|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Prepublished online as a Blood First Edition Paper on January 16, 2003; DOI 10.1182/blood-2002-08-2405.
CLINICAL OBSERVATIONS, INTERVENTIONS, AND THERAPEUTIC TRIALS
From the Departments of Pharmaceutical Sciences,
Biostatistics, Pathology, Hematology-Oncology, and Radiation Oncology,
St Jude Children's Research Hospital; and Colleges of Medicine and
Pharmacy, University of Tennessee, Memphis, TN.
Event-free survival for children with acute lymphoblastic leukemia
(ALL) now exceeds 80% in the most effective trials. Failures are due
to relapse, toxicity, and second cancers such as therapy-related myeloid leukemia or myelodysplasia (t-ML). Topoisomerase II inhibitors and alkylators can induce t-ML; additional risk factors for t-ML remain
poorly defined. The occurrence of t-ML among children who had received
granulocyte colony-stimulating factor (G-CSF) following ALL remission
induction therapy prompted us to examine this and other putative risk
factors for t-ML in 412 children treated on 2 consecutive ALL protocols
from 1991 to 1998. All children received etoposide and anthracyclines,
99 of whom received G-CSF; 284 also received cyclophosphamide, 58 of
whom also received cranial irradiation. There were 20 children
who developed t-ML at a median of 2.3 years (range, 1.0-6.0 years),
including 16 cases of acute myeloid leukemia, 3 myelodysplasia, and 1 chronic myeloid leukemia. Stratifying by protocol, the cumulative
incidence functions differed (P = .017) according to the
use of G-CSF and irradiation: 6-year cumulative incidence (standard
error) of t-ML of 12.3% (5.3%) among the 44 children who received
irradiation without G-CSF, 11.0% (3.5%) among the 85 children who
received G-CSF but no irradiation, 7.1% (7.2%) among the 14 children
who received irradiation plus G-CSF, and 2.7% (1.3%) among the 269 children who received neither irradiation nor G-CSF. Even when children
receiving irradiation were excluded, the incidence was still higher in
those receiving G-CSF (P = .019). In the setting of
intensive antileukemic therapy, short-term use of G-CSF may increase
the risk of t-ML.
(Blood. 2003;101:3862-3867) Treatment of childhood acute lymphoblastic leukemia
(ALL) has made tremendous strides over the past 20 years, but has been complicated by the induction of secondary tumors after some regimens. The cumulative incidence of therapy-related myeloid leukemia and myelodysplastic syndrome (referred to collectively as t-ML) varies widely among treatment protocols, from 1% to 12%.1-5
Among children with ALL, t-ML secondary to topoisomerase II inhibitors,
characterized by balanced translocations often involving the
MLL gene on 11q23, has been the most common t-ML, but t-ML
characteristic of that induced by alkylating agents (eg, preceded by
myelodysplasia, displaying monosomy 5 or 7) has also been
reported.3,6,7 The entity of t-ML occurs not only in
survivors of cancer but also in those treated with topoisomerase II
inhibitors or alkylators for nonmalignant diseases4,8;
thus, risk factors for t-ML among patients with ALL may have relevance
for other patients treated with these medications. Because there are
many treatment regimens that include high doses of alkylators and
topoisomerase II inhibitors that are not associated with a high risk of
t-ML,1,4,6 it is clear that there are other factors that
cooperate with the primary leukemogen to influence the risk of t-ML. We
and others have investigated host risk factors for
t-ML,9-12 but the development of t-ML likely depends
upon interactions between host and treatment-related risk factors.
Heretofore, additional facilitative treatment-related risk factors
identified have included irradiation2,5,13 and medications
such as asparaginase14,15 and thiopurines,3,9 which may enhance the leukemogenic properties of the primary
leukemogens: topoisomerase II inhibitors, and alkylators.
Since their discovery, it has been questioned whether granulocyte
colony-stimulating factors could facilitate the growth of malignant myeloid cells or could induce a myeloid
leukemia.16-20 Granulocyte colony-stimulating factor
(G-CSF) induces the growth of primary acute myeloid leukemic blasts in
vitro in about 50% of cases,16 and it increases the
proliferation and maturation of myeloid progenitors.16
However, G-CSF was not leukemogenic in mice,17 induced
differentiation of granulocyte precursors, and even had an antileukemic
effect in some preclinical models.17 Thus,
colony-stimulating factors have now been tested in several randomized
phase 3 trials to treat acute myeloid leukemia
(AML).21 These trials have failed to show any effect of
G-CSF on leukemia-free or overall survival in patients with
AML.21-25
There are no controlled trials indicating an excess risk of t-ML among
patients treated with G-CSF or granulocyte-macrophage colony-stimulating factor (GM-CSF); however, there are few reports on
long-term outcome of any kind in controlled trials of G-CSF or GM-CSF,
especially compared with placebo.24,26-28 Although there
is a relatively high incidence (5%-27%) of myeloid malignancies following G-CSF use for aplastic anemia or congenital
neutropenia,29-35 the underlying predisposition of such
patients to develop myeloid malignancy has confounded attempts to
determine whether growth factors could contribute to the myelodysplasia
or myeloid leukemia in these patients. Thus, it is not currently known
whether hematopoietic growth factors are a risk factor for
t-ML.
