8.2, at 350 V for 35 minutes. The electrophoresis protocol and the materials were from Helena Laboratories (Beaumont, TX). Protein bands were visualized by staining the cellulose acetate strip with 0.5% Ponceau S and destaining with 5% acetic acid. The strip was blocked for 1 hour in 5% solution of fat-free dry milk in PBS containing 0.1% Tween 20 and the hemoglobins were detected with polyclonal affinity-purified chicken antihuman hemoglobin IgG as primary antibody and rabbit antichicken horseradish peroxidase (HRP)-conjugated IgG as secondary antibody (Accurate, Westbury, NY), both at 1000-fold dilution in the blocking solution. The blots were also developed with an enhanced chemiluminescence detection system (Amersham, Piscataway, NJ) and fluorography.
Modification of EGFP-654 and EGFP-705U splicing by U7.623 snRNA A 4-bp insertion centered at position 623 of intron 2 of the -globin gene was found to prevent aberrant and restore correct splicing of IVS2-654 pre-mRNA. Presumably, this insertion disrupted a
sequence that in the context of the thalassemic mutation acted as a
splicing enhancer and promoted the inclusion of the exonlike sequence contained between the aberrant 3' and 5' splice sites (Figure
1A).29 Moreover, oligonucleotides antisense to
the IVS2-623 region corrected splicing of IVS2-654 pre-mRNA
approximately 50% more effectively than those targeted against the
aberrant 3' and 5' splice sites (data not shown). These results
prompted the generation of a U7 snRNA targeted against position 623 of
the -globin pre-mRNA (U7.623, Figure 1B). U7 snRNA has been used
previously as an effective antisense carrier by replacing the
18-nucleotide antihistone pre-mRNA sequence with a 24-nucleotide
sequence antisense to the cryptic 3' splice site.18
Initially, correction of aberrant splicing by U7.623 snRNA was tested
in a recently developed assay that uses EGFP as a read-out. In this
assay the coding region of EGFP is interrupted by intron 2 of the
Quantitative analysis of FACS data from 3 independent experiments
showed that the U7.623 construct was more effective than the previously
tested U7.324. The effects of the 2 constructs were sequence specific
because a U7 snRNA lacking the antisense sequence (U7SmOPT) had little
effect (Figure 2B and Table 1). The
U7.623 construct was also more effective than the U7.324 snRNA when
transfected in the EGFP-654 HeLa cells. Nevertheless, in these cells
the level of correction by all 3 constructs was lower than that seen in
the transfected EGFP-705U cell line (Table 1), indicating that EGFP-654
pre-mRNA might be less susceptible to modification of splicing by
antisense sequences than its 705U counterpart (see below and
"Discussion").30
-globin IVS2 mutant cells (Figure 3),
which more closely model the mutations found in -thalassemic
patients. In these cells, the correction of aberrant splicing was
assessed by RT-PCR of total RNA from transfected cells, using primers
that flank intron 2 of the -globin gene (Figure 1A). To increase
sensitivity as well as to ascertain linear response and quantifiable
ratio of PCR products obtained from aberrant and corrected -globin mRNAs, RT-PCR was carried out at low cycles and with
[ -32P]dATP. No product was detectable without the
reverse transcription step (not shown; see "Materials and Methods"
and Lacerra et al17 for more details).
U7.623 snRNA corrected splicing of all 3 thalassemic pre-mRNAs in a
dose-dependent fashion. As seen in EGFP cells, the Even though in IVS2-654 cells correctly spliced Correction of aberrant splicing by U7 lentiviral plasmids Figure 4 shows the structure of 3 U7 antisense lentiviral constructs in which the snRNA genes were inserted into the pTK134 plasmid (T.K., unpublished plasmid). The inserts were composed of the modified U7.324 and U7.623 genes and included the flanking promoter and terminator sequences. The U7.324 was inserted in forward and reverse orientations with respect to the viral LTRs (pTKU7.324 and pTKU7.324r), and the U7.623 only in reverse orientation (pTKU7.623r; see "Materials and methods"). The plasmids were transiently transfected into EGFP-654 and EGFP-705U HeLa cells and the effects quantitated by FACS analysis as described above.
