Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
Prepublished online as a Blood First Edition Paper on June 28, 2002; DOI 10.1182/blood-2002-04-1088.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2002-04-1088v1
101/1/305    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Aliberti, J.
Right arrow Articles by Sher, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Aliberti, J.
Right arrow Articles by Sher, A.
Related Collections
Right arrow Immunobiology
Right arrow Phagocytes
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, 1 January 2003, Vol. 101, No. 1, pp. 305-310

PHAGOCYTES

Essential role for ICSBP in the in vivo development of murine CD8alpha + dendritic cells

Julio Aliberti, Oliver Schulz, Daniel J. Pennington, Hideki Tsujimura, Caetano Reis e Sousa, Keiko Ozato, and Alan Sher

From the Immunobiology Section, Laboratory of Parasitic Diseases, National Institute of Allergy and Infectious Diseases (NIAID), and Laboratory of Molecular Growth Regulation, National Institute of Child Health and Human Development (NICHD), National Institutes of Health, Bethesda, MD; and Immunobiology and Lymphocyte Molecular Biology Laboratories, Cancer Research United Kingdom, London Research Institute, London, United Kingdom.


    Abstract
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Interferon (IFN) consensus sequence-binding protein (ICSBP) is an important transcription factor regulating proinflammatory cytokine production and the development of mononuclear phagocytes in vitro. Here we analyzed the role of ICSBP in the in vivo differentiation of 3 major subsets of murine dendritic cells (DCs). We found that ICSBP is predominantly expressed by the CD8alpha + subset, and more important, that ICSBP-/- mice have a profound and selective deficiency in CD8alpha + DEC205+ DCs in lymphoid tissues. Studies using wild-type/ICSBP-/- chimeras revealed that this defect in CD8alpha + DC development is intrinsic to bone marrow-derived progenitors and not dependent on ICSBP expression in the nonhemopoietic compartment. Because DC precursor frequencies are unaltered in the bone marrow of ICSBP-/- mice, ICSBP appears to function by regulating CD8alpha + DC differentiation downstream from the generation of common DC progenitors. Although CD8alpha - DCs are present in normal numbers in ICSBP-/- animals, up-regulation of CD40, CD80, and major histocompatibility complex (MHC) class II expression was found to be impaired in this subset after in vivo microbial stimulation. Together these results demonstrate that ICSBP is critically required for the in vivo differentiation of CD8alpha + DCs and may also influence the functional maturation of the CD8alpha - subsets. (Blood. 2003;101:305-310)

© 2003 by The American Society of Hematology.

    Introduction
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Dendritic cells (DCs) are thought to exert a pivotal role in the induction of antigen-specific immune responses.1 Recent studies have demonstrated that the functional diversity of DCs can be attributed in part to the existence of distinct subsets of this important class of antigen-presenting cells.2 Murine DCs have been classified into 3 major subsets (CD8alpha +CD4-, CD8alpha -CD4+, and CD8alpha -CD4-) based on their expression of the surface markers CD4 and CD8alpha . It was originally thought that these cells represent distinct ontogenetic lineages with CD8alpha + DCs deriving from "lymphoid" progenitors and CD4+ and double-negative (DN) cells arising from a distinct set of "myeloid" precursors.3 This concept of dual lineages for DC development has recently been overturned by a series of reports demonstrating that all 3 subsets can be generated from either common myeloid or common lymphoid progenitors.4,5 It has also been suggested that different DC subsets represent no more than stages of DC differentiation rather than distinct lineages.6 At present, the nature of the factors that regulate murine DC subset differentiation are poorly understood and their delineation remains an important area of investigation in DC biology.

A major issue raised by the existence of distinct populations of DCs concerns whether these subsets possess distinct immunologic functions or whether their function is determined largely by environmental cues.7 CD8alpha + DCs are thought to be closely associated with the induction of cell-mediated immunity. Thus, cells belonging to this subset preferentially produce the cytokine interleukin 12 (IL-12) on stimulation with a number of microbial agents such as bacterial lipopolysaccharide (LPS),8 bacterial CpG-containing oligonucleotides,9 and Toxoplasma gondii soluble tachyzoite antigen (STAg)10 known to promote potent TH1 responses. Moreover, on in vivo transfer, antigen-pulsed CD8alpha + DCs induced CD4+ T cells with a TH1 cytokine profile, while similarly treated CD8alpha - DCs promoted a TH2-dominated response.11 In addition, the CD8alpha + subset has been shown to play a preferential role in the induction of cytotoxic T cells by cross-priming.12 However, this association of CD8alpha + DCs with the induction of cell-mediated immunity is not absolute because additional evidence indicates that under some circumstances some CD8alpha - DCs can produce IL-12 and induce TH1 responses.13

In the present study, we have investigated host factors that control the differentiation of CD8alpha + DCs in vivo. Our approach was to isolate CD8alpha + and CD8alpha - DCs from mouse spleen and to screen by representational difference analysis (RDA) for genes expressed uniquely in the CD8alpha + subset. One gene that showed a preferential association with CD8alpha + DCs was that encoding interferon consensus sequence binding protein (ICSBP), a member of the interferon regulatory factor (IRF) gene family. Interestingly, this transcription factor had previously been shown to play a preferential role in the induction of IL-12p40 expression in macrophages and spleen cells stimulated with microbial products and to be essential for IL-12-dependent host resistance to both T gondii and Leishmania major.14-16 Thus, ICSBP controls a cytokine preferentially expressed by CD8alpha + DCs. We now demonstrate that this same transcription factor is critical for the development of CD8alpha + DCs in vivo.


    Materials and methods
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Animals

Male and female ICSBP-/- mice17 backcrossed for 7 generations onto a C57Bl/6 background were generated by heterozygote mating. Wild-type littermates from the same breeding were used as controls. All mice were bred and maintained in a shared NIAID/NICHD (Association for the Assessment and Accreditation of Laboratory Animal Care [AALAC] accredited) animal facility under pathogen-free conditions and used in experiments at 4 to 7 weeks of age.