We performed one of the few placebo-controlled randomized studies of
G-CSF in a relatively large group (n = 164) of children with
ALL,36 and because of effective chemotherapy a large
percentage (> 75%) of patients are long-term survivors. The
occurrence of cases of t-ML among patients with ALL who received G-CSF
prompted us to perform the current analysis of whether G-CSF could be a risk factor for t-ML. Because other factors (eg, irradiation) might
have also impacted the risk of t-ML, we extended the analysis to
include a relatively large cohort of consecutively treated children
with ALL (n = 412) to account for potentially confounding risk factors.
Patients with newly diagnosed ALL were enrolled on St Jude
Children's Research Hospital protocol Total XIIIA
(1991-1994)37 or on Total XIIIB (1994-1998) (Tables
1-2). Patients or their parents (as
appropriate) gave informed consent to
participate. Both protocols, and the current analysis of risk factors
for t-ML, were approved by the institutional review board. The 2 treatment arms (low and intermediate/high) of each protocol had
identical cumulative doses and frequency of administration of
topoisomerase II inhibitors and alkylating agents. A total of 164 of
the 167 patients enrolled on Total XIIIA were stratified by their
up-front methotrexate treatment dose and risk group (based on age,
initial leukocyte count, presence of the Philadelphia chromosome, and
DNA content of the leukemic blasts) and randomized to receive
10 µg/kg/d G-CSF subcutaneously (80 patients) or placebo (84 patients) for 15 days after remission induction that included
etoposide, or until the neutrophil count was higher than
1 × 109/L for 2 days.36 The dose
of 10 µg/kg was based on the fact that pharmacokinetic data in
children indicated that G-CSF exposure was dose-related over the 5 to
10 µg/kg dosage range,39 and that early data had
suggested that children might benefit from the higher 10 µg/kg dose.
The optimal dosage in children has not been established.22
This was the only use of G-CSF among patients on Total XIIIA for the
duration of their ALL treatment. G-CSF use on Total XIIIB was not
randomly assigned, but was at the discretion of the treating physician,
and was generally given to patients with prolonged or severe
neutropenia to attempt to hasten neutrophil recovery following
chemotherapy. To confirm use on Total XIIIA, and to identify use on
Total XIIIB, we performed comprehensive computer searches for all
prescriptions and orders for hematologic growth factors for patients
treated on Total XIIIA and B from December of 1991 to January 2000, and
then performed detailed medical record reviews to verify the
administration, dose, and duration of growth factor use (all growth
factors were G-CSF) given during the time period of front-line protocol
therapy. The 14% of patients at higher risk of central nervous system
(CNS) relapse37 received irradiation at one year
of therapy on both protocols (Tables 1-2).
We defined the event of t-ML to include AML, relapse
with a lineage switch, myelodysplastic syndrome, and chronic myeloid leukemia. Competing events included induction failure, isolated CNS
relapse, testicular relapse, all other relapses, and death. Patients
were classified as having received G-CSF or irradiation if G-CSF or
irradiation was given prior to an event. Patients remaining in complete
remission were classified as having received G-CSF or irradiation if
G-CSF or irradiation was ever given.
The t-ML-free survival was calculated from the initial complete
remission date to the date of the diagnosis of the t-ML for those who
experienced a t-ML, and from the initial remission date to the date of
a competing event for patients experiencing a competing event. Patients
who were still alive and free of any kind of event were censored at the
time of last follow-up. Patients who had stem cell
transplantation before any kind of event at the time of
analysis were censored at the time of transplantation, as their therapy
then changed substantially; no patients who developed t-ML underwent
stem cell transplantation prior to their t-ML. The cumulative incidence
of t-ML was estimated using the method described by
Kalbfleisch and Prentice,40 and the cumulative incidence functions were compared using the method described by Gray.41 Because asparaginase use has been linked to the
risk of t-ML,14,15 and protocol Total XIIIA had more
asparaginase than Total XIIIB (Tables 1-2), analyses were stratified by
treatment protocol.
Acquired point mutations in exon 17 of the G-CSF receptor have been
linked by some but not others33,34,42 to the development of t-ML in patients who have received G-CSF. Intron 16 and exon 17 were
amplified with 2 separate polymerase chain reactions (PCRs) using DNA from bone marrow collected at the time of diagnosis of t-ML,
using primer pairs AACAGCTCAGAGACCTGTGGCCT and GGCCATTGGGTGGGGGCTGGAT or TGCCCAGAATCATGGAGGAG and TGGAGTCACAGCGGAGATAG. Amplification conditions were 95°C for 5 minutes, 40 cycles at 95°C for 45 seconds, 61°C for 1 minute, and 70°C for 1 minute. Sequence was
obtained from at least 4 separate amplifications for each sample in
both forward and reverse orientations.
Presenting features of the 412 patients are indicated in Table
3. With a median follow-up of 5.7 years,
20 patients have developed a t-ML, with a median onset of 2.3 years
(range, 1.0-6.0 years) from the start of ALL therapy. Of these, 16 presented with acute myeloid leukemia, 3 with myelodysplasia, and 1 with chronic myeloid leukemia. Among the 99 patients who received
G-CSF, the median daily dose of G-CSF was 10 mcg/kg/d (coefficient of
variation of only 1.9% in daily dose), median duration of use was 9 days, and the median time that G-CSF started relative to ALL therapy was 34 days (corresponding to the day following the last
etoposide/cytarabine of remission induction therapy). The distribution
of G-CSF use and irradiation therapy among patients on each protocol is
listed in Table 4.
