|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Prepublished online as a Blood First Edition Paper on June 28, 2002; DOI 10.1182/blood-2002-03-0818.
CLINICAL OBSERVATIONS, INTERVENTIONS, AND THERAPEUTIC TRIALS
From the Laboratoire de virologie, C.E.R.VI., UPRES EA
2387, Hôpital Pitié-Salpêtrière, Paris,
France; Unité Mixte CNRS-bioMérieux, Ecole
Normale Supérieure, Lyon, France; INSERM U128, CNRS,
BP5051, Montpellier, France.
Hepatitis C virus (HCV) is predominantly a hepatotropic virus.
Nonetheless, there is mounting evidence that hematopoietic cells may
support HCV replication. The HCV 5' untranslated region (5'UTR),
responsible for initiation of viral translation, via an internal
ribosome entry site (IRES), has been previously described to contain
specific nucleotide substitutions when cultured in infected lymphoid
cells. Our purpose was to establish whether the 5'UTR polymorphism of
quasispecies from 3 cell compartments (liver, peripheral blood
mononuclear cells [PBMG], and monocyte-derived dendritic cells
[DCs]) of a patient chronically infected with HCV1b affects the
corresponding translational efficiencies and thus the capacity for
replication. The 5'UTR polymorphism was characterized by identification
of changes at 3 crucial sites as compared with the reference nucleotide
(nt) sequence: a G insertion between positions 19 and 20, a C>A
substitution at position 204 and a G>A substitution at position 243. The quasispecies detected in DCs was unique and differed from those
present in the liver, suggesting a particular tropism of HCV
quasispecies for DCs. Moreover, its translational activity was
significantly impaired when compared with those from liver and PBMCs in
different cell lines. This impairment was thoroughly confirmed in
primary cultures of both human hepatocytes and monocyte-derived DCs.
Taken together, our data lend support both to a specific location and
impaired replication of HCV quasispecies in DCs, which could be related
to viral persistence and perturbation of DC function in chronically
infected patients.
(Blood. 2003;101:52-57) Hepatitis C virus (HCV) is a positive strand RNA
virus that establishes a chronic infection in more than 80% of cases.
Chronicity frequently leads to liver cirrhosis and hepatocellular
carcinoma,1 making HCV infection the first indication for
liver transplantation. Poor fidelity of the viral RNA-dependent RNA
polymerase results in the coexistence of closely related but distinct
variants called quasispecies, which are likely involved in viral
persistence.2,3
There is mounting evidence for an extrahepatic replication based on the
frequent association of hepatitis C infection with lymphoproliferative
disorders such as cryoglobulinemia and non-Hodgkin lymphomas (reviewed
by Dammacco et al4), and the possibility of experimental
transmission of non-A non-B hepatitis to a chimpanzee by mononuclear
leucocytes from a chronically infected patient.5 Supporting the results of Hellings et al,6 severe
combined immunodeficiency (SCID) mice have been shown to be susceptible to persistent HCV infection after injection of human HCV-positive peripheral blood mononuclear cells (PBMCs). In addition, tissue compartmentalization of the HCV genome has been described during HCV
infection7,8 and coinfection with HIV.8
Finally, the detection of HCV RNA-negative strand as the theoretical
intermediate of replication, although somewhat
controversial,9,10 has been well documented in PBMCs.
Indeed, negative- strand RNA has been reported in mononuclear cells
such as B and T lymphocytes and monocytes,11-15 in
polynuclear lymphocytes,16,17 and even in hematopoietic
progenitor cells.18 Moreover, the viral genomic RNA has
been detected more frequently in PBMCs from
nonresponders19 to interferon (IFN) treatment.
Interestingly, considering viral dynamics such as virus half-life, the
suppressing effect on viral replication observed through treatment
appears consistently slower in PBMCs than in serum.20 On
the basis of these studies, one can argue that a specific replicative
dynamics of HCV exists in PBMCs.
The relationship between quasispecies and replication in PBMCs is
unclear. In a previous study we demonstrated, in the serum of a patient
chronically infected with HCV,21 the coexistence of
internal ribosome entry site (IRES) quasispecies segregating according
to their respective translation efficiencies in lymphoid and
nonlymphoid optimal IRES. The HCV IRES responsible for the cap-independent initiation of viral RNA translation22,23
comprises most of the 5' untranslated region (5'UTR) and extends to a
short stretch (12-30 nucleotides [nt]) downstream of the initiator
codon.24 The IRES element is highly organized in secondary
and tertiary structures, which have been shown to be crucial for its
functionality (reviewed in Rijnbrand and Lemon25). By
analogy with pestiviruses (belonging like HCV to the
Flaviviridae family) and with Picornaviridae, the HCV 5'UTR is
expected to be implicated in regulation of the viral life cycle by
playing a key role in both initiation of translation and replication of
viral RNA. Moreover, this structure, albeit genetically stable across
different genotypes, might be implicated, as shown for viruses from
Picornaviridae family,26-28 in promoting HCV replication
in particular cells such as hematopoietic cells, depending on specific
changes in its sequence. Many groups have described several nucleotide
positions within the IRES structure associated with lymphoid
replication.29-33 Therefore, the presence of HCV RNA in
lymphoid cells, which is more frequently observed in the setting of
immune suppression,8,34 can be related to viral persistence.