FACS staining and immunohistochemistry

Cell suspensions from lymphoid organs were obtained as previously described for splenic DC purification.18 Briefly, lymphoid organs (spleen, lymph nodes, Peyer patches, and thymus) were harvested and incubated with a solution containing Liberase CI (Roche Biochemicals, Indianapolis, IN) for 30 minutes at 37°C. After incubation tissues were forced through a 100-µm cell strainer and washed with 5 mM phosphate-buffered saline-ethylenediaminetetraacetic acid (PBS-EDTA). Cells were resuspended in 30% PBS-bovine serum albumin (PBS-BSA; 1 mL/spleen) covered with 1 mL PBS and centrifuged (9500g) for 15 minutes at 4°C. The interface was collected and washed with PBS. The resulting cell suspensions were incubated with anti-DEC205-fluorescein isothiocyanate (FITC; Cedar Lane laboratories, Hornby, ON, Canada), anti-CD11c-phycoerythrin (PE; Becton Dickinson, San Diego, CA), anti-CD4-peridinin chlorophyll protein (PerCP; Becton Dickinson) and anti-CD8alpha -allophycocyanin (APC; Becton Dickinson) for 30 minutes at 4°C. Cells were then washed and acquired in a fluorescence-activated cell sorter (FACS Calibur; Becton Dickinson). Flow cytometry analysis was performed using FlowJo software (Tree Star, San Carlos, CA). The distribution of DCs in spleen before and after LPS injection was assessed by staining of frozen sections using biotin-conjugated monoclonal antibody (mAb) anti-CD11c (Becton Dickinson) as previously described.18

Semiquantitative reverse transcription-polymerase chain reaction

Total RNA was isolated from sorted DC subset samples using the RNeasy mini kit (Qiagen, Crawley, United Kingdom) combined with a DNA digestion step (DNAse set, Qiagen). Single-stranded cDNA was synthesized using the SuperScript preamplification system (Gibco BRL, Paisley, United Kingdom) and polymerase chain reaction (PCR) was carried out according to standard protocols on a PTC-100 thermal cycler (MJ Research, Watertown, MA). PCR products were electrophoresed on 1.5% agarose gels and visualized by ethidium bromide staining. The following primer pairs were used: beta -actin: forward: GTTTGAGACCTTCAACACCCC, reverse: GTGGCCATCTCCTGCTCGAAGTC, product size 320 base pair (bp); ICSBP: forward: TCAGCTTTCTCCCAGATGGT, reverse: TAGAATTGCTGCAGCTCTCG, product size 403 bp.

Bone marrow chimeras

Bone marrow from tibia and femurs of wild-type (B6.SJL CD45.1) or ICSBP-/- (CD45.2) mice were recovered by flushing with PBS-EDTA and dissociated by repeated passage through a 20-gauge needle. The resulting cell suspensions were counted and 1:1 mixtures of wild-type and ICSBP-/- cells prepared. The donor mixtures were then injected intravenously into previously irradiated (900 rad) wild-type or ICSBP-/- recipients at a dose of 1 × 106 cells/mouse (0.2 mL). After 8 weeks the animals were killed and spleen cell suspensions prepared for DC subset analysis. To determine the donor origin of the DCs, cells were labeled with anti-CD45.2-FITC (Becton Dickinson), anti-CD11c-PE, anti-CD8alpha -PerCP, and CD45.1-biotin (Becton Dickinson) followed by streptavidin-APC (Becton Dickinson) and subjected to FACS analysis.

Bone marrow precursor analysis

Quantitation of hematopoietic stem cell (HSC), common myeloid precursor (CMP), and common lymphoid precursor (CLP) in bone marrow was performed using a published protocol.4 For depletion of lineage-positive (Lin+) cells, bone marrow cell suspensions (prepared as described in "Bone marrow chimeras") were incubated with anti- Ter-192 biotin, anti-CD11b biotin, anti-B220 biotin, anti-CD3epsilon biotin, anti-Ly6G biotin (all from Becton Dickinson) for 30 minutes at 4°C. Cells were then washed and labeled with streptavidin-conjugated magnetic beads (Miltenyi Biotec, Auburn, CA). After further washing with 5 mM PBS-EDTA, Lin+ cells were depleted using a negative-selection column (Miltenyi Biotec). The Lin- cells were then incubated with anti-CD90-FITC (Becton Dickinson), anti-CD127-PE (Becton Dickinson), anti-Sca-1-tetrahodamine isothiocyanate (TRITC; Caltag, Burlingame, CA) and anti-CD117-APC (Becton Dickinson) for HSC and CLP analysis. For CMP analysis a sample of bone marrow suspension was depleted of Lin+ cells (except for those carrying the CD11b marker) and incubated with anti-CD34-FITC (Becton Dickinson), anti-CD16/32-PE (Becton Dickinson), anti-Sca-1-TRITC (Caltag), and anti-CD117-APC (Becton Dickinson). FACS analysis was then performed as described above. The population with the phenotype CD117+Sca-1+CD90+CD127-Lin- was designated as HSC; CD117+Sca-1+CD127+Lin- as CLP, and CD117+CD34+CD16/32loSca-1- as CMP. Absolute cell numbers were determined by reference to the total cells in the starting bone marrow populations.

DC functional response assays

Wild-type and ICSBP-/-animals were injected intraperitoneally with PBS or 1 µg Oligo-CpG-DNA 166819 or Escherichia. coli LPS and 6 hours later spleens harvested and low-density (LOD) cells purified as described above. The resulting populations were labeled with anti-CD40-FITC or anti-CD80-FITC or anti-I-A-FITC and with anti-CD11c-PE, anti-CD8alpha -PerCP as well as anti-CD4-APC. The cells were acquired using a FACS Calibur and analyzed using FlowJo software.


    Results
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

ICSBP is preferentially expressed by the murine CD8alpha +CD4-CD11c+ DC subset

To study ICSBP expression by different DC subsets CD8alpha +CD11c+ and CD8alpha -CD11c+ cells were isolated from spleen by FACS; cDNA was prepared and subjected to RDA20 using CD8alpha + DC cDNA as tester and CD8alpha - DC cDNA as driver (D.J.P. et al, unpublished data). Cloning and sequencing of one of the bands from the sample containing CD8alpha + DC-specific cDNA revealed that it corresponded to nucleotides 98-461 of murine ICSBP (data not shown). Expression of ICSBP mRNA in CD8alpha + DCs was confirmed by reverse transcription-PCR (RT-PCR) with specific primers (Figure 1A). ICSBP message was also found to a lesser extent in DN DCs but was absent from CD4+ DCs, which represent most CD8alpha - cells (Figure 1A). Intracellular staining for ICSBP on CD11c+ DCs further revealed a unique subpopulation of cells expressing the transcription factor (Figure 1B). As expected, these cells were absent in DCs derived from ICSBP-/- animals (Figure 1B). Further analysis confirmed that the ICSBP+ subpopulation detected in wild-type mice corresponds to CD8alpha + DCs (Figure 1C).