Our goal was to evaluate whether G-CSF was associated with the risk of t-ML, accounting for other risk factors that were variant in the antileukemic therapy for these 412 patients. All patients received epipodophyllotoxins. Among patients who received neither G-CSF nor irradiation, there was no evidence of a difference in the incidence of t-ML for patients on the intermediate/high risk versus those on the low-risk arms of Total XIIIA (4.9% ± 2.8% vs 0%, respectively; P = .55) or of Total XIIIB (1.5% ± 1.5% vs 1.0% ± 1%, respectively; P = .72). When patients treated in both protocols were combined for analysis, there was also no evidence for a difference (P = .52) in the risk of t-ML between those on the intermediate/high-risk and low-risk arms (3.7% ± 2.0% vs 0.9% ± 0.9%, respectively), despite the fact that patients on the intermediate/high-risk arms of both studies received more doses of epipodophyllotoxins and cyclophosphamide (Table 2). Thus, when evaluating the possible role of irradiation and G-CSF on the development of t-ML, we did not stratify for risk group. Because use of asparaginase has been linked to the risk of t-ML,14,15 and asparaginase was more extensively used in Total XIIIA than in Total XIIIB (Table 2), analyses were stratified for asparaginase use by stratifying for treatment protocol. The cumulative incidence functions for risk of t-ML differed
significantly among patients grouped by their G-CSF and irradiation treatment (P = .017, stratified by protocol) (Figure
1). Among those who did not receive
G-CSF, there was a higher incidence (P = .0038) of t-ML
among those who received irradiation (6-year estimate,
12.3% ± 5.3%) than among those who did not receive irradiation (6-year estimate, 2.7% ± 1.3%). Among those who did not receive irradiation, there was a higher incidence (P = .019) of
t-ML among those who did versus did not receive G-CSF
(11.0% ± 3.5% vs 2.7% ± 1.3%). The cumulative incidence of
t-ML was similar (P = .87) among patients who had only one
risk factor: 6-year estimates of 12.3% ± 5.3% for those who
received irradiation but no G-CSF and 11.0% ± 3.5% for those who
received G-CSF but no irradiation.
In our prior studies,2,43 all patients treated with epipodophyllotoxins and alkylators for higher risk ALL also received irradiation, thereby precluding our ability to assess the impact of irradiation on t-ML risk. In the current study, only a fraction of the higher risk patients received radiation. When we restricted the analysis to the 193 patients on the higher-risk arms of Total XIIIA and XIIIB who did not receive G-CSF (all of whom received cyclophosphamide and a large number of etoposide doses [Tables 1-2] and 23% of whom received irradiation), irradiation therapy was associated with a higher risk of t-ML, with 6-year estimates of 12.3% ± 5.3% vs 3.7% ± 2.0% (P = .0320). When we restricted the analysis to the 164 patients on Total XIIIA, for whom G-CSF was administered as part of the randomized trial, there was no statistically significant difference in the risk of t-ML in those who did versus did not receive G-CSF (10.0% ± 3.4% vs 6.0% ± 2.6%; P = .33, stratifying for radiation therapy). Among the 5 t-ML cases who received irradiation but no G-CSF, 2 had myelodysplastic syndrome (one with an 11q23 translocation), 1 had chronic myelogenous leukemia (CML) with a t(9;22), and 2 had acute myeloid leukemia with 11q23 translocations. Among the 9 t-ML patients who received G-CSF but no irradiation, 1 developed myelodysplastic syndrome and 8 developed acute myeloid leukemia (7 with 11q23 translocations). Among the 5 t-ML patients who received neither G-CSF nor irradiation, all 5 had acute myeloid leukemia (4 with 11q23 translocations). The single case of t-ML among the 14 patients who received irradiation and G-CSF had acute myeloid leukemia with an 11q23 translocation. No heterozygous or homozygous mutations were detected in exon 17 of the G-CSF receptor in DNA from bone marrow obtained at the time of diagnosis of t-ML in any of the 20 patients who developed t-ML.