The exact mechanisms responsible for immune disorders caused by
extrahepatic infection are still poorly understood.35
Studies have highlighted (1) an impaired allostimulatory function of
monocyte-derived dendritic cells (DCs) in chronic HCV
carriers33,36,37 and (2) a low stimulatory capacity of
murine DCs expressing HCV proteins.38 Moreover, the
detection of HCV RNA-negative strand has been described in human DCs,
suggesting a viral replication in these cells.39
As DCs are known to play a crucial role in the induction of both innate
and adaptive immune responses,40 the purpose of the
current work was to investigate the genetic variability of HCV IRES,
its quasispecies distribution, and corresponding translational efficiencies in DCs, in an attempt to gain insight into their involvement in the pathogenesis of HCV infection. With this aim, the
relative translational efficiencies of HCV IRES quasispecies retrieved
from different tissue compartments of a patient chronically infected
with HCV were monitored after transfection of various cell lines, using
a bicistronic-based assay vector.21 This was achieved both
in cell lines of hepatic or lymphoid origin, as well as in human cells
in primary culture, such as hepatocytes and dendritic cells.
Clinical samples
Two different samples were studied: a liver biopsy and a blood sample.
Mononuclear cells were obtained from blood collected in EDTA
(ethylenediaminetetraacetic acid)-treated tubes and isolated by
standard Ficoll-Hypaque (Pharmacia, St Quentin en Yvelines, France)
density gradient centrifugation and were resuspended in complete RPMI
1640 medium (Invitrogen, Cergy-Pontoise, France) with a view to
adhesion in 24-well plates for further derivation into dendritic cells.
Adherent monocytes were cultured in RPMI in the presence of 100 ng/mL
recombinant human (rh) granulocyte-macrophage colony-stimulating factor
(GM-CSF) and 500 U/mL rh-interleukin 4 (rhIL-4) as described
before.33 After a 6-day culture, cells (DCs) were
centrifuged and resuspended in complete medium containing 2.5 ng/mL
rh-tumor necrosis factor (TNF)- HCV 5'UTR amplification
Complementary DNAs (cDNAs) were synthesized as already described41 by using Moloney murine leukemia virus (M-MLV) reverse transcriptase (Invitrogen) for 1 hour at 37°C with antisense primer 1HVR3 (nt 1679-1700, ATGCGCTCTGGGCACCCGGAC). They were further amplified by heminested polymerase chain reaction (PCR), with the high fidelity Arrow Taq DNA polymerase (Stratagene) (sense primer Quasi5', nt 1-18: GCCAGCCCCTGTTGGGGG and antisense primer Quasi3', nt 409-426: AGTTCCCCGGGTGGCGGTC for the first round; sense primer IRES5', nt 1-15: CGCCGGATCCGCCAGCCCCCTGATG and antisense primer IRES3', nt 353-371: GCGCCCTGCAGTTTTCTTTGAGGTTTAGG for the second round). PCR reactions involved 30 cycles (94°C for 20 seconds, 50°C for 1 minute, and 72°C for 1 minute, followed by a final elongation step at 72°C for 7 minutes). Cloning and sequencing PCR products were digested with BamHI and PstI enzymes, then purified by using the QIAquick PCR purification kit (Qiagen) and cloned into the BamHI/PstI-digested pIRF vector, previously described.21 Briefly, this vector comprises the T7 promoter for transcription, the firefly luciferase (FLuc) gene, followed by the HCV 5'UTR sequence and the renilla luciferase (RLuc) gene. In this system the upstream (control) reporter FLuc is translated in a cap-dependent fashion, whereas the downstream (assay) reporter RLuc is under HCV IRES control.Thirty clones were generated per sample origin and then sequenced in both directions by using an ABI 377 automated DNA sequencer (Applied Biosystems) and the Dye Dideoxy TM Terminator Cycle Sequencing kit (Applied Biosystems). When detected, mutations were considered to be representative of a quasispecies distribution only when observed in at least 5 independent clones. This precaution was respected to exclude any polymerase artifact because of nucleotide misincorporations, which cannot be totally ruled out even when using a high fidelity polymerase with proofreading activity (Malet I., unpublished results, 2002). Cell cultures Five human cell lines were used: HepG2 and HuH7 of hepatocellular carcinoma origin, Jurkat a T-cell line derived from lymphoblastic leukemia, Daudi a B-cell line from B-lymphoma, and KG1 a cell line of myeloblastic origin. Adherent cells (HepG2 and HuH7) were maintained in Dulbecco-modified Eagle medium (DMEM; Invitrogen) and nonadherent cells in RPMI 1640 medium at 37°C in a 5% CO2 atmosphere. All media were supplemented with glutamax, 10% fetal calf serum, and 1% penicillin-streptomycin (Invitrogen). One day before transfection, 2 × 105 adherent cells (HepG2, HuH7) or 5 × 105 nonadherent cells (Jurkat, Daudi, and KG1) were seeded in 24-well plates.Hepatocytes in primary culture were prepared from liver lobectomy segments taken from adult patients for medical purposes unrelated to our research program. All patients tested negative for HCV (IMX, Abbott), as well as HBV and HIV (VIDAS, Biomérieux) antibodies. Hepatocytes were isolated and plated at confluence in 24-well plates precoated with collagen and cultured for 2 days according to the previously published procedure,42 before transfection. Preparation of monocyte-induced DCs for transfection experiments was carried out as described above from blood samples tested negative for HCV, HBV, and HIV antibodies. After a 6-day culture, DCs were harvested and plated in 24-well plates (106 cells/mL per well) and transfected the next day. DNA transfections Cells lines were infected with the vTF7-3 recombinant vaccinia virus expressing T7 RNA polymerase (kindly provided by B. Moss, National Institutes of Health, Bethesda, MD) at 5 plaque-forming units (PFU)/cell in 300 µL serum-free medium Opti-MEM (Invitrogen) for 1 hour at 37°C. They were then transfected in triplicate with respective constructs, using 1 µg plasmid DNA mixed with 5 µg DAC-30 (Eurogentec) in 300 µL Opti-MEM. At 18 hours after transfection, cells were harvested and lysates were stored at 20°C
until use.