View larger version (16K):
[in this window]
[in a new window]
 
Figure 1. Selective constitutive expression of ICSBP in CD8alpha +CD11c+ DCs. (A) Murine splenic CD11c+CD4+CD8alpha - (CD4), CD11c+CD4-CD8alpha + (CD8), and CD11c+CD4-CD8alpha - (DN) cells were sorted, mRNA extracted, and RT-PCR performed using ICSBP- and beta -actin-specific probes. PCR products were resolved by electrophoresis on agarose gels and products visualized by ethidium bromide staining. (B) Wild-type (+/+) or ICSBP-/- (-/-) splenic CD11c+ or CD3+ cells were purified by positive selection using CD11c- or CD3-conjugated magnetic beads. The resulting cells were then permeabilized, labeled with anti-ICSBP, and analyzed by FACS. (C) Wild-type CD11c+ spleen cells were obtained as in panel B and stained with CD8alpha +, permeabilized, and incubated with isotype-control or anti-ICSBP. Contour plots represent CD8alpha versus ICSBP or control-isotype expression; numbers represent the event frequency of the quadrant. Experiments were performed using at least 5 animals per group and are representative of at least 2 independent experiments.

ICSBP-deficient mice display a systemic and selective loss of the CD8alpha +DEC205+CD11c+ subset of DCs

Because of its selective expression in CD8alpha + DCs, we asked whether ICSBP might have a role in the development of this DC subset. A phenotypic analysis of splenic low-density cells enriched for DCs revealed a dramatic (> 94%) deficiency in CD8alpha +CD11c+ double-positive cells (Figure 2A) in ICSBP-/- mice versus wild-type littermates. Although this finding suggested that ICSBP selectively directs CD8alpha + DC development, it was possible that the gene instead preferentially regulates the expression of the CD8alpha molecule on the same cells. To rule out this hypothesis we examined the expression of a second marker, DEC205, selectively expressed by CD8alpha + DCs under resting conditions.21 Consistent with our previous observation, the frequency of DEC205+CD11c+ cells was profoundly reduced in spleens of ICSBP-/- mice versus littermate controls (Figure 2B). In contrast, no significant changes in the frequencies of CD8alpha - populations (CD4+ and DN) were observed in ICSBP-/- mice (Figure 2C). Moreover, the CD8alpha - DCs arising in the ICSBP-/- mice showed normal expression of CD11b and were indistinguishable from wild-type DCs in their morphology (Figure 2D,E). To determine whether these findings reflect a systemic defect in CD8alpha + DC development in ICSBP-/- animals, we determined the frequency of this subset in other lymphoid tissues (thymus, inguinal, axillary and mesenteric lymph nodes, and Peyer patches) where CD8alpha + DCs are generally found. The tissues from ICSBP-/- mice displayed marked reductions of 60% or greater in the levels of CD8alpha +DEC205+CD11c+ cells detected without major changes in the proportion of CD4+ and DN populations present (Figure 2F). Interestingly, despite the fact that Langerhans cells have been suggested to share a common lineage with CD8alpha + DCs, their numbers were not reduced in the skin of ICSBP-/- mice (S. Stol, personal communication, 2001). Together the above findings suggest that ICSBP plays a critical and selective role in the development of CD8alpha + DCs in vivo.


View larger version (60K):
[in this window]
[in a new window]
 
Figure 2. ICSBP-deficient mice present a systemic and selective loss of CD11c+CD8alpha +DEC205+ DCs. (A) CD8alpha and CD11c staining in low-density (LOD) mouse spleen cells from wild-type (left panels, +/+) or ICSBP-/- (right panels, -/-) animals. (B) DEC-205 and CD8alpha staining of the same populations after gating on CD11c+ cells. (C) CD4 expression in LOD cells gated on CD11c+CD8alpha -. Experiment shown is representative of 3 performed. (D) CD11b expression on CD4+ (left panel) and DN (right panel) CD11c+ populations in wild-type (filled pattern) and ICSBP-/- (open pattern) spleens. (E) Representative Giemsa-stained purified CD11c+ DCs from wild-type (left panel) versus ICSBP-/- spleen (right panel). Original magnification, × 400 for both panels in 2E. (F) Analysis of CD11c+ cell levels in spleen, lymph node, Peyer patches, and thymus of wild-type (left-hand bars in each panel) or ICSBP-/- (right-hand bars) animals. The different segments of each bar represent the proportion of CD8alpha + (black pattern), CD4+ (dotted pattern), and double-negative (DN, open pattern) cells present in each population. The difference in the ratio of CD8alpha + cells in this figure versus that in Figure 2A may be related to the higher total cell numbers in ICSBP-/- (55 ± 3.9 × 107) versus wild-type (15 ± 1.9 × 107) spleen resulting in a smaller apparent CD8alpha + cell reduction. Bars represent means ± SDs of absolute numbers of DCs per mouse (n = 5).

The function of ICSBP in CD8alpha + DC development is intrinsic to the hemopoietic compartment

To determine whether ICSBP function in the differentiation of CD8alpha + DCs is intrinsic to the bone marrow-derived lineage from which these cells originate or instead represents an indirect influence of the gene in the nonhemopoietic compartment, we analyzed CD8alpha + DC development in reciprocal bone marrow chimeras constructed with wild-type and ICSBP-/- mice. In the experimental design used, lethally irradiated wild-type or ICSBP-/- recipients were reconstituted with a 1:1 mixture of bone marrow cells from ICSBP-/- (CD45.2) and B6.SJL (CD45.1) mice. Because the 2 donor populations differ in their expression of CD45 alleles, it was possible to assess their individual development in the recipient animals. When examined 8 weeks after bone marrow cell transfer, complete leukocyte repopulation was observed in the lethally irradiated wild-type and ICSBP-/- recipients (data not shown). Frequency analysis of the splenic CD8alpha - DCs arising in these animals revealed that cells of both ICSBP+/+ and ICSBP-/- origin were able to develop in recipients of either strain. In striking contrast, when CD8alpha + DCs were examined only cells of wild-type origin were detected in either bone marrow recipient (Figure 3A,B). Thus, CD8alpha + DC development depends on the expression of ICSBP in the hemopoietic but not the nonhemopoietic compartment and therefore the transcription factor would appear to function intrinsically in the differentiation of this subset.