Multiple therapy-related and host-specific risk factors are likely to contribute to the development of secondary leukemias,2-6,9-11,13,15,44-47 in addition to the well-known contribution of topoisomerase II inhibitors and alkylating agents to t-ML.44,47,48 In the present study, topoisomerase II inhibitors were given to all children. Our goal was to identify additional treatment-related factors, besides topoisomerase II inhibitors, that contributed to the risk of t-ML. Several studies have attempted to identify other "coleukemogens" that affect the risk of t-ML, suggesting that irradiation5,13,43 and concurrent asparaginase use14,15 may increase the risk of t-ML following potentially leukemogenic multiagent chemotherapy. In the current analysis of 412 patients treated on 2 consecutive front-line ALL trials, even after stratifying for asparaginase use and accounting for irradiation, we found that G-CSF use was associated with an increased risk of t-ML. A proleukemogenic effect of hematologic growth factors has long been a theoretical concern.16-19 Despite shortening the need for acute hospitalization in patients with AML,49,50 G-CSF has demonstrated no effect on event-free survival or overall survival.21,22,24,25,50 Thus, it is possible that any potentially improved treatment response due to G-CSF or its effects on delivery of chemotherapy (which was observed as a higher complete remission rate in one study)25 could be nullified by its proliferative effects on leukemic clones. A few case reports in patients with t-ML have included withdrawal and rechallenge with G-CSF, indicating that G-CSF use was temporally associated with proliferation of myeloid leukemia.51-53 However, promoting the proliferation of an existing myeloid leukemia may involve different mechanisms than promoting the genesis of t-ML. If G-CSF can facilitate leukemogenesis of chemotherapy, given its widespread use,54,55 it might be argued that more cases of t-ML should have been reported. The incidence of t-ML overall is not known, and such documentation is confounded because many myeloid malignancy trials exclude t-ML cases, and most front-line randomized studies of hematopoietic growth factors lack long-term follow-up. A study of acute myeloid leukemia, which did not exclude patients previously treated with growth factors or with chemo- or radiotherapy, reported that 24% (50/211) of its patients presented as t-ML, although only a few had been documented to have received prior myeloid growth factors.24 Although G-CSF is widely used in patients with cancer, few studies have evaluated long-term outcome,24,26 and only rarely have they specifically reported a lack of t-ML.26 Most randomized studies have been of patients who are at high risk of relapse of their primary malignancy; in a randomized study of G-CSF with relatively long follow-up (up to 4 years), the median survival in the G-CSF and placebo groups was only 6 and 9 months (P = .71), respectively,24 far shorter than the median onset time for t-ML. Overall 3-year survival was only 21% and 19% in G-CSF versus placebo arms in another trial.23 In nonrandomized trials of G-CSF during potentially leukemogenic chemotherapy, a higher-than-expected frequency of t-ML has occasionally been reported,45,46,56 and it is possible that G-CSF could have contributed to t-ML following intensification of therapy for women with breast cancer.57,58 By inhibiting apoptosis of hematopoietic precursors, affecting differentiation, or enhancing proliferation of clones carrying leukemogenic genomic fusions,58 growth factors could contribute to leukemogenesis initiated by other potentially leukemogenic stimuli (eg, radiation, alkylators, and topoisomerase II inhibitors). Because the dose intensity of leukemogenic anticancer therapy has been increased in parallel with the introduction of G-CSF in many nonrandomized studies,56,57 it has not been possible to distinguish the contribution of intensified therapy versus G-CSF. However, there are conflicting data as to whether t-ML is related to either intensity or cumulative doses of chemotherapy.2,6,43,45,59,60 Thus, higher frequencies of t-ML observed on "modern" trials, which include both growth factors and "more intense" chemotherapy, cannot necessarily be ascribed to the more intense chemotherapy. We acknowledge that when the current analysis was restricted to only the 164 children on Total XIIIA, in which use of G-CSF was solely based upon randomization, there was no statistically significant association of G-CSF with risk of t-ML. Because of the relatively small sample size in that subset, the fact that irradiation was confounding and its use was not randomized, and that administration of etoposide-containing chemotherapy was not altered by the administration of G-CSF, we think it is appropriate to present results for the entire cohort of 412 patients (those who did and did not receive either G-CSF or irradiation, respectively, whether randomized or not). Because of the now widespread (and therefore undocumented) use of G-CSF, it will become increasingly difficult to track any potential long-term effects of the agent in cancer trials. Whether the timing or dosing of G-CSF relative to chemotherapy
might have an impact on its putative leukemogenic effects is not known.
The dose of G-CSF that was used in most patients (10 mcg/kg) in this
study is higher than that recommended for most indications in
adults,22 and thus a lower dose of G-CSF might not have
been similarly associated with t-ML risk. The timing of G-CSF use might
also be important: most patients in the current study received G-CSF
immediately following topoisomerase II inhibitors at the end of
remission induction therapy. We previously "back-tracked" the
molecular emergence of t-ML in one of our ALL patients (reported herein). This patient received only 6 doses of topoisomerase II inhibitors, G-CSF before and after the first 3 topoisomerase II inhibitors doses during induction therapy, no alkylators, and no
irradiation.61 We found that t-ML emerged early in
therapy, after exposure to only the 3 induction doses of topoisomerase II inhibitors with G-CSF. Given that most patients in the current study
received G-CSF at this same time point Secondary acute myeloid leukemia is divided into 2 major types: that due to topoisomerase II inhibitors and that due to alkylating agents.48 The former type is characterized by a short onset, the lack of a prodromal phase, and balanced translocations, most often involving MLL on 11q23.2,4,6,47,48 Alkylator- and radiation-associated t-ML typically has a longer onset, is often preceded by a myelodysplastic phase, and displays chromosomal deletions, especially of chromosomes 5 and 7.47,62 Herein, 15 of 20 t-ML cases displayed 11q23 translocations, suggesting that most cases were at least partly due to topoisomerase II inhibitors, and 3 of 20 cases presented with myelodysplasia. Interestingly, the t-ML we observed in the patients who received irradiation alone (no G-CSF) plus ALL systemic therapy was more likely to exhibit alkylator-like t-ML characteristics (2 with myelodysplasia) than the other G-CSF/irradiation subgroups. This group also included an unusual case of secondary CML carrying a t(9;22) (in a patient who was negative for the t(9;22) at diagnosis of ALL), a translocation for which fusion products have been induced in vitro by irradiation.63 It is possible that both irradiation and G-CSF can act as cooperative factors for leukemogenesis initiated by other primary leukemogens (eg, topoisomerase II inhibitors, alkylators), and thus the t-ML we observed reflected the molecular signatures of several possible primary leukemogens. The cumulative incidence of t-ML among children who received irradiation but no G-CSF was similar to that observed among children who received G-CSF but no irradiation (P = .87), suggesting that either one of these modalities provided an additional leukemogenic hit that enhanced leukemogenesis. Because only 14 children received both G-CSF and irradiation (in addition to topoisomerase II inhibitors and alkylators), it is not possible to speculate as to whether their putative cooperative leukemogenic effects were "additive" in this setting. Given the lack of effect of G-CSF on long-term outcomes among cancer patients,23-26 and some contradictory data on its efficacy for short-term outcomes,23-25,64 our observation of a possible contribution of G-CSF to the risk of t-ML dictates that caution be exercised in adding hematopoietic growth factors to intensive antineoplastic regimens.