Table 1 shows that transfection of HeLa EGFP IVS2-654 and IVS2-705U
cells with 0.25 µg pTKU7.324 yielded fluorescence indices of
18 ± 11 and 19 ± 12, respectively, which were 44- and 62-fold lower than those obtained in analogous experiments with the parent U7.324. To test if this loss of activity was caused by occlusion of U7
promoter by RNA polymerase II, which would elongate the full-length
transcript from the upstream LTR, the U7.324 was inserted in reverse
orientation (pTKU7.324r). This change in construction seemed promising
because other studies have shown effective expression of antisense
constructs inserted in the viral vectors in reverse orientation.35-37 Transfection of the cells with
pTKU7.324r increased correction about 11-fold higher for EGFP-654 and
19-fold for EGFP-705U cells (FIs, 194 ± 56 and 360 ± 58,
respectively). The U7 construct in reverse orientation targeted to the
623 sequence was even more effective, reaching FIs of 349 ± 58 and
576 ± 60. Note that even the latter construct was 3 times less
effective than its parent plasmid in both cell lines. The most
effective lentiviral construct, pTKU7.623r, was tested in HeLa cell
lines expressing IVS2-654, IVS2-705, and IVS2-745
Correction of pre-mRNA splicing in HeLa cells transduced with U7.623 lentiviral vector The pTKU7.623r construct was used to produce a lentiviral vector ("Materials and methods"), which was tested in EGFP-654, EGFP-705U, -globin IVS2-654, IVS2-705, and IVS2-745 cells. Note that in the
context of the self-inactivating lentiviral vector, in which the
endogenous promoter is inactivated after one round of reverse
transcription, the problem of transcriptional interference should be
eliminated. Of the HeLa EGFP-654 cells transduced with the lentiviral
vector, 97% fluoresced with a mean fluorescence intensity of 1116, resulting in an FI of 1086 (Figure 6A).
Transduction of EGFP-705U cells was less efficient (76%), with a lower
mean fluorescence of 914, resulting in an FI of 694. For both cell lines the FI of nontransduced cells was negligible. Fluorescence microscopy corroborated the results of FACS analysis (Figure
6B).
Transduction of HeLa cell lines expressing thalassemic pre-mRNAs showed
(Figure 6C) that the U7 lentiviral vector resulted in an increase in
correctly spliced products to about 3% of total in IVS2-654 cells
(lane 2), 17% in IVS2-705 (lane 5), and essentially complete in
IVS2-745 (lane 8). The IVS2-745 cell line transduced with the
lentiviral vector was maintained in continuous culture for 6 months.