View larger version (50K):
[in this window]
[in a new window]
 
Figure 3. CD8alpha +CD11c+ DC deficiency is due to the lack of ICSBP expression within the hemopoietic compartment. Bone marrow chimeras were made by intravenous injection of a mixture of bone marrow cell suspensions (1:1 ratio, 1 × 106 cells/animal in a volume of 0.2 mL) from wild-type mice congenic for the CD45.1 marker and ICSBP-/- animals, which are CD45.2+. Wild-type (A) or ICSBP-/- (B) hosts were irradiated (9 Gy [900 rads]) prior to bone marrow reconstitution. Eight weeks later, LOD cells were obtained and stained with anti-CD45.2-FITC, anti-CD11c-PE, anti-CD8alpha -PerCP, and anti-CD45.1-APC. Cells CD11c+CD8alpha + (upper gate and panel) or CD11c+CD8alpha - (lower gate and panel) were analyzed for CD45.1 (wild-type) versus CD45.2 (ICSBP-/-) expression. The values expressed at the corners of each panel represent the relative frequency of cells within that specific quadrant (n = 3 or 4 animals/group).

ICSBP deficiency does not affect the frequency of common DC precursors in bone marrow

CD8alpha + and CD8alpha - DCs had been shown to arise from 3 types of common progenitors present in bone marrow: hemopoietic stem cells (HSC), common myeloid precursors (CMP), and common lymphoid precursors (CLP).4 To examine whether the deficiency in CD8alpha + DC in ICSBP-/- animals is due to the absence of one of these precursor lineages, a phenotypic analysis for markers associated with each progenitor type was performed on bone marrow from knockout versus wild-type animals. No differences were detected in absolute number or frequency (data not shown) of HSC, CMP, or CLP in the ICSBP-/- versus wild-type mice (Table 1). Moreover, we found no evidence for enhanced apoptosis in any of the 3 progenitor populations (not shown). Thus, the deficiency in CD8alpha + DCs in ICSBP-/- animals does not appear to be due to the absence of a distinct precursor population. Instead, these data argue that ICSBP acts further downstream in the differentiation of CD8alpha + DCs from these common lineages.

                              
View this table:
[in this window]
[in a new window]
 
Table 1. ICSBP-/- mice are not deficient in common myeloid and lymphoid bone marrow progenitors

Impaired responsiveness of ICSBP-/- CD8alpha - DCs to microbial stimulation in vivo

Although ICSBP was found to be constitutively expressed at highest levels in the CD8alpha + DC subset and ICSBP-/- mice display a selective deficiency in this subset (Figure 1), it was still possible that the gene plays a more generalized role in the development of all DC subsets. Thus, the absence of CD8alpha + DCs in ICSBP-/- mice might reflect a block in a late step in DC differentiation, which in addition to preventing the expression of CD8alpha and DEC-205 also functionally impairs the remaining subsets. To examine this issue we asked whether ICSBP-deficient DCs belonging to the other 2 subsets respond normally to in vivo microbial stimulation with CpG-oligonucleotides or LPS. As shown in Figure 4, panels A to C, DN, CD4+, and CD8alpha + DC subpopulations purified from wild-type spleen all displayed significantly up-regulated CD40, CD80, and I-A expression in response to injected LPS or CpG-oligo. In contrast, all 3 subsets from ICSBP-/- mice failed to exhibit increased CD40, CD80, or I-A expression in response to the same stimuli with the exception of the CD4+ subset, which displayed a partial up-regulation in CD40 levels. In addition, immunohistochemical examination revealed a major defect in CD11c+ DC migration into T-cell areas of ICSBP-/- spleen in response to injected LPS (Figure 4D). These data suggest that while present in normal numbers in ICSBP-deficient mice, CD8alpha - DCs are functionally impaired in vivo.


View larger version (67K):
[in this window]
[in a new window]
 
Figure 4. Impaired functional maturation of ICSBP-/-CD8alpha - DCs in vivo. Wild-type control and ICSBP-/- mice were injected intraperitoneally with PBS (0.2 mL/mouse) or 1 µg oligo-CpG DNA or E coli LPS. Six hours later low-density spleen cells were purified and the expression of CD40 (A), CD80 (B), and I-A (C) was analyzed by FACS within the cells of the DC subsets: CD11c+CD8alpha +CD4- (DN), CD11c+CD8alpha -CD4+ (CD4), CD11c+CD8alpha +CD4- (CD8) as indicated. Bars represent mean fluorescence intensity (MFI) ± SEM of each marker in each subset analyzed. (D) Representative micrographs of CD11c-stained spleen sections from wild-type (i and ii) or ICSBP-/- (iii and iv) mice injected with PBS (i and iii) or LPS (ii and iv) as described above. Orginal magnifications, × 200.


    Discussion
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Although there is now considerable information concerning the functional diversity of DCs, little is known about the factors that determine the development of individual subsets in vivo. Flt-3 ligand22 as well as the transcription factors PU.123 and Ikaros24 have been shown to markedly affect DC generation in vivo. In addition, evidence has been presented for a selective influence of PU.1 and Ikaros on the ratio of CD8alpha - and CD8alpha + DC subsets although it remains unclear to what extent these transcription factors act as determinants of differentiation.25,26 The one previously studied gene product that clearly appears to differentially direct DC subset development is the nuclear factor-kappa B (NF-kappa B) family member RelB.27 Mice deficient in this transcription factor generate CD8alpha + DCs but neither of the other 2 murine subsets.27 We demonstrate here that ICSBP, another transcription factor associated with immune function, is critical in determining the differentiation of CD8alpha + DCs, a functionally important subset of these antigen-presenting cells.

ICSBP (IRF-8) belongs to the IRF family of transcription factors but distinct from the other members of this family is expressed only in hemopoietic cells, including Lin- bone marrow cells28 as well as B and T lymphocytes and mononuclear phagocytes.29 Interferon (IFN)-gamma stimulates ICSBP expression through signal transducer and activator of transcription 1 (STAT-1) that binds to the gamma -activated site in the ICSBP gene promoter.29 Of direct relevance to the present study is our previous finding that spleen cells and elicited macrophages from ICSBP-deficient mice show impaired T gondii-induced production of IL-12p40 independent of the presence or absence of IFN-gamma .15 This study15 along with others16,30 implicated ICSBP as an important transcription factor for IL-12p40 gene expression in macrophages. Later studies revealed that the major cell population producing IL-12p40 in T gondii-stimulated spleen is the CD8alpha + subset of DCs10 suggesting that the impaired IL-12 expression observed in splenocytes from ICSBP-deficient mice results from a defect in DCs rather than macrophages. The data presented here confirm the latter hypothesis but suggest that the defective IL-12p40 response seen in unfractionated spleen cells may have been due at least in part to the failure of the major DC subset expressing this cytokine to develop in the ICSBP-deficient animals. The concept that ICSBP plays a specific role in CD8alpha + DC development is also supported by recent experiments investigating the generation of DC subsets in an in vitro system31 involving murine bone marrow cells stimulated with Flt-3 ligand plus LPS. In this study,32 IL-12-producing CD8alpha + DCs failed to develop in cultures from ICSBP-/- as opposed to wild-type mice. Retroviral transduction of knockout bone marrow with the ICSBP gene restored in vitro development of CD8alpha + DCs and IL-12 production to normal levels. This finding extends previous observations indicating that ICSBP transduction corrects the defect in the in vitro generation of CD11bhigh F4/80+ macrophages displayed by ICSBP-deficient bone marrow progenitors.33 Recent studies have elucidated the presence in mice of a plasmacytoid DC population that, in common with the "lymphoidlike" DC population studied here, can express the CD8alpha + marker.34-36 In experiments not presented here, one of us has shown that these cells are also absent in ICSBP-/- mice (H.T. et al, manuscript in preparation) suggesting an additional role for the transcription factor in the development of this DC lineage.