Cells in primary culture were infected with the vTF7-3 recombinant
vaccinia virus at 3 PFU/cell in 300 µL serum-free medium DMEM for 1 hour at 37°C. The cells were then transfected in triplicate with
respective constructs, using 2 µg plasmid DNA mixed with 6 µg
Fugene 6 (Roche, Meylan, France) in 400 µL DMEM, incubated for 5 hours at 37°C, and complete medium was added. At 18 hours after
transfection, cells were harvested and lysates stored at Luciferase assays Both renilla and firefly luciferases were measured for their respective luminometric activity from cell lysates by using the Dual Luciferase kit assay (Promega). IRES relative translational activity is represented by the RLuc/FLuc ratio.Statistical analysis Variations between the mean translational efficiencies were analyzed by means of methods of analysis of variance. The tests were performed by using Excel software (Ritme Informatique, Paris, France). The significance of observed differences was assessed by using the Snedecor F test.43 Multiple comparisons between individual variations were performed by using the Scheffé test.44 The Scheffé test is a procedure that permits to test unplanned comparisons among means without inflating the type I error rate. Differences were considered to be significant when P < .05.
Characterization of HCV 5'UTR quasispecies A 371-nt region corresponding to the HCV IRES was amplified from a patient chronically infected with genotype 1b HCV. Quasispecies was characterized in 3 tissue samples of different origins: a liver biopsy, PBMCs from whole blood, and DCs derived from blood monocytes. The amplified products were cloned into the pIRF vector, and 30 clones per tissue origin were sequenced. More than 90 clones were isolated from the 3 samples; 3 principal sites reflected a quasispecies distribution after comparison with the 5'UTR sequence of HCV genotype 1b45: a G insertion between nucleotides 19 and 20, a C>A substitution at position 204, and a G>A substitution at position 243. The combination of nucleotide substitutions at these 3 crucial positions varied depending on the sample origin and allowed a segregation of clones studied into 6 independent quasispecies: QD, QL1, QL2, QP1, QP2, and QP3, described hereafter, and represented in Table 1 and Figure 1. QD was the unique sequence isolated in the DC sample, and QL1 and QL2 were both representative of the liver sample. All these quasispecies were detected in the PBMCs, with 3 additional sequences (QP1, QP2, and QP3) exclusively detected in that tissue sample. Of note QL1 was also predominantly represented in the serum33 and exhibited a complete homology with the HCV 1b reference. Therefore, it was considered as the consensus sequence. Two substitutions were found to be associated in the DC sample: a C>A at position 204 and a G>A at position 243 (QD). These mutations were detected in the PBMC sample, either associated in most clones (QD, 20 of 30 clones), or unique at position 204 (QP1, 2 of 30) or 243 (QP2 and QP3, 1 of 30). The G insertion between nt 19 and 20 was predominantly observed in the liver compartment (QL2, 10 of 30) and was also detected, albeit at low frequency, in the PBMC sample (QL2 and QP3, 1 of 30), whereas it was absent in the DCs.
The 5'UTR IRES quasispecies translational efficiencies in cell lines To establish whether the observed mutations could be related to a functional variability, we performed translational luciferase assays following transfection of 5 cell lines as described in "Materials and methods." The pIRF bicistronic system used in that work has the advantage of bypassing the possible differences in transfection efficiency and susceptibility occurring in each cell line. Indeed, during the transfection procedure, the upstream FLuc translation product serves as an internal control, whereas the second RLuc product depends on the HCV IRES activity.A great heterogeneity, with a highly significant difference
(P < .001), was observed between the IRES efficiencies,
depending on the cell line used (Figure
2). In different experiments no signal
could be obtained from the Daudi cells. To facilitate interpretation of
the results, QD was chosen for normalization of relative translational efficiency with an arbitrary value of 1 in each cell line. On independent experiments performed in triplicate, QD clearly appeared to
be the least efficient IRES in all cell lines (Scheffe test, P < .05). Consequently, relative activity of quasispecies
isolated from the other compartments was enhanced 2- to 6-fold in HepG2 and HuH7 cells and 3- to more than 10-fold in Jurkat and KG1 cells. Interestingly, comparison between QD efficiency and that from QP1 and
QP2 quasispecies revealed a dramatic decrease for QD: from 2.5- to
9-fold (HepG2 versus KG1 cell line). QD contains substitutions C>A at
nt 204 and G>A at nt 243, compared with QP1 and QP2, each of them
possessing only one of these mutations at nt 204 and 243, respectively.