Importantly, and as expected with the genome integrated viral
sequences, the RT-PCR analysis of the RNA after this period showed the
level of correction equal to that seen 2 weeks after transduction
(compare lanes 8 and 10). Similar results were seen with lentiviral
vector transduction of K562 cells stably expressing the Correction of IVS2-745 splicing in erythroid progenitor cells by U7.623 lentiviral vector The U7.623 lentiviral vector was applied to a therapeutically relevant target, the erythroid progenitor cells from a patient with IVS2-745/IVS2-1 thalassemia. Based on the results shown in Figure 6, this mutation was expected to be the easiest to correct, allowing the proof of principle for antisense RNA treatment of thalassemia to be established. Furthermore, the splicing of IVS2-745 pre-mRNA in human erythroid progenitor cells has been repaired by treatment of the cells with oligonucleotides targeted to the aberrant 3' splice site.17The mononuclear cells were isolated from the patient's blood and
cultured in the presence of Epo and SCF, conditions that promote
erythroid differentiation of stem cells and early
progenitors.17 The cells were transduced with U7.623
lentiviral vector on days 1 and 2 of culture and subsequently cultured
in methylcellulose medium containing growth factors ("Materials and
methods") for 12 days; at this time total RNA was analyzed by RT-PCR
(Figure 7A). As expected, in cells
transduced with a control viral vector in which the U7.623 gene was
replaced with the GFP gene (Figure 7A, lane 2), there was no increase
in the amount of correctly spliced
To test for hemoglobin synthesis, lysates of lentiviral
vector-transduced cells at day 12 of culture were separated by
electrophoresis on cellulose acetate and probed with polyclonal
antihemoglobin antibody. This analysis showed significant levels of
newly generated hemoglobin A (Hb A; Figure 7B). Quantitation of the
ratio of Hb A bands to Hb F (used as an internal control) showed that
the amount of Hb A in the patient cells transduced with the U7.623 lentiviral vector increased about 25-fold over that in cells transduced with the control GFP viral vector. This result is consistent with the
increase of
Previously, viral vector transfer of antisense RNAs has been used for down-regulation of gene expression (for a review, see Sazani et al38). Here we demonstrate that this strategy can be used to successfully restore expression of a gene inactivated by a splicing mutation. This novel application of the lentiviral vector-mediated antisense approach was achieved not only in cell line models but also in the clinically relevant erythroid progenitor cells from a patient with IVS2-745/IVS2-1 thalassemia. The fact that U7.623 snRNA (targeted downstream of the cryptic 3' splice site) is more effective in the correction of aberrant splicing than U7.324 targeted against the splice site itself implies the presence of a splicing enhancer at the target site.29 Splicing enhancers function as binding sites for SR proteins, a family of serine/arginine-rich essential splicing factors involved in regulation of alternative splicing (for a review, see Blencowe39). Presumably, antisense RNAs targeted against the 623 region prevented the binding of SR proteins and induced skipping of the aberrant pseudoexon.40 The modified U7 snRNAs were most efficient in the correction of
splicing of IVS2-745 pre-mRNA, followed by IVS2-705 and IVS2-654. Similar results have also been observed in correction of splicing of
these pre-mRNAs by antisense oligonucleotides targeted to the aberrant
3' and 5' splice sites.30 Here, these observations are
extended to antisense RNA that is targeted between the splice sites and
is expressed intracellularly. One concludes that the strength of the
aberrant 5' splice sites and the distance between the 3' and
5' splice sites flanking the internal exons determine the differences
in correction achieved in the 3 mutants. Because the HeLa IVS2-654 cell
line was relatively resistant to correction by the lentiviral vector,
these experiments were not attempted in the IVS2-654 Previous experiments with erythroid mononuclear cultures have
established that in the presence of Epo and SCF An important advantage of our antisense approach is that the correction
occurs in the The effects of the U7.623 snRNAs expressed by the lentiviral vector are expected to be limited only to cells that express the target sequence, that is, the erythroid precursor and progenitor cells. This is because hybridization of the U7.623 snRNA to other RNAs will occur with a number of mismatches, rendering the molecules ineffective.16 The fact that cell growth of cultured mononuclear cells was unaffected by lentiviral vector transduction shows that U7.623 RNA did not effect widespread inhibition of gene expression. Likewise, antisense oligonucleotides have been found relatively nontoxic in clinical trials and as a marketed drug.45 It was estimated that 15% of point mutations contributing to genetic diseases cause aberrant splicing.46 Recent results, which take into account not only genomic sequence but also RNA expression and splicing patterns, indicate that the percentage of splicing defects may be much higher. For example, when analyzed at the RNA level, 50% of mutations in the ataxia-telangiectasia and neurofibromatosis type 1 genes resulted in defective splicing.47,48 Thus, the antisense repair of defective pre-mRNAs can be applied to other disorders in addition to thalassemia syndromes. In fact, correction of pre-mRNA splicing by antisense oligonucleotides was investigated in the context of cystic fibrosis,49 Duchenne muscular dystrophy,50,51Alzheimerlike frontotemporal dementia and Parkinsonism associated with chromosome 17 (FTDP-17) syndrome,52 and spinal muscular atrophy.53 This method was also used for modification of alternative splicing by targeting a cancer-related splice variant of bcl-x pre-mRNA.20,54,56 The approach described here provides a way to effect permanent correction of the aberrant splicing that gives rise to disease by incorporating these and other antisense sequences into viral vectors.