We thank Michael Hancock, Terreia Jones, Jean Cai, and Yinmei Zhou for analytical assistance; the clinical and laboratory staff at St Jude Children's Research Hospital; and the patients and their families for participating. None of the funding sources had any role in the design or analysis of these data, nor in the decision to submit this manuscript. The authors have no financial or personal conflicts of interest related to this work.
Submitted August 6, 2002; accepted January 11, 2003.
Prepublished online as Blood First Edition Paper, January 16, 2003; DOI 10.1182/blood-2002-08-2405.
Supported by NCI CA 51001, CA 78224, CA 21765, and the National Institutes of Health (NIH)/National Institute of General Medical Sciences (NIGMS) Pharmacogenetics Research Network and Database (U01 GM61393, U01 GM61374 [http://pharmgkb.org/do/serve?id=home.welcome]) from the NIH; by a Center of Excellence grant from the State of Tennessee; and by American Lebanese Syrian Associated Charities (ALSAC). C.-H.P. is American Cancer Society FM Kirby Clinical Research Professor.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Mary V. Relling, Department of Pharmaceutical Sciences, St Jude Children's Research Hospital, 332 N Lauderdale, Memphis, TN 38105; e-mail: mary.relling{at}stjude.org.
1.
Winick NJ, McKenna RW, Shuster JJ, et al.
Secondary acute myeloid leukemia in children with acute lymphoblastic leukemia treated with etoposide.
J Clin Oncol.
1993;11:209-217 2. Pui C-H, Ribeiro R, Hancock ML, et al. Acute myeloid leukemia in children treated with epipodophyllotoxins for acute lymphocytic leukemia. N Engl J Med. 1991;325:1682-1687[Abstract]. 3. Thomsen J, Schroder H, Kristinsson J, et al. Possible carcinogenic effect of 6-mercaptopurine on bone marrow stem cells. Cancer. 1999;86:1080-1086[CrossRef][Medline] [Order article via Infotrieve]. 4. Pui C-H, Relling MV. Topoisomerase II inhibitor-related acute myeloid leukemia. Br J Haematol. 2000;109:13-23[CrossRef][Medline] [Order article via Infotrieve].
5.
Loning L, Zimmermann M, Reiter A, et al.
Secondary neoplasms subsequent to Berlin-Frankfurt-Munster therapy of acute lymphoblastic leukemia in childhood: significantly lower risk without cranial radiotherapy.
Blood.
2000;95:2770-2775
6.
Smith MA, Rubinstein L, Anderson JR, et al.
Secondary leukemia or myelodysplastic syndrome after treatment with epipodophyllotoxins.
J Clin Oncol.
1999;17:569-577
7.
Pui CH, Relling MV, Rivera GK, et al.
Epipodophyllotoxin-related acute myeloid leukemia 8. Haupt R, Fears TR, Heise A, et al. Risk of secondary leukemia after treatment with etoposide (VP-16) for Langerhans' cell histiocytosis in Italian and Austrian-German populations. Int J Cancer. 1997;71:9-13[CrossRef][Medline] [Order article via Infotrieve]. 9. Relling MV, Yanishevski Y, Nemec J, et al. Etoposide and antimetabolite pharmacology in patients who develop secondary acute myeloid leukemia. Leukemia. 1998;12:346-352[CrossRef][Medline] [Order article via Infotrieve].
10.
Felix CA, Walker AH, Lange BJ, et al.
Association of CYP3A4 genotype with treatment-related leukemia.
Proc Natl Acad Sci U S A.
1998;95:13176-13181
11.
Larson RA, Wang Y, Banerjee M, et al.
Prevalence of the inactivating 609C 12. Blanco JG, Edick MJ, Hancock ML, et al. Genetic polymorphisms in CYP3A5, CYP3A4 and NQO1 in children who developed therapy-related myeloid malignancies. Pharmacogenetics. 2002;12:605-611[CrossRef][Medline] [Order article via Infotrieve].