This finding strongly suggests that the restricted association of both
mutations, as is the case in QD, is deleterious for the virus,
impairing its initiation translation step.
Although not statistically significant, opposite trends in the translation mechanism were noted in cell lines of the same origin, depending on the mutation involved. Indeed, concerning hepatocellular cell lines, an increase in IRES activity was observed in HepG2 cells and a decrease in HuH7 cells, whether A substitution occurred at nt 204 (QP1 versus QL1) or at nt 243 (QP3 versus QL2). Similarly, for lymphoid cell lines, an increase in IRES efficiency appeared in Jurkat cells and a decrease in KG1 cells, whether A substitution was detected at nt 204 (QP2 versus QL1) or at nt 243 (QP1 versus QL1 and QP3 versus QL2). It appeared from these observations that cell lines, albeit of a common origin, react independently to the same viral pressure, perhaps because of the presence in each of them, of specific factors able to modulate the IRES activity, as already suggested in other studies. The 5'UTR quasispecies translational efficiencies in primary cells To strengthen our data obtained with cell lines, we performed the same experiments using primary cell cultures that were assumed to mimic more closely the conditions of natural infection.Hepatocytes in primary culture were isolated from 3 different human
livers to exclude any host factor selection bias. After seeding in
24-well plates, they were transfected with the bicistronic constructs
containing any of the IRES quasispecies and assayed by luminometry. As
represented in Figure 3, the values
obtained from 3 independent experiments were highly reproducible and
closely related for each clone tested. The differences between the
quasispecies activities were statistically significant
(P < .05) in the 3 assays. Importantly, it can be noted
that the luciferase levels obtained in primary hepatocytes were of the
same magnitude as that obtained with the cell lines. QD was again
significantly less efficient than the other quasispecies
(P < .05, donor 2), with a difference of at least
3.7-fold for QD versus QP3 and 9.4-fold for QD versus QL2.
Furthermore, the transfection experiment was performed in DCs derived
from blood monocytes (Figure 4). Despite
the poor transfection efficiency observed, probably because of high
cell mortality and slight contamination with other PBMC populations. QD
still significantly appeared the least efficient of the quasispecies
(first and second assays, P < .01; third assay,
P < .05).
Our results clearly indicated that the unique IRES sequence present in DCs was less efficient than the other sequences detected in liver and PBMCs. As expected, according to the above results, the combination of the 2 substitutions at nt 204 and 243 seems required to impair IRES activity.
Quasispecies polymorphism is associated in many RNA viruses with viral persistence, and several reports have demonstrated that among Picornaviridae, such as poliovirus26 and HAV,27 the 5'UTR determines cell type-specific replication. The current study was undertaken to determine whether variability occurring in HCV 5'UTR could confer a putative replication advantage in cells of lymphoid origin. We present data that support that hypothesis with the identification of a particular HCV quasispecies in one subpopulation of DCs, the monocyte-derived DC, as defined by a unique sequence within 5'UTR. Among IRES quasispecies amplified from 3 cell compartments of the same individual, 3 mutations were found to be representative of a polymorphism within the HCV 5'UTR: a Gly insertion between nt 19 and 20, a C>A substitution at position 204, and a G>A substitution at position 243. The 5'UTR originated from the DCs (QD) differed from the sequences from the liver and was predominantly recovered from the PBMC sample. The hypothesis of a passive adsorption onto DCs or PBMCs of viral particles released from the liver into the blood stream seems unlikely for several reasons. (1) Although the liver is considered as the major virus-producing compartment in an infected host, quasispecies retrieved from the liver are recovered at a low frequency from the PBMCs (QL1, 5 of 30; and QL2, 1 of 30) and never from the DCs. (2) Substitutions at positions 204 (C>A) and 243 (G>A) observed in the DCs and in the PBMCs have already been described as lymphoid specific, either after selection during passage of HCV in lymphoblastic B and T cells,29 or more recently in PBMCs of a chronically infected patient.33 (3) The possibility that human PBMCs could concentrate a subset of the circulating viral population differing in the IRES area has been considered in a study, and thus excluded by adsorption assays.8 Our work provides original observations further supporting the concept of HCV replication in PBMCs. They consist of the identification of different mutation patterns observed for quasispecies of lymphoid origin (DCs and PBMCs) compared with that recovered from the liver. Most of the published reports have described the coexistence of positive and negative strands of HCV RNA in the PBMCs of infected patients.11,12,14,17,47 Although convincing, because of the use of assays carefully optimized for strand specificity, these observations must be considered with caution. It should be kept in mind that the presence of a nuclease-resistant form of HCV-negative strand has been reported in the serum.13 Thus, it cannot be totally excluded that the basis for the negative strand detection in these cells resulted from phagocytosis, such as internalization either of fragments of replicating liver cells or of protected