We are grateful to the patients and their parents for donating blood samples. We thank Elizabeth Smith for technical assistance and Thipparat Suwanmanee for guidance in erythroid cell culture.
Submitted June 24, 2002; accepted July 30, 2002.
Prepublished online as Blood First Edition Paper, August 15, 2002; DOI 10.1182/blood-2002-06-1869.
Supported in part by grant HL-51940, National Heart, Lung, and Blood Institute, National Institutes of Health (R.K.) and grant DK-58702, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health (T.K.).
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Ryszard Kole, University of North Carolina, Lineberger Comprehensive Cancer Center, CB no. 7295, Chapel Hill, NC 27599; e-mail: kole{at}med.unc.edu, or Tal Kafri, University of North Carolina, Gene Therapy Center, Thurston-Bowles, CB no. 7352, Chapel Hill, NC 27599; e-mail: kafri{at}med.unc.edu.
1. Schwartz E, Benz EJ. Hematology: Basic Principles and Practice. In: Hoffman R,Benz EJ,Shattil SJ,Furie B,Cohen HJ, eds. Thalassemia Syndromes. New York, NY: Churchill Livingston; 1991:586-610. 2. Rund D, Rachmilewitz E. New trends in the treatment of beta-thalassemia. Crit Rev Oncol Hematol. 2000;33:105-118[Medline] [Order article via Infotrieve]. 3. Boulad F, Giardina P, Gillio A, et al. Bone marrow transplantation for homozygous beta-thalassemia. The Memorial Sloan-Kettering Cancer Center experience. Ann N Y Acad Sci. 1998;850:498-502[CrossRef][Medline] [Order article via Infotrieve]. 4. Lucarelli G, Galimberti M, Giardini C, et al. Bone marrow transplantation in thalassemia. The experience of Pesaro. Ann N Y Acad Sci. 1998;850:270-275[CrossRef][Medline] [Order article via Infotrieve].
5.
Olivieri NF, Weatherall DJ.
The therapeutic reactivation of fetal haemoglobin.
Hum Mol Genet.
1998;7:1655-1658 6. Sadelain M. Globin gene transfer for the treatment of severe hemoglobinopathies: a paradigm for stem cell-based gene therapy. J Gene Med. 2002;4:113-121[CrossRef][Medline] [Order article via Infotrieve]. 7. Tisdale J, Sadelain M. Toward gene therapy for disorders of globin synthesis. Semin Hematol. 2001;38:382-392[CrossRef][Medline] [Order article via Infotrieve]. 8. May C, Rivella S, Callegari J, et al. Therapeutic haemoglobin synthesis in beta-thalassaemic mice expressing lentivirus-encoded human beta-globin. Nature. 2000;406:82-86[CrossRef][Medline] [Order article via Infotrieve].
9.
May C, Rivella S, Chadburn A, Sadelain M.
Successful treatment of murine beta-thalassemia intermedia by transfer of the human beta-globin gene.
Blood.
2002;99:1902-1908 10. Sierakowska H, Gorman L, Kang SH, Kole R. Antisense oligonucleotides and RNAs as modulators of pre-mRNA splicing. Methods Enzymol. 2000;313:506-521[Medline] [Order article via Infotrieve].
11.
Chui DH, Hardison R, Riemer C, et al.
An electronic database of human hemoglobin variants on the World Wide Web.
Blood.
1998;91:2643-2644 12. Treisman R, Proudfoot NJ, Shander M, Maniatis T. A single-base change at a splice site in a beta 0-thalassemic gene causes abnormal RNA splicing. Cell. 1982;29:903-911[CrossRef][Medline] [Order article via Infotrieve].