Although ICSBP is clearly required for the development of CD8alpha + DCs both in vivo and in vitro, the precise point at which the gene functions to determine differentiation of this subset remains to be determined. Our finding that ICSBP-/- mice display no deficiencies in the bone marrow progenitor populations implicated in DC differentiation argues that the transcription factor is likely to affect CD8alpha + DC generation at a later developmental stage. The latter hypothesis is consistent with previous studies demonstrating that the phenotypic determination of this subset occurs only after the relevant precursors arrive in lymphoid tissues.4,37

Because ICSBP appeared to be affecting a late step in the development of CD8alpha + DCs, it was important to determine whether the gene might simultaneously influence some of the late maturational properties of the remaining 2 subsets. We found that although present in unaltered frequencies in ICSBP-/- spleen both CD8alpha - subsets failed to respond normally to in vivo microbial stimulation in terms of splenic migration and major histocompatibility complex (MHC) class II as well as costimulatory molecule expression. One interpretation of this observation is that the emergence of the CD8alpha + DC subset is itself a late maturational step in DC development. Such an explanation is supported by a recent report in which CD8alpha - DCs were shown to give rise to CD8alpha + DCs in lymphoid organs after in vivo injection.6 The latter findings, however, contradict previous studies demonstrating the simultaneous emergence of both subsets in lymphoid tissues37 as well as the observation that CD8alpha + cells develop in the absence of CD8alpha - cells in RelB-deficient mice.27 The concept that CD8alpha + DCs arise from CD8alpha - precursors is also inconsistent with our failure to observe a buildup of CD8alpha - DCs in the spleens of ICSBP-deficient mice where development of CD8alpha + DCs is blocked. Instead we favor the hypothesis that CD8alpha + and CD8alpha - DCs represent independent lineages and that ICSBP in addition to regulating CD8alpha + DC development also affects the responsiveness of the other subsets that emerge in its absence, a conclusion supported by our recent experiments on ICSBP function in in vitro-derived DC populations.32 In that study, we noted that ICSBP, which is normally lacking in CD8alpha - DCs, is induced on microbial stimulation. Therefore, in its absence normal activation of the CD8alpha - DC population may not be possible. Further studies following both the expression and activity of ICSBP during in vivo DC development should help to resolve this issue.


    Acknowledgments

We thank Ron Germain for his invaluable advice and criticism during the course of this project and Sabine Stoll for allowing us to quote her unpublished data on the frequency of Langerhans cells in ICSBP-/- mice.


    Footnotes

Submitted April 10, 2002; accepted June 13, 2002.

Prepublished online as Blood First Edition Paper, June 28, 2002; DOI 10.1182/blood-2002-04-1088.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: Julio Aliberti, Immunobiology Section/LPD/NIAID/NIH. 50 South Dr, Bethesda, MD 20892; e-mail: jaliberti{at}niaid.nih.gov.


    References
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

1. Steinman RM. Dendritic cells and the control of immunity: enhancing the efficiency of antigen presentation. Mt Sinai J Med. 2001;68:106-166[Medline] [Order article via Infotrieve].

2. Maldonado-Lopez R, Moser M. Dendritic cell subsets and the regulation of TH1/TH2 responses. Semin Immunol. 2001;13:275-282[CrossRef][Medline] [Order article via Infotrieve].

3. Shortman K, Wu L, Suss G, Kronin V, Winkel K, Saunders D, Vremec D. Dendritic cells and T lymphocytes: developmental and functional interactions. Ciba Found Symp. 1997;204:130-138[Medline] [Order article via Infotrieve].

4. Traver D, Akashi K, Manz M, et al. Development of CD8alpha-positive dendritic cells from a common myeloid progenitor. Science. 2000;290:2152-2154[Abstract/Free Full Text].

5. Merad M, Fong L, Bogenberger J, Engleman EG. Differentiation of myeloid dendritic cells into CD8alpha-positive dendritic cells in vivo. Blood. 2000;96:1865-1872[Abstract/Free Full Text].

6. del Hoyo GM, Martin P, Arias CF, Marin AR, Ardavin C. CD8alpha(+) dendritic cells originate from the CD8alpha(-) dendritic cell subset by a maturation process involving CD8alpha, DEC-205, and CD24 up-regulation. Blood. 2002;99:999-1004[Abstract/Free Full Text].

7. Reis e Sousa C. Dendritic cells as sensors of infection. Immunity. 2001;14:495-498[CrossRef][Medline] [Order article via Infotrieve].

8. Kanangat S, Nair S, Babu JS, Rouse BT. Expression of cytokine mRNA in murine splenic dendritic cells and better induction of T cell-derived cytokines by dendritic cells than by macrophages during in vitro costimulation assay using specific antigens. J Leukoc Biol. 1995;57:310-316[Abstract].

9. Sparwasser T, Koch ES, Vabulas RM, et al. Bacterial DNA and immunostimulatory CpG oligonucleotides trigger maturation and activation of murine dendritic cells. Eur J Immunol. 1998;28:2045-2054[CrossRef][Medline] [Order article via Infotrieve].

10. Sousa CR, Hieny S, Scharton-Kersten T, et al. In vivo microbial stimulation induces rapid CD40 ligand-independent production of interleukin 12 by dendritic cells and their redistribution to T cell areas. J Exp Med. 1997;186:1819-1829[Abstract/Free Full Text].

11. Maldonado-Lopez R, De Smedt T, Michel P, et al. CD8alpha+ and CD8alpha- subclasses of dendritic cells direct the development of distinct T helper cells in vivo. J Exp Med. 1999;189:587-592[Abstract/Free Full Text].

12. den Haan JM, Lehar SM, Bevan MJ. CD8(+) but not CD8(-) dendritic cells cross-prime cytotoxic T cells in vivo. J Exp Med. 2000;192:1685-1696[Abstract/Free Full Text].