negative strand RNA from serum. One originality of this work is the use of primary human cells to monitor the IRES translational efficiency. The human hepatocyte is the primary target for HCV replication and has been shown to be metabolically active for at least 35 days48-50 and able to support in vitro HCV replication as described.42 Although quasispecies retrieved from the liver (QL1 and QL2) was, as expected, the most efficient in primary hepatocytes, QD, the unique quasispecies from the DCs, exhibited a dramatic low translational activity in 3 independent assays using primary hepatocytes prepared from 3 different donors. This result was not surprising, as QD variant derived from DCs was supposed to be adapted to the lymphoid rather than to the liver compartment. However, a similar unexpected reduced activity was observed in DCs induced from blood monocyte primary culture, the same cell subset from which QD was recovered. Nonetheless, such an impaired IRES activity observed in DC cultures cannot rule out the possibility of an unadapted culture system, lacking some indispensable factors. Alternatively, if QD reflects an adaptation to lymphotropism, this would imply that such a variant might have a lower fitness than the wild type for DCs, because of its low translational activity, thus making DCs a potent viral reservoir accounting for viral latency. In general 2 mechanisms are proposed to justify the viral persistence in a host, beside the possibility of integration into the cell genome, which is excluded for HCV infection: (1) the disruption of immune system and/or (2) the alteration of replication. As reviewed in Klagge and Schneider-Schaulies51 for chronic retroviral infection and acute measles infections, and in Akbar et al52 for chronic viral hepatites, viruses can modulate DC functions and hence interfere with the immune response. Together with 2 reports,33,36 our results fit such mechanisms. Indeed, the impaired activity of DC quasispecies could be explained by persistent maintenance of HCV in DCs either at a low level and/or at a small percentage within the cell population. In addition, it is consistent with the attribution to DCs, of a role in disseminating the virus via lymph nodes, therefore contributing to the pathogenesis of HCV infection. In conclusion, our study provides another strong argument in favor of extrahepatic replication of HCV taking the advantage of human primary cells for testing the assayed IRES activity. The unique IRES variant from the DCs was clearly impaired in translational efficiency, suggesting that viral adaptation to these cells leads to a low replication phenotype. DC infection with HCV may explain HCV persistence in the host, even after treatment or orthotopic liver transplantation,34,53,54 and it corroborates the hypothesis that lymphoid cells are an alternative reservoir for the virus. Nonetheless, further studies are necessary to assess the incidence of this phenomenon on immune disorders associated with HCV infection, such as cryoglobulinemia and non-Hodgkin lymphoma, and whether it could be related to the progression to cirrhosis or resistance to treatment.
We thank Nadège Goutagny for her help in harvesting and preparing the dendritic cell cultures.
Submitted March 18, 2002; accepted June 12, 2002.
Prepublished online as Blood First Edition Paper, June 28, 2002; DOI 10.1182/blood-2002-03-0818.
Supported in part by the Ministère de l'Education Nationale, de la Recherche et de la Technologie (MENRT): programme de Recherche Fondamentale en Microbiologie et Maladies Infectieuses et Parasitaires (réseau Hépatite C), the Association pour la Recherche contre le Cancer, and the Association Claude Bernard. J. L. is supported by a doctoral grant from the MENRT No. 99623.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Annie Cahour, Laboratoire de Virologie, C.E.R.V.I., UPRES EA 2387, Hôpital Pitié-Salpêtrière, 83 Bd de l'hôpital, 75651 Paris Cedex 13, France; e-mail: cahour{at}idf.ext.jussieu.
1.
Alter HJ.
To C or not to C: these are the questions.
Blood.
1995;85:1681-1695
2.
Martell M, Esteban JI, Quer J, et al.
Hepatitis C virus (HCV) circulates as a population of different but closely related genomes: quasispecies nature of HCV genome distribution.
J Virol.
1992;66:3225-3229 3. Forns X, Purcell RH, Bukh J. Quasispecies in viral persistence and pathogenesis of hepatitis C virus. Trends Microbiol. 1999;7:402-410[CrossRef][Medline] [Order article via Infotrieve]. 4. Dammacco F, Sansonno D, Piccoli C, Tucci FA, Racanelli V. The cryoglobulins: an overview. Eur J Clin Invest. 2001;31:628-638[CrossRef][Medline] [Order article via Infotrieve]. 5. Hellings JA, van der Veen-du Prie J, Snelting-van Densen R, Stute R. Preliminary results of transmission experiments of non-A, non-B hepatitis by mononuclear leucocytes from a chronic patient. J Virol Methods. 1985;10:321-326[CrossRef][Medline] [Order article via Infotrieve]. 6. Bronowicki JP, Loriot MA, Thiers V, Grignon Y, Zignego AL, Brechot C. Hepatitis C virus persistence in human hematopoietic cells injected into SCID mice. Hepatology. 1998;28:211-218[CrossRef].
7.
Navas S, Martin J, Quiroga JA, Castillo I, Carreno V.
Genetic diversity and tissue compartmentalization of the hepatitis C virus genome in blood mononuclear cells, liver, and serum from chronic hepatitis C patients.
J Virol.
1998;72:1640-1646
8.
Laskus T, Radkowski M, Wang LF, Nowicki M, Rakela J.
Uneven distribution of hepatitis C virus quasispecies in tissues from subjects with end-stage liver disease: confounding effect of viral adsorption and mounting evidence for the presence of low-level extrahepatic replication.
J Virol.