13.
Travis LB, Andersson M, Gospodarowicz M, et al.
Treatment-associated leukemia following testicular cancer.
J Natl Cancer Inst.
2000;92:1165-1171 14. Amylon MD, Shuster J, Pullen J, et al. Intensive high-dose asparaginase consolidation improves survival for pediatric patients with T cell acute lymphoblastic leukemia and advanced stage lymphoblastic lymphoma: a Pediatric Oncology Group study. Leukemia. 1999;13:335-342[CrossRef][Medline] [Order article via Infotrieve]. 15. Pui C-H, Relling MV, Behm FG, et al. L-asparaginase may potentiate the leukemogenic effect of the epipodophyllotoxins. Leukemia. 1995;9:1680-1684[Medline] [Order article via Infotrieve]. 16. Lieschke GJ, Burgess AW. Granulocyte colony-stimulating factor and granulocyte-macrophage colony-stimulating factor (2). N Engl J Med. 1992;327:99-106[Medline] [Order article via Infotrieve]. 17. Metcalf D. The colony stimulating factors: discovery, development, and clinical applications. Cancer. 1990;65:2185-2195[CrossRef][Medline] [Order article via Infotrieve]. 18. Kojima S, Tsuchida M, Matsuyama T. Myelodysplasia and leukemia after treatment of aplastic anemia with G-CSF. N Engl J Med. 1992;326:1294-1295[Medline] [Order article via Infotrieve].
19.
Soutar RL.
Acute myeloblastic leukemia and recombinant granulocyte colony stimulating factor.
BMJ.
1991;303:123-124
20.
Ozer H, Miller LL, Anderson JR, et al.
American Society of Clinical Oncology recommendations for the use of hematopoietic colony-stimulating factors: evidence-based, clinical practice guidelines.
J Clin Oncol.
1994;12:2471-2508
21.
Geller RB.
Use of cytokines in the treatment of acute myelocytic leukemia: a critical review.
J Clin Oncol.
1996;14:1371-1382
22.
Ozer H, Armitage JO, Bennett CL, et al.
2000 update of recommendations for the use of hematopoietic colony-stimulating factors: evidence-based, clinical practice guidelines: American Society of Clinical Oncology Growth Factors Expert Panel.
J Clin Oncol.
2000;18:3558-3585
23.
Heil G, Hoelzer D, Sanz MA, et al.
A randomized, double-blind, placebo-controlled, phase III study of filgrastim in remission induction and consolidation therapy for adults with de novo acute myeloid leukemia: The International Acute Myeloid Leukemia Study Group.
Blood.
1997;90:4710-4718
24.
Godwin JE, Kopecky KJ, Head DR, et al.
A double-blind placebo-controlled trial of granulocyte colony-stimulating factor in elderly patients with previously untreated acute myeloid leukemia: a Southwest oncology group study (9031).
Blood.
1998;91:3607-3615
25.
Dombret H, Chastang C, Fenaux P, et al.
A controlled study of recombinant human granulocyte colony-stimulating factor in elderly patients after treatment for acute myelogenous leukemia: AML Cooperative Study Group.
N Engl J Med.
1995;332:1678-1683 26. Gisselbrecht C, Haioun C, Lepage E, et al. Placebo-controlled phase III study of lenograstim (glycosylated recombinant human granulocyte colony-stimulating factor) in aggressive non-Hodgkin's lymphoma: factors influencing chemotherapy administration: Groupe d'Etude des Lymphomes de l'Adulte. Leuk Lymphoma. 1997;25:289-300[Medline] [Order article via Infotrieve]. 27. Thomas X, Fenaux P, Dombret H, et al. Granulocyte-macrophage colony-stimulating factor (GM-CSF) to increase efficacy of intensive sequential chemotherapy with etoposide, mitoxantrone and cytarabine (EMA) in previously treated acute myeloid leukemia: a multicenter randomized placebo-controlled trial (EMA91 Trial). Leukemia. 1999;13:1214-1220[CrossRef][Medline] [Order article via Infotrieve].
28.
Witz F, Sadoun A, Perrin MC, et al.
A placebo-controlled study of recombinant human granulocyte-macrophage colony-stimulating factor administered during and after induction treatment for de novo acute myelogenous leukemia in elderly patients: Groupe Ouest Est Leucemies Aigues Myeloblastiques (GOELAM).
Blood.
1998;91:2722-2730 29. Locasciulli A, Arcese W, Locatelli F, Di Bona E, Bacigalupo A. Treatment of aplastic anaemia with granulocyte-colony stimulating factor and risk of malignancy: Italian Aplastic Anaemia Study Group. Lancet. 2001;357:43-44[CrossRef][Medline] [Order article via Infotrieve].
30.
Ohara A, Kojima S, Hamajima N, et al.
Myelodysplastic syndrome and acute myelogenous leukemia as a late clonal complication in children with acquired aplastic anemia.
Blood.
1997;90:1009-1013
31.
Freedman MH, Bonilla MA, Fier C, et al.
Myelodysplasia syndrome and acute myeloid leukemia in patients with congenital neutropenia receiving G-CSF therapy.
Blood.