13. Huang LY, Reis e Sousa C, Itoh Y, Inman J, Scott DE. IL-12 induction by a TH1-inducing adjuvant in vivo: dendritic cell subsets and regulation by IL-10. J Immunol. 2001;167:1423-1430[Abstract/Free Full Text].

14. Giese NA, Gabriele L, Doherty TM, et al. Interferon (IFN) consensus sequence-binding protein, a transcription factor of the IFN regulatory factor family, regulates immune responses in vivo through control of interleukin 12 expression. J Exp Med. 1997;186:1535-1546[Abstract/Free Full Text].

15. Scharton-Kersten T, Contursi C, Masumi A, Sher A, Ozato K. Interferon consensus sequence binding protein-deficient mice display impaired resistance to intracellular infection due to a primary defect in interleukin 12 p40 induction. J Exp Med. 1997;186:1523-1534[Abstract/Free Full Text].

16. Wu CY, Maeda H, Contursi C, Ozato K, Seder RA. Differential requirement of IFN consensus sequence binding protein for the production of IL-12 and induction of TH1-type cells in response to IFN-gamma. J Immunol. 1999;162:807-812[Abstract/Free Full Text].

17. Holtschke T, Lohler J, Kanno Y, et al. Immunodeficiency and chronic myelogenous leukemia-like syndrome in mice with a targeted mutation of the ICSBP gene. Cell. 1996;87:307-317[CrossRef][Medline] [Order article via Infotrieve].

18. Aliberti J, Reis e Sousa C, Schito M, et al. CCR5 provides a signal for microbial induced production of IL-12 by CD8 alpha+ dendritic cells. Nat Immunol. 2000;1:83-87[CrossRef][Medline] [Order article via Infotrieve].

19. Klinman DM, Yi AK, Beaucage SL, Conover J, Krieg AM. CpG motifs present in bacteria DNA rapidly induce lymphocytes to secrete interleukin 6, interleukin 12, and interferon gamma. Proc Natl Acad Sci U S A. 1996;93:2879-2883[Abstract/Free Full Text].

20. Hubank M, Schatz DG. Identifying differences in mRNA expression by representational difference analysis of cDNA. Nucleic Acids Res. 1994;22:5640-5648[Abstract/Free Full Text].

21. Vremec D, Shortman K. Dendritic cell subtypes in mouse lymphoid organs: cross-correlation of surface markers, changes with incubation, and differences among thymus, spleen, and lymph nodes. J Immunol. 1997;159:565-573[Abstract].

22. McKenna HJ, Stocking KL, Miller RE, et al. Mice lacking flt3 ligand have deficient hematopoiesis affecting hematopoietic progenitor cells, dendritic cells, and natural killer cells. Blood. 2000;95:3489-3497[Abstract/Free Full Text].

23. Anderson KL, Perkin H, Surh CD, Venturini S, Maki RA, Torbett BE. Transcription factor PU.1 is necessary for development of thymic and myeloid progenitor-derived dendritic cells. J Immunol. 2000;164:1855-1861[Abstract/Free Full Text].

24. Wu L, Nichogiannopoulou A, Shortman K, Georgopoulos K. Cell-autonomous defects in dendritic cell populations of Ikaros mutant mice point to a developmental relationship with the lymphoid lineage. Immunity. 1997;7:483-492[CrossRef][Medline] [Order article via Infotrieve].

25. Guerriero A, Langmuir PB, Spain LM, Scott EW. PU.1 is required for myeloid-derived but not lymphoid-derived dendritic cells. Blood. 2000;95:879-885[Abstract/Free Full Text].

26. Wang JH, Nichogiannopoulou A, Wu L, et al. Selective defects in the development of the fetal and adult lymphoid system in mice with an Ikaros null mutation. Immunity. 1996;5:537-549[CrossRef][Medline] [Order article via Infotrieve].

27. Wu L, D'Amico A, Winkel KD, Suter M, Lo D, Shortman K. RelB is essential for the development of myeloid-related CD8alpha- dendritic cells but not of lymphoid-related CD8alpha+ dendritic cells. Immunity. 1998;9:839-847[CrossRef][Medline] [Order article via Infotrieve].

28. Tsujimura H, Nagamura-Inoue T, Tamura T, Ozato K. IFN consensus sequence binding protein/IFN regulatory factor-8 guides bone marrow progenitor cells toward the macrophage lineage. J Immunol. 2002;169:1261-1269[Abstract/Free Full Text].

29. Nagamura-Inoue T, Tamura T, Ozato K. Transcription factors that regulate growth and differentiation of myeloid cells. Int Rev Immunol. 2001;20:83-105[Medline] [Order article via Infotrieve].

30. Wang IM, Contursi C, Masumi A, Ma X, Trinchieri G, Ozato K. An IFN-gamma-inducible transcription factor, IFN consensus sequence binding protein (ICSBP), stimulates IL-12 p40 expression in macrophages. J Immunol. 2000;165:271-279[Abstract/Free Full Text].

31. Brasel K, De Smedt T, Smith JL, Maliszewski CR. Generation of murine dendritic cells from flt3-ligand-supplemented bone marrow cultures. Blood. 2000;96:3029-3039[Abstract/Free Full Text].

32. Tsujimura H, Tamura T, Gongora C, Aliberti J, Sher A, Ozato K. ICSBP/IRF-8 retrovirus transduction rescues CD8 alpha+ dendritic cell development in vitro. Blood. 2002;DOI 10.1182/blood-2002-05-1327.

33. Tamura T, Nagamura-Inoue T, Shmeltzer Z, Kuwata T, Ozato K. ICSBP directs bipotential myeloid progenitor cells to differentiate into mature macrophages. Immunity. 2000;13:155-165[CrossRef][Medline] [Order article via Infotrieve].

34. Bjorck P. Isolation and characterization of plasmacytoid dendritic cells from Flt3 ligand and granulocyte-macrophage colony-stimulating factor- treated mice. Blood. 2001;98:3520-3526[Abstract/Free Full Text].

35. Asselin-Paturel C, Boonstra A, Dalod M, et al. Mouse type I IFN-producing cells are immature APCs with plasmacytoid morphology. Nat Immunol. 2001;2:1144-1150[CrossRef][Medline] [Order article via Infotrieve].

36. Nakano H, Yanagita M, Gunn MD. CD11c(+)B220(+)Gr-1(+) cells in mouse lymph nodes and spleen display characteristics of plasmacytoid dendritic cells. J Exp Med. 2001;194:1171-1178[Abstract/Free Full Text].