2000;74:1014-1017 9. McGuinness PH, Bishop GA, McCaughan GW, Trowbridge R, Gowans EJ. False detection of negative-strand hepatitis C virus RNA. Lancet. 1994;343:551-552[CrossRef][Medline] [Order article via Infotrieve]. 10. Lanford RE, Sureau C, Jacob JR, White R, Fuerst TR. Demonstration of in vitro infection of chimpanzee hepatocytes with hepatitis C virus using strand-specific RT/PCR. Virology. 1994;202:606-614[CrossRef][Medline] [Order article via Infotrieve]. 11. Wang JT, Sheu JC, Lin JT, Wang TH, Chen DS. Detection of replicative form of hepatitis C virus RNA in peripheral blood mononuclear cells. J Infect Dis. 1992;166:1167-1169[Medline] [Order article via Infotrieve]
12.
Muller HM, Pfaff E, Goeser T, Kallinowski B, Solbach C, Theilmann L.
Peripheral blood leukocytes serve as a possible extrahepatic site for hepatitis C virus replication.
J Gen Virol.
1993;74:669-676 13. Willems M, Peerlinck K, Moshage H, et al. Hepatitis C virus-RNAs in plasma and in peripheral blood mononuclear cells of hemophiliacs with chronic hepatitis C: evidence for viral replication in peripheral blood mononuclear cells. J Med Virol. 1994;42:272-278[Medline] [Order article via Infotrieve]
14.
Lerat H, Rumin S, Habersetzer F, et al.
In vivo tropism of hepatitis C virus genomic sequences in hematopoietic cells: influence of viral load, viral genotype, and cell phenotype.
Blood.
1998;91:3841-3849 15. Schirren CA, Jung MC, Gerlach JT, et al. Liver-derived hepatitis C virus (HCV)-specific CD4(+) T cells recognize multiple HCV epitopes and produce interferon gamma. Hepatology. 2000;32:597-603[CrossRef] 16. Mihm S, Hartmann H, Ramadori G. A reevaluation of the association of hepatitis C virus replicative intermediates with peripheral blood cells including granulocytes by a tagged reverse transcription/polymerase chain reaction technique. J Hepatol. 1996;24:491-497[CrossRef][Medline] [Order article via Infotrieve].
17.
Crovatto M, Pozzato G, Zorat F, et al.
Peripheral blood neutrophils from hepatitis C virus-infected patients are replication sites of the virus.
Haematologica.
2000;85:356-361
18.
Sansonno D, Lotesoriere C, Cornacchiulo V, et al.
Hepatitis C virus infection involves CD34(+) hematopoietic progenitor cells in hepatitis C virus chronic carriers.
Blood.
1998;92:3328-3337 19. Qian C, Camps J, Maluenda MD, Civeira MP, Prieto J. Replication of hepatitis C virus in peripheral blood mononuclear cells. Effect of alpha-interferon therapy. J Hepatol. 1992;16:380-383[CrossRef][Medline] [Order article via Infotrieve]. 20. Asahina Y, Izumi N, Uchihara M, et al. A potent antiviral effect on hepatitis C viral dynamics in serum and peripheral blood mononuclear cells during combination therapy with high-dose daily interferon alfa plus ribavirin and intravenous twice-daily treatment with interferon beta. Hepatology. 2001;34:377-384[CrossRef].
21.
Laporte J, Malet I, Andrieu T, et al.
Comparative analysis of translation efficiencies of hepatitis C virus 5' untranslated regions among intraindividual quasispecies present in chronic infection: opposite behaviors depending on cell type.
J Virol.
2000;74:10827-10833
22.
Tsukiyama-Kohara K, Iizuka N, Kohara M, Nomoto A.
Internal ribosome entry site within hepatitis C virus RNA.
J Virol.
1992;66:1476-1483
23.
Wang C, Sarnow P, Siddiqui A.
Translation of human hepatitis C virus RNA in cultured cells is mediated by an internal ribosome-binding mechanism.
J Virol.
1993;67:3338-3344 24. Reynolds JE, Kaminski A, Kettinen HJ, et al. Unique features of internal initiation of hepatitis C virus RNA translation. EMBO J. 1995;14:6010-6020[Medline] [Order article via Infotrieve]. 25. Rijnbrand RC, Lemon SM. Internal ribosome entry site-mediated translation in hepatitis C virus replication. Curr Top Microbiol Immunol. 2000;242:85-116[Medline] [Order article via Infotrieve].
26.
Kuge S, Nomoto A.
Construction of viable deletion and insertion mutants of the Sabin strain of type 1 poliovirus: function of the 5' noncoding sequence in viral replication.
J Virol.
1987;61:1478-1487
27.
Day SP, Murphy P, Brown EA, Lemon SM.
Mutations within the 5' nontranslated region of hepatitis A virus RNA which enhance replication in BS-C-1 cells.
J Virol.
1992;66:6533-6540 28. Todd S, Towner JS, Semler BL. Translation and replication properties of the human rhinovirus genome in vivo and in vitro. Virology. 1997;229:90-97[CrossRef][Medline] [Order article via Infotrieve]. 29. Nakajima N, Hijikata M, Yoshikura H, Shimizu YK. Characterization of long-term cultures of hepatitis C virus. J Virol. 1996;70:3325-3329[Abstract]. 30. Shimizu YK, Igarashi H, Kanematu T, et al. Sequence analysis of the hepatitis C virus genome recovered from serum, liver, and peripheral blood mononuclear cells of infected chimpanzees. J Virol. 1997;71:5769-5773[Abstract].