13.
Cheng TC, Orkin SH, Antonarakis SE, et al.
beta-Thalassemia in Chinese: use of in vivo RNA analysis and oligonucleotide hybridization in systematic characterization of molecular defects.
Proc Natl Acad Sci U S A.
1984;81:2821-2825
14.
Dobkin C, Bank A.
Reversibility of IVS 2 missplicing in a mutant human beta-globin gene.
J Biol Chem.
1985;260:16332-16337
15.
Dominski Z, Kole R.
Restoration of correct splicing in thalassemic pre-mRNA by antisense oligonucleotides.
Proc Natl Acad Sci U S A.
1993;90:8673-8677
16.
Sierakowska H, Sambade MJ, Agrawal S, Kole R.
Repair of thalassemic human beta-globin mRNA in mammalian cells by antisense oligonucleotides.
Proc Natl Acad Sci U S A.
1996;93:12840-12844
17.
Lacerra G, Sierakowska H, Carestia C, et al.
Restoration of hemoglobin A synthesis in erythroid cells from peripheral blood of thalassemic patients.
Proc Natl Acad Sci U S A.
2000;97:9591-9596
18.
Gorman L, Suter D, Emerick V, Schumperli D, Kole R.
Stable alteration of pre-mRNA splicing patterns by modified U7 small nuclear RNAs.
Proc Natl Acad Sci U S A.
1998;95:4929-4934
19.
Suter D, Tomasini R, Reber U, Gorman L, Kole R, Schumperli D.
Double-target antisense U7 snRNAs promote efficient skipping of an aberrant exon in three human beta-thalassemic mutations.
Hum Mol Genet.
1999;8:2415-2423
20.
Gorman L, Mercatante DR, Kole R.
Restoration of correct splicing of thalassemic beta-globin pre-mRNA by modified U1 snRNAs.
J Biol Chem.
2000;275:35914-35919 21. Baserga SJ, Steitz JA. The diverse world of small ribonucleoproteins. In: Gesteland RF,Atkins JF, eds. The RNA World. Plainview, NY: Cold Spring Harbor Laboratory Press; 1993:359-382. 22. Kafri T. Lentivirus vectors: difficulties and hopes before clinical trials. Curr Opin Mol Ther. 2001;3:316-326[Medline] [Order article via Infotrieve].
23.
Uchida N, Sutton RE, Friera AM, et al.
HIV, but not murine leukemia virus, vectors mediate high efficiency gene transfer into freshly isolated G0/G1 human hematopoietic stem cells.
Proc Natl Acad Sci U S A.
1998;95:11939-11944
24.
Case SS, Price MA, Jordan CT, et al.
Stable transduction of quiescent CD34(+)CD38(
25.
Chen W, Wu X, Levasseur DN, et al.
Lentiviral vector transduction of hematopoietic stem cells that mediate long-term reconstitution of lethally irradiated mice.
Stem Cells.
2000;18:352-359 26. Douglas JL, Lin WY, Panis ML, Veres G. Efficient human immunodeficiency virus-based vector transduction of unstimulated human mobilized peripheral blood CD34+ cells in the SCID-hu Thy/Liv model of human T cell lymphopoiesis. Hum Gene Ther. 2001;12:401-413[CrossRef][Medline] [Order article via Infotrieve]. 27. Yamada K, Olsen JC, Patel M, Rao KW, Walsh CE. Functional correction of Fanconi anemia group C hematopoietic cells by the use of a novel lentiviral vector. Mol Ther. 2001;3:485-490[CrossRef][Medline] [Order article via Infotrieve]. 28. Saulnier SO, Steinhoff D, Dinauer MC, et al. Lentivirus-mediated gene transfer of gp91phox corrects chronic granulomatous disease (CGD) phenotype in human X-CGD cells. J Gene Med. 2000;2:317-325[CrossRef][Medline] [Order article via Infotrieve]. 29. Gemignani F, Landi S, DeMarini DM, Kole R. Spontaneous and MNNG-induced reversion of an EGFP construct in HeLa cells: an assay for observing mutations in living cells by fluorescent microscopy. Hum Mutat. 2001;18:526-534[CrossRef][Medline] [Order article via Infotrieve]. 30. Sierakowska H, Sambade MJ, Schumperli D, Kole R. Sensitivity of splice sites to antisense oligonucleotides in vivo. RNA. 1999;5:369-377[Abstract].