2000;96:429-436 32. Ohara A, Kojima S, Okamura J, et al. Evolution of myelodysplastic syndrome and acute myelogenous leukaemia in children with hepatitis-associated aplastic anaemia. Br J Haematol. 2002;116:151-154[CrossRef][Medline] [Order article via Infotrieve]. 33. Bernard T, Gale RE, Evans JP, Linch DC. Mutations of the granulocyte-colony stimulating factor receptor in patients with severe congenital neutropenia are not required for transformation to acute myeloid leukaemia and may be a bystander phenomenon. Br J Haematol. 1998;101:141-149[CrossRef][Medline] [Order article via Infotrieve].
34.
Tidow N, Pilz C, Teichmann B, et al.
Clinical relevance of point mutations in the cytoplasmic domain of the granulocyte colony-stimulating factor receptor gene in patients with severe congenital neutropenia.
Blood.
1997;89:2369-2375
35.
Imashuku S, Hibi S, Nakajima F, et al.
A review of 125 cases to determine the risk of myelodysplasia and leukemia in pediatric neutropenic patients after treatment with recombinant human granulocyte colony-stimulating factor.
Blood.
1994;84:2380-2381
36.
Pui CH, Boyett JM, Hughes WT, et al.
Human granulocyte colony-stimulating factor after induction chemotherapy in children with acute lymphoblastic leukemia.
N Engl J Med.
1997;336:1781-1787
37.
Pui CH, Mahmoud HH, Rivera GK, et al.
Early intensification of intrathecal chemotherapy virtually eliminates central nervous system relapse in children with acute lymphoblastic leukemia.
Blood.
1998;92:411-415
38.
Dervieux T, Brenner T, Hon YY, et al.
De novo purine synthesis inhibition and antileukemic effects of mercaptopurine alone or in combination with methotrexate in vivo.
Blood.
2002;100:1240-1247
39.
Stute N, Santana VM, Rodman JH, et al.
Pharmacokinetics of subcutaneous recombinant human granulocyte colony- stimulating factor in children.
Blood.
1992;79:2849-2854 40. Kalbfleisch JD, Prentice RL. The Statistical Analysis of Failure Time Data. New York, NY: John Wiley & Sons; 1980. 41. Gray RJ. A class of K-sample tests for comparing the cumulative incidence of a competing risk. Annals Stat. 1988;16:1141-1154.
42.
Dong F, Brynes RK, Tidow N, et al.
Mutations in the gene for the granulocyte colony-stimulating-factor receptor in patients with acute myeloid leukemia preceded by severe congenital neutropenia.
N Engl J Med.
1995;333:487-493 43. Pui C-H, Behm FG, Raimondi SC, et al. Secondary acute myeloid leukemia in children treated for acute lymphoid leukemia. N Engl J Med. 1989;321:136-142[Abstract]. 44. Felix CA. Leukemias related to treatment with DNA topoisomerase II inhibitors. Med Pediatr Oncol. 2001;36:525-535[CrossRef][Medline] [Order article via Infotrieve].
45.
Kushner BH, Heller G, Cheung NK, et al.
High risk of leukemia after short-term dose-intensive chemotherapy in young patients with solid tumors.
J Clin Oncol.
1998;16:3016-3020
46.
Micallef IN, Lillington DM, Apostolidis J, et al.
Therapy-related myelodysplasia and secondary acute myelogenous leukemia after high-dose therapy with autologous hematopoietic progenitor-cell support for lymphoid malignancies.
J Clin Oncol.
2000;18:947-955 47. Thirman MJ, Larson RA. Therapy-related myeloid leukemia. Hematol Oncol Clin North Am. 1996;10:293-320[CrossRef][Medline] [Order article via Infotrieve].
48.
Pedersen-Bjergaard J, Pedersen M, Roulston D, Philip P.
Different genetic pathways in leukemogenesis for patients presenting with therapy-related myelodysplasia and therapy-related acute myeloid leukemia.
Blood.
1995;86:3542-3552
49.
Harousseau JL, Witz B, Lioure B, et al.
Granulocyte colony-stimulating factor after intensive consolidation chemotherapy in acute myeloid leukemia: results of a randomized trial of the Groupe Ouest-Est Leucemies Aigues Myeloblastiques.
J Clin Oncol.
2000;18:780-787
50.
Moore JO, Dodge RK, Amrein PC, et al.
Granulocyte-colony stimulating factor (filgrastim) accelerates granulocyte recovery after intensive postremission chemotherapy for acute myeloid leukemia with aziridinyl benzoquinone and mitoxantrone: Cancer and Leukemia Group B study 9022.
Blood.
1997;89:780-788
51.
Jeha S, Chan KW, Aprikyan AG, et al.
Spontaneous remission of granulocyte colony-stimulating factor-associated leukemia in a child with severe congenital neutropenia.
Blood.
2000;96:3647-3649 52. Laver JH, Barredo JC, Amylon M, et al. Effects of cranial radiation in children with high risk T cell acute lymphoblastic leukemia: a Pediatric Oncology Group report. Leukemia. 2000;14:369-373[CrossRef][Medline] [Order article via Infotrieve]. 53. Inukai T, Sugita K, Iijima K, et al. Leukemic cells with 11q23 translocations express granulocyte colony-stimulating factor (G-CSF) receptor and their proliferation is stimulated with G-CSF. Leukemia. 1998;12:382-389[CrossRef][Medline] [Order article via Infotrieve]. 54. Top 200 drugs by WAC for hospitals in 2001. Drug Topics [serial online at www.drugtopics.com]. February 18, 2002;4:hse14.