31.
Lerat H, Shimizu YK, Lemon SM.
Cell type-specific enhancement of hepatitis C virus internal ribosome entry site-directed translation due to 5' nontranslated region substitutions selected during passage of virus in lymphoblastoid cells.
J Virol.
2000;74:7024-7031 32. Laskus T, Radkowski M, Piasek A, et al. Hepatitis C virus in lymphoid cells of patients coinfected with human immunodeficiency virus type 1: evidence of active replication in monocytes/macrophages and lymphocytes. J Infect Dis. 2000;181:442-448[CrossRef][Medline] [Order article via Infotrieve]. 33. Bain C, Fatmi A, Zoulim F, Zarski JP, Trepo C, Inchauspe G. Impaired allostimulatory function of dendritic cells in chronic hepatitis C infection. Gastroenterology. 2001;120:512-524[CrossRef][Medline] [Order article via Infotrieve]. 34. Radkowski M, Wang LF, Vargas H, Wilkinson J, Rakela J, Laskus T. Changes in hepatitis C virus population in serum and peripheral blood mononuclear cells in chronically infected patients receiving liver graft from infected donors. Transplantation. 2001;72:833-838[CrossRef][Medline] [Order article via Infotrieve]. 35. Zignego AL, Brechot C. Extrahepatic manifestations of HCV infection: facts and controversies. J Hepatol. 1999;31:369-376[CrossRef][Medline] [Order article via Infotrieve].
36.
Kanto T, Hayashi N, Takehara T, et al.
Impaired allostimulatory capacity of peripheral blood dendritic cells recovered from hepatitis C virus-infected individuals.
J Immunol.
1999;162:5584-5591 37. Kakumu S, Ito S, Ishikawa T, et al. Decreased function of peripheral blood dendritic cells in patients with hepatocellular carcinoma with hepatitis B and C virus infection. J Gastroenterol Hepatol. 2000;15:431-436[CrossRef][Medline] [Order article via Infotrieve]. 38. Hiasa Y, Horiike N, Akbar SM, et al. Low stimulatory capacity of lymphoid dendritic cells expressing hepatitis C virus genes. Biochem Biophys Res Commun. 1998;249:90-95[CrossRef][Medline] [Order article via Infotrieve]. 39. Mellor J, Haydon G, Blair C, Livingstone W, Simmonds P. Low level or absent in vivo replication of hepatitis C virus and hepatitis G virus/GB virus C in peripheral blood mononuclear cells. J Gen Virol. 1998;79:705-714[Abstract]. 40. Banchereau J, Steinman RM. Dendritic cells and the control of immunity. Nature. 1998;392:245-252[CrossRef][Medline] [Order article via Infotrieve]. 41. Lerat H, Berby F, Trabaud MA, et al. Specific detection of hepatitis C virus minus strand RNA in hematopoietic cells. J Clin Invest. 1996;97:845-851[Medline] [Order article via Infotrieve]. 42. Fournier C, Sureau C, Coste J, et al. In vitro infection of adult normal human hepatocytes in primary culture by hepatitis C virus. J Gen Virol. 1998;79:2367-2374[Abstract]. 43. Snedecor GW, Cochran WG. Covariance analysis WG Statistical Methods. 6th edition. Ames, IA: The Iowa State University Press; 1967:419-420. 44. Scheffe H. The Analysis of Variance. New York, NY: Wiley; 1959.
45.
Inchauspe G, Zebedee S, Lee DH, Sugitani M, Nasoff M, Prince AM.
Genomic structure of the human prototype strain H of hepatitis C virus: comparison with American and Japanese isolates.
Proc Natl Acad Sci U S A.
1991;88:10292-10296
46.
Honda M, Beard MR, Ping LH, Lemon SM.
A phylogenetically conserved stem-loop structure at the 5' border of the internal ribosome entry site of hepatitis C virus is required for cap-independent viral translation.
J Virol.
1999;73:1165-1174
47.
Moldvay J, Deny P, Pol S, Brechot C, Lamas E.
Detection of hepatitis C virus RNA in peripheral blood mononuclear cells of infected patients by in situ hybridization.
Blood.
1994;83:269-273 48. Ferrini JB, Pichard L, Domergue J, Maurel P. Long-term primary cultures of adult human hepatocytes. Chem Biol Interact. 1997;107:31-45[CrossRef][Medline] [Order article via Infotrieve]. 49. Ferrini JB, Rodrigues E, Dulic V, et al. Expression and DNA-binding activity of C/EBPalpha and C/EBPbeta in human liver and differentiated primary hepatocytes. J Hepatol. 2001;35:170-177[CrossRef][Medline] [Order article via Infotrieve]. 50. Pichard-Garcia L, Gerbal-Chaloin S, Ferrini J, Fabre J, Maurel P. Use of long term cultures of human hepatocytes to study CYP gene expression. Methods Enzymol. In press. 51. Klagge IM, Schneider-Schaulies S. Virus interactions with dendritic cells. J Gen Virol. 1999;80:823-833[Medline] [Order article via Infotrieve]. 52. Akbar SM, Horiike N, Onji M, Hino O. Dendritic cells and chronic hepatitis virus carriers. Intervirology. 2001;44:199-208[CrossRef][Medline] [Order article via Infotrieve]. 53. Martin P, Munoz SJ, Di Bisceglie AM, et al. Recurrence of hepatitis C virus infection after orthotopic liver transplantation. Hepatology. 1991;13:719-721[CrossRef]. 54. Feray C, Samuel D, Thiers V, et al. Reinfection of liver graft by hepatitis C virus after liver transplantation. J Clin Invest. 1992;89:1361-1365[Medline] [Order article via Infotrieve].