31.
Sazani P, Kang SH, Maier MA, et al.
Nuclear antisense effects of neutral, anionic and cationic oligonucleotide analogs.
Nucleic Acids Res.
2001;29:3965-3974 32. Naldini L, Blomer U, Gallay P, et al. In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science. 1996;272:263-267[Abstract].
33.
Kafri T, van Praag H, Ouyang L, Gage FH, Verma IM.
A packaging cell line for lentivirus vectors.
J Virol.
1999;73:576-584 34. Xu K, Ma H, McCown TJ, Verma IM, Kafri T. Generation of a stable cell line producing high-titer self-inactivating lentiviral vectors. Mol Ther. 2001;3:97-104[CrossRef][Medline] [Order article via Infotrieve].
35.
Sun LQ, Pyati J, Smythe J, et al.
Resistance to human immunodeficiency virus type 1 infection conferred by transduction of human peripheral blood lymphocytes with ribozyme, antisense, or polymeric trans-activation response element constructs.
Proc Natl Acad Sci U S A.
1995;92:7272-7276 36. Vandendriessche T, Chuah MK, Chiang L, Chang HK, Ensoli B, Morgan RA. Inhibition of clinical human immunodeficiency virus (HIV) type 1 isolates in primary CD4+ T lymphocytes by retroviral vectors expressing anti-HIV genes. J Virol. 1995;69:4045-4052[Abstract]. 37. Mautino MR, Morgan RA. Potent inhibition of human immunodeficiency virus type 1 replication by conditionally replicating human immunodeficiency virus-based lentiviral vectors expressing envelope antisense mRNA. Hum Gene Ther. 2000;11:2025-2037[CrossRef][Medline] [Order article via Infotrieve]. 38. Sazani P, Vacek M, Kole R. Modulation of gene expression by antisense therapeutics. Curr Opin Biotechnol. 2002;13:468-472[CrossRef][Medline] [Order article via Infotrieve]. 39. Blencowe BJ. Exonic splicing enhancers: mechanism of action, diversity and role in human genetic diseases. Trends Biochem Sci. 2000;25:106-110[CrossRef][Medline] [Order article via Infotrieve].
40.
Liu HX, Chew SL, Cartegni L, Zhang MQ, Krainer AR.
Exonic splicing enhancer motif recognized by human SC35 under splicing conditions.
Mol Cell Biol.
2000;20:1063-1071
41.
Lewis J, Yang B, Kim R, et al.
A common human beta globin splicing mutation modeled in mice.
Blood.
1998;91:2152-2156
42.
Suwanmanee T, Sierakowska H, Lacerra G, et al.
Restoration of human beta-globin gene expression in murine and human IVS2-654 thalassemic erythroid cells by free uptake of antisense oligonucleotides.
Mol Pharmacol.