37. Kamath AT, Pooley J, O'Keeffe MA, et al. The development, maturation, and turnover rate of mouse spleen dendritic cell populations. J Immunol. 2000;165:6762-6770[Abstract/Free Full Text].

© 2003 by The American Society of Hematology.
 

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Immunol.Home page
Y.-H. Chan, M.-F. Chiang, Y.-C. Tsai, S.-T. Su, M.-H. Chen, M.-S. Hou, and K.-I Lin
Absence of the Transcriptional Repressor Blimp-1 in Hematopoietic Lineages Reveals Its Role in Dendritic Cell Homeostatic Development and Function
J. Immunol., December 1, 2009; 183(11): 7039 - 7046.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
A. la Sala, J. He, L. Laricchia-Robbio, S. Gorini, A. Iwasaki, M. Braun, G. S. Yap, A. Sher, K. Ozato, and B. Kelsall
Cholera toxin inhibits IL-12 production and CD8{alpha}+ dendritic cell differentiation by cAMP-mediated inhibition of IRF8 function
J. Exp. Med., June 8, 2009; 206(6): 1227 - 1235.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
V. Nardi, O. Naveiras, M. Azam, and G. Q. Daley
ICSBP-mediated immune protection against BCR-ABL-induced leukemia requires the CCL6 and CCL9 chemokines
Blood, April 16, 2009; 113(16): 3813 - 3820.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Merad and M. G. Manz
Dendritic cell homeostasis
Blood, April 9, 2009; 113(15): 3418 - 3427.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J.-F. Marquis, R. LaCourse, L. Ryan, R. J. North, and P. Gros
Disseminated and Rapidly Fatal Tuberculosis in Mice Bearing a Defective Allele at IFN Regulatory Factor 8
J. Immunol., March 1, 2009; 182(5): 3008 - 3015.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Y. Kim and K. Ozato
The Sequestosome 1/p62 Attenuates Cytokine Gene Expression in Activated Macrophages by Inhibiting IFN Regulatory Factor 8 and TNF Receptor-Associated Factor 6/NF-{kappa}B Activity
J. Immunol., February 15, 2009; 182(4): 2131 - 2140.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H. Wang, C. H. Lee, C. Qi, P. Tailor, J. Feng, S. Abbasi, T. Atsumi, and H. C. Morse III
IRF8 regulates B-cell lineage specification, commitment, and differentiation
Blood, November 15, 2008; 112(10): 4028 - 4038.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Milanovic, G. Terszowski, D. Struck, O. Liesenfeld, and D. Carstanjen
IFN Consensus Sequence Binding Protein (Icsbp) Is Critical for Eosinophil Development
J. Immunol., October 1, 2008; 181(7): 5045 - 5053.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. Marafioti, J. C. Paterson, E. Ballabio, K. K. Reichard, S. Tedoldi, K. Hollowood, M. Dictor, M.-L. Hansmann, S. A. Pileri, M. J. Dyer, et al.
Novel markers of normal and neoplastic human plasmacytoid dendritic cells
Blood, April 1, 2008; 111(7): 3778 - 3792.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Q.-G. Steiner, L. A. Otten, M. J. Hicks, G. Kaya, F. Grosjean, E. Saeuberli, C. Lavanchy, F. Beermann, K. L. McClain, and H. Acha-Orbea
In vivo transformation of mouse conventional CD8{alpha}+ dendritic cells leads to progressive multisystem histiocytosis
Blood, February 15, 2008; 111(4): 2073 - 2082.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
P. Tailor, T. Tamura, H. C. Morse III, and K. Ozato
The BXH2 mutation in IRF8 differentially impairs dendritic cell subset development in the mouse
Blood, February 15, 2008; 111(4): 1942 - 1945.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. De Trez, K. Schneider, K. Potter, N. Droin, J. Fulton, P. S. Norris, S.-w. Ha, Y.-X. Fu, T. Murphy, K. M. Murphy, et al.
The Inhibitory HVEM-BTLA Pathway Counter Regulates Lymphotoxin Receptor Signaling to Achieve Homeostasis of Dendritic Cells
J. Immunol., January 1, 2008; 180(1): 238 - 248.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. M. Prazma, N. Yazawa, Y. Fujimoto, M. Fujimoto, and T. F. Tedder
CD83 Expression Is a Sensitive Marker of Activation Required for B Cell and CD4+ T Cell Longevity In Vivo
J. Immunol., October 1, 2007; 179(7): 4550 - 4562.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
L. Chen, E. Calomeni, J. Wen, K. Ozato, R. Shen, and J.-X. Gao
Natural killer dendritic cells are an intermediate of developing dendritic cells
J. Leukoc. Biol., June 1, 2007; 81(6): 1422 - 1433.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
C. Varol, L. Landsman, D. K. Fogg, L. Greenshtein, B. Gildor, R. Margalit, V. Kalchenko, F. Geissmann, and S. Jung
Monocytes give rise to mucosal, but not splenic, conventional dendritic cells
J. Exp. Med., January 22, 2007; 204(1): 171 - 180.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
H. Ito, E. Esashi, T. Akiyama, J.-i. Inoue, and A. Miyajima
IL-18 produced by thymic epithelial cells induces development of dendritic cells with CD11b in the fetal thymus
Int. Immunol., August 1, 2006; 18(8): 1253 - 1263.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Nencioni, K. Schwarzenberg, K. M. Brauer, S. M. Schmidt, A. Ballestrero, F. Grunebach, and P. Brossart
Proteasome inhibitor bortezomib modulates TLR4-induced dendritic cell activation
Blood, July 15, 2006; 108(2): 551 - 558.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
F. Mattei, G. Schiavoni, P. Borghi, M. Venditti, I. Canini, P. Sestili, I. Pietraforte, H. C. Morse III, C. Ramoni, F. Belardelli, et al.
ICSBP/IRF-8 differentially regulates antigen uptake during dendritic-cell development and affects antigen presentation to CD4+ T cells
Blood, July 15, 2006; 108(2): 609 - 617.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
C. H. Lee, M. Melchers, H. Wang, T. A. Torrey, R. Slota, C.-F. Qi, J. Y. Kim, P. Lugar, H. J. Kong, L. Farrington, et al.
Regulation of the germinal center gene program by interferon (IFN) regulatory factor 8/IFN consensus sequence-binding protein
J. Exp. Med., January 23, 2006; 203(1): 63 - 72.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Lehtonen, V. Veckman, T. Nikula, R. Lahesmaa, L. Kinnunen, S. Matikainen, and I. Julkunen
Differential Expression of IFN Regulatory Factor 4 Gene in Human Monocyte-Derived Dendritic Cells and Macrophages