55.
Bennett CL, Weeks JA, Somerfield MR, Feinglass J, Smith TJ.
Use of hematopoietic colony-stimulating factors: comparison of the 1994 and 1997 American Society of Clinical Oncology surveys regarding ASCO clinical practice guidelines: Health Services Research Committee of the American Society of Clinical Oncology.
J Clin Oncol.
1999;17:3676-3681 56. Rodriguez-Galindo C, Poquette CA, Marina NM, et al. Hematologic abnormalities and acute myeloid leukemia in children and adolescents administered intensified chemotherapy for the Ewing sarcoma family of tumors. J Pediatr Hematol Oncol. 2000;22:321-329[CrossRef][Medline] [Order article via Infotrieve].
57.
Fisher B, Anderson S, DeCillis A, et al.
Further evaluation of intensified and increased total dose of cyclophosphamide for the treatment of primary breast cancer: findings from National Surgical Adjuvant Breast and Bowel Project B-25.
J Clin Oncol.
1999;17:3374-3388 58. Brodsky RA, Bedi A, Jones RJ. Are growth factors leukemogenic? Leukemia. 1996;10:175-177[Medline] [Order article via Infotrieve]. 59. Heyn R, Khan F, Ensign LG, et al. Acute myeloid leukemia in patients treated for rhabdomyosarcoma with cyclophosphamide and low-dose etoposide on Intergroup Rhabdomyosarcoma Study III: an interim report. Med Pediatr Oncol. 1994;23:99-106[Medline] [Order article via Infotrieve]. 60. Sugita K, Furukawa T, Tsuchida M, et al. High frequency of etoposide-related secondary leukemia in children with non-Hodgkin's lymphoma. Am J Pediatr Hematol Oncol. 1993;15:99-104[Medline] [Order article via Infotrieve].
61.
Blanco JG, Dervieux T, Edick MJ, et al.
Molecular emergence of acute myeloid leukemia during treatment for acute lymphoblastic leukemia.
Proc Natl Acad Sci U S A.
2001;98:10338-10343 62. Gundestrup M, Klarskov AM, Sveinbjornsdottir E, et al. Cytogenetics of myelodysplasia and acute myeloid leukaemia in aircrew and people treated with radiotherapy. Lancet. 2000;356:2158[CrossRef][Medline] [Order article via Infotrieve].
63.
Deininger MW, Bose S, Gora-Tybor J, et al.
Selective induction of leukemia-associated fusion genes by high-dose ionizing radiation.
Cancer Res.
1998;58:421-425
64.
Hartmann LC, Tschetter LK, Habermann TM, et al.
Granulocyte colony-stimulating factor in severe chemotherapy-induced afebrile neutropenia.
N Engl J Med.
1997;336:1776-1780
© 2003 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  K. Schmiegelow, I. Al-Modhwahi, M. K. Andersen, M. Behrendtz, E. Forestier, H. Hasle, M. Heyman, J. Kristinsson, J. Nersting, R. Nygaard, et al. Methotrexate/6-mercaptopurine maintenance therapy influences the risk of a second malignant neoplasm after childhood acute lymphoblastic leukemia: results from the NOPHO ALL-92 study Blood, June 11, 2009; 113(24): 6077 - 6084. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. French, W. Yang, C. Cheng, S. C. Raimondi, C. G. Mullighan, J. R. Downing, W. E. Evans, C.-H. Pui, and M. V. Relling Acquired variation outweighs inherited variation in whole genome analysis of methotrexate polyglutamate accumulation in leukemia Blood, May 7, 2009; 113(19): 4512 - 4520. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Crawford, C. Caserta, F. Roila, and On behalf of the ESMO Guidelines Working Group Hematopoietic growth factors: ESMO Recommendations for the applications Ann. Onc., May 1, 2009; 20(suppl_4): iv162 - iv165. [Full Text] [PDF]
|
|
|
|
|
|
B. W. Robinson, N.-K. V. Cheung, C. P. Kolaris, S. C. Jhanwar, J. K. Choi, N. Osheroff, and C. A. Felix Prospective tracing of MLL-FRYL clone with low MEIS1 expression from emergence during neuroblastoma treatment to diagnosis of myelodysplastic syndrome Blood, April 1, 2008; 111(7): 3802 - 3812. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Leone, L. Pagano, D. Ben-Yehuda, and M. T. Voso Therapy-related leukemia and myelodysplasia: susceptibility and incidence Haematologica, October 1, 2007; 92(10): 1389 - 1398. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Hijiya, M. M. Hudson, S. Lensing, M. Zacher, M. Onciu, F. G. Behm, B. I. Razzouk, R. C. Ribeiro, J. E. Rubnitz, J. T. Sandlund, et al. Cumulative Incidence of Secondary Neoplasms as a First Event After Childhood Acute Lymphoblastic Leukemia JAMA, March 21, 2007; 297(11): 1207 - 1215. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. D. Dickerman The