© 2003 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  H. Barth, E. K. Schnober, C. Neumann-Haefelin, C. Thumann, M. B. Zeisel, H. M. Diepolder, Z. Hu, T. J. Liang, H. E. Blum, R. Thimme, et al. Scavenger Receptor Class B Is Required for Hepatitis C Virus Uptake and Cross-Presentation by Human Dendritic Cells J. Virol., April 1, 2008; 82(7): 3466 - 3479. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Sansonno, A. Carbone, V. De Re, and F. Dammacco Hepatitis C virus infection, cryoglobulinaemia, and beyond Rheumatology, April 1, 2007; 46(4): 572 - 578. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Guitart, J.-I. Riezu-Boj, E. Elizalde, E. Larrea, C. Berasain, R. Aldabe, M. P. Civeira, and J. Prieto Hepatitis C virus infection of primary tupaia hepatocytes leads to selection of quasispecies variants, induction of interferon-stimulated genes and NF-{kappa}B nuclear translocation J. Gen. Virol., November 1, 2005; 86(11): 3065 - 3074. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Patterson, H. Donaghy, P. Amjadi, B. Gazzard, F. Gotch, and P. Kelleher Human BDCA-1-Positive Blood Dendritic Cells Differentiate into Phenotypically Distinct Immature and Mature Populations in the Absence of Exogenous Maturational Stimuli: Differentiation Failure in HIV Infection J. Immunol., June 15, 2005; 174(12): 8200 - 8209. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Boni, J.-P. Lavergne, S. Boulant, and A. Cahour Hepatitis C Virus Core Protein Acts as a trans-Modulating Factor on Internal Translation Initiation of the Viral RNA J. Biol. Chem., May 6, 2005; 280(18): 17737 - 17748. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Barth, A. Ulsenheimer, G. R. Pape, H. M. Diepolder, M. Hoffmann, C. Neumann-Haefelin, R. Thimme, P. Henneke, R. Klein, G. Paranhos-Baccala, et al. Uptake and presentation of hepatitis C virus-like particles by human dendritic cells Blood, May 1, 2005; 105(9): 3605 - 3614. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. C. van Leeuwen, C. B. E. M. Reusken, M. Roeten, T. J. Dalebout, J. I. Riezu-Boj, J. Ruiz, and W. J. M. Spaan Evolution of naturally occurring 5' non-translated region variants of hepatitis C virus genotype 1b in selectable replicons J. Gen. Virol., July 1, 2004; 85(7): 1859 - 1866. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. M. Forton, P. Karayiannis, N. Mahmud, S. D. Taylor-Robinson, and H. C. Thomas Identification of Unique Hepatitis C Virus Quasispecies in the Central Nervous System and Comparative Analysis of Internal Translational Efficiency of Brain, Liver, and Serum Variants J. Virol., May 15, 2004; 78(10): 5170 - 5183. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Sarobe, J. J. Lasarte, A. Zabaleta, L. Arribillaga, A. Arina, I. Melero, F. Borras-Cuesta, and J. Prieto Hepatitis C Virus Structural Proteins Impair Dendritic Cell Maturation and Inhibit In Vivo Induction of Cellular Immune Responses J. Virol., October 15, 2003; 77(20): 10862 - 10871. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2003 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
) treatment and was under ribavirin antiviral
therapy at sampling time. The alanine aminotransferase level was
109 IU/mL and viral load was 3.8 MEq/mL (Quantiplex, HCV RNA
2.0 Assay, bDNA; Chiron, Emeryville, CA). Fibrosis status was evaluated
as A3F3 using Metavir scoring on liver biopsy. Infection either with
HIV or hepatitis B virus (HBV) was excluded by enzyme-linked immunosorbent assays.
for substitution, and 
for insertion.
Clone identifications are shown in parentheses.
, 
, 
, and 
) were seeded in 24-well
plates at 2 × 105 cells/well for adherent cells and
5 × 105 cells/well for nonadherent cells. The next day,
they were infected with vTF7-3 recombinant vaccinia virus at 5 PFU/cell
for 1 hour at 37°C and then transfected in triplicate as described in
"Materials and methods" with respective bicistronic constructs,
containing each of the identified HCV quasispecies. At 18 hours after
transfection cells were lysed and assayed for luciferases activities.
For each quasispecies (QD, QL1, QL2, QP1, QP2, and QP3) IRES relative
activities were given as RLuc/FLuc ratios normalized to the
QD (originated from DCs) RLuc/FLuc ratio. The
data bars and error bars represent the means and SDs of 3 independent
triplicate transfections.