J. Immunol., November 15, 2005; 175(10): 6570 - 6579.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. Yamaoka, B. Min, Y.-J. Zhou, W. E. Paul, and J. J. O'Shea
Jak3 negatively regulates dendritic-cell cytokine production and survival
Blood, November 1, 2005; 106(9): 3227 - 3233.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. Tamura, P. Thotakura, T. S. Tanaka, M. S. H. Ko, and K. Ozato
Identification of target genes and a unique cis element regulated by IRF-8 in developing macrophages
Blood, September 15, 2005; 106(6): 1938 - 1947.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Galibert, G. S. Diemer, Z. Liu, R. S. Johnson, J. L. Smith, T. Walzer, M. R. Comeau, C. T. Rauch, M. F. Wolfson, R. A. Sorensen, et al.
Nectin-like Protein 2 Defines a Subset of T-cell Zone Dendritic Cells and Is a Ligand for Class-I-restricted T-cell-associated Molecule
J. Biol. Chem., June 10, 2005; 280(23): 21955 - 21964.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
M. C. Gauzzi, C. Purificato, L. Conti, L. Adorini, F. Belardelli, and S. Gessani
IRF-4 expression in the human myeloid lineage: up-regulation during dendritic cell differentiation and inhibition by 1{alpha},25-dihydroxyvitamin D3
J. Leukoc. Biol., June 1, 2005; 77(6): 944 - 947.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. M. Lefebvre, M. C. Haks, M. O. Carleton, M. Rhodes, G. Sinnathamby, M. C. Simon, L. C. Eisenlohr, L. A. Garrett-Sinha, and D. L. Wiest
Enforced Expression of Spi-B Reverses T Lineage Commitment and Blocks {beta}-Selection
J. Immunol., May 15, 2005; 174(10): 6184 - 6194.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Hanada, K. Tanaka, Y. Matsumura, M. Yamauchi, H. Nishinakamura, H. Aburatani, R. Mashima, M. Kubo, T. Kobayashi, and A. Yoshimura
Induction of Hyper Th1 Cell-Type Immune Responses by Dendritic Cells Lacking the Suppressor of Cytokine Signaling-1 Gene
J. Immunol., April 1, 2005; 174(7): 4325 - 4332.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Tamura, P. Tailor, K. Yamaoka, H. J. Kong, H. Tsujimura, J. J. O'Shea, H. Singh, and K. Ozato
IFN Regulatory Factor-4 and -8 Govern Dendritic Cell Subset Development and Their Functional Diversity
J. Immunol., March 1, 2005; 174(5): 2573 - 2581.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. M. Kerksiek, F. Niedergang, P. Chavrier, D. H. Busch, and T. Brocker
Selective Rac1 inhibition in dendritic cells diminishes apoptotic cell uptake and cross-presentation in vivo
Blood, January 15, 2005; 105(2): 742 - 749.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. M. Kane, L. Cervi, J. Sun, A. S. McKee, K. S. Masek, S. Shapira, C. A. Hunter, and E. J. Pearce
Helminth Antigens Modulate TLR-Initiated Dendritic Cell Activation
J. Immunol., December 15, 2004; 173(12): 7454 - 7461.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Suzuki, K. Honma, T. Matsuyama, K. Suzuki, K. Toriyama, I. Akitoyo, K. Yamamoto, T. Suematsu, M. Nakamura, K. Yui, et al.
From the Cover: Critical roles of interferon regulatory factor 4 in CD11bhighCD8{alpha}- dendritic cell development
PNAS, June 15, 2004; 101(24): 8981 - 8986.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Tsujimura, T. Tamura, H. J. Kong, A. Nishiyama, K. J. Ishii, D. M. Klinman, and K. Ozato
Toll-Like Receptor 9 Signaling Activates NF-{kappa}B through IFN Regulatory Factor-8/IFN Consensus Sequence Binding Protein in Dendritic Cells
J. Immunol., June 1, 2004; 172(11): 6820 - 6827.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Franchini, H. Hefti, S. Vollstedt, B. Glanzmann, M. Riesen, M. Ackermann, P. Chaplin, K. Shortman, and M. Suter
Dendritic Cells from Mice Neonatally Vaccinated with Modified Vaccinia Virus Ankara Transfer Resistance against Herpes Simplex Virus Type I to Naive One-Week-Old Mice
J. Immunol., May 15, 2004; 172(10): 6304 - 6312.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
E. Ichikawa, S. Hida, Y. Omatsu, S. Shimoyama, K. Takahara, S. Miyagawa, K. Inaba, and S. Taki
Defective development of splenic and epidermal CD4+ dendritic cells in mice deficient for IFN regulatory factor-2
PNAS, March 16, 2004; 101(11): 3909 - 3914.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
G. Schiavoni, F. Mattei, P. Borghi, P. Sestili, M. Venditti, H. C. Morse III, F. Belardelli, and L. Gabriele
ICSBP is critically involved in the normal development and trafficking of Langerhans cells and dermal dendritic cells
Blood, March 15, 2004; 103(6): 2221 - 2228.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. Honda, T. Mizutani, and T. Taniguchi
Negative regulation of IFN-{alpha}/{beta} signaling by IFN regulatory factor 2 for homeostatic development of dendritic cells
PNAS, February 24, 2004; 101(8): 2416 - 2421.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
M. Salio, M. J. Palmowski, A. Atzberger, I. F. Hermans, and V. Cerundolo
CpG-matured Murine Plasmacytoid Dendritic Cells Are Capable of In Vivo Priming of Functional CD8 T Cell Responses to Endogenous but Not Exogenous Antigens
J. Exp. Med., February 17, 2004; 199(4): 567 - 579.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. Tamura, H. J. Kong, C. Tunyaplin, H. Tsujimura, K. Calame, and K. Ozato
ICSBP/IRF-8 inhibits mitogenic activity of p210 Bcr/Abl in differentiating myeloid progenitor cells
Blood, December 15, 2003; 102(13): 4547 - 4554.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Naik, D. Vremec, L. Wu, M. O'Keeffe, and K. Shortman
CD8{alpha}+ mouse spleen dendritic cells do not originate from the CD8{alpha}- dendritic cell subset
Blood, July 15, 2003; 102(2): 601 - 604.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2002-04-1088v1
101/1/305    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Aliberti, J.
Right arrow Articles by Sher, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Aliberti, J.
Right arrow Articles by Sher, A.
Related Collections
Right arrow Immunobiology
Right arrow Phagocytes
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2003 by American Society of Hematology         Online ISSN: 1528-0020