2002;62:545-553 43. Papayannoupoulou T, Abkowitz J, D'Andrea A. Biology of erythropoiesis, erythroid differentiation, and maturation. In: Hoffman R,Benz EJ,Shattil SJ,Furie B,Cohen HJ, eds. Hematology: Basic Principles and Practice. New York, NY: Churchill Livingstone; 2000:202-219. 44. Yesilipek MA, Hazar V, Kupesiz A, Kizilors A, Uguz A, Yegin O. Peripheral blood stem cell transplantation in children with beta-thalassemia. Bone Marrow Transplant. 2001;28:1037-1040[CrossRef][Medline] [Order article via Infotrieve]. 45. Crooke ST. Basic principles of antisense technology. In: Crooke ST, ed. Antisense Drug Technology: Principles, Strategies and Applications. New York, NY: Marcel Dekker; 2001:1-28. 46. Krawczak M, Smith-Sorensen B, Schmidtke J, Kakkar VV, Cooper DN, Hovig E. Somatic spectrum of cancer-associated single basepair substitutions in the TP53 gene is determined mainly by endogenous mechanisms of mutation and by selection. Hum Mutat. 1995;5:48-57[CrossRef][Medline] [Order article via Infotrieve]. 47. Teraoka SN, Telatar M, Becker-Catania S, et al. Splicing defects in the ataxia-telangiectasia gene, ATM: underlying mutations and consequences. Am J Hum Genet. 1999;64:1617-1631[CrossRef][Medline] [Order article via Infotrieve].
48.
Ars E, Serra E, Garcia J, et al.
Mutations affecting mRNA splicing are the most common molecular defects in patients with neurofibromatosis type 1.
Hum Mol Genet.
2000;9:237-247
49.
Friedman KJ, Kole J, Cohn JA, Knowles MR, Silverman LM, Kole R.
Correction of aberrant splicing of the cystic fibrosis transmembrane conductance regulator (CFTR) gene by antisense oligonucleotides.
J Biol Chem.
1999;274:36193-36199 50. Wilton SD, Lloyd F, Carville K, et al. Specific removal of the nonsense mutation from the mdx dystrophin mRNA using antisense oligonucleotides. Neuromuscul Disord 1999;9:330-338[CrossRef][Medline] [Order article via Infotrieve].
51.
Mann CJ, Honeyman K, Cheng AJ, et al.
Antisense-induced exon skipping and synthesis of dystrophin in the mdx mouse.
Proc Natl Acad Sci U S A.
2001;98:42-47
52.
Kalbfuss B, Mabon SA, Misteli T.
Correction of alternative splicing of tau in frontotemporal dementia and parkinsonism linked to chromosome 17.
J Biol Chem.
2001;276:42986-42993
53.
Lim SR, Hertel KJ.
Modulation of survival motor neuron pre-mRNA splicing by inhibition of alternative 3' splice site pairing.
J Biol Chem.
2001;276:45476-45483 54. Taylor JK, Zhang QQ, Wyatt JR, Dean NM. Induction of endogenous Bcl-xS through the control of Bcl-x pre-mRNA splicing by antisense oligonucleotides. Nat Biotechnol. 1999;17:1097-1100[CrossRef][Medline] [Order article via Infotrieve]. 55. Grimm C, Stefanovic B, Schumperli D. The low abundance of U7 snRNA is partly determined by its Sm binding site. EMBO J. 1993;12:1229-1238[Medline] [Order article via Infotrieve].
56.
Mercatante DR, Bortner CD, Cidlowski JA, Kole R.
Modification of alternative splicing of Bcl-x pre-mRNA in prostate and breast cancer cells; analysis of apoptosis and cell death.
J Biol Chem.
2001;276:16411-16417
© 2003 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
S.-Y. Xie, Z.-R. Ren, J.-Z. Zhang, X.-B. Guo, Q.-X. Wang, S. Wang, D. Lin, X.-L. Gong, W. Li, S.-Z. Huang, et al. Restoration of the balanced {alpha}/{beta}-globin gene expression in {beta}654-thalassemia mice using combined RNAi and antisense RNA approach Hum. Mol. Genet., November 1, 2007; 16(21): 2616 - 2625. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Rund and E. Rachmilewitz {beta}-Thalassemia N. Engl. J. Med., September 15, 2005; 353(11): 1135 - 1146. [Full Text] [PDF] |
||||
![]() |
A. Goyenvalle, A. Vulin, F. Fougerousse, F. Leturcq, J.-C. Kaplan, L. Garcia, and O. Danos Rescue of Dystrophic Muscle Through U7 snRNA-Mediated Exon Skipping Science, December 3, 2004; 306(5702): 1796 - 1799. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2003 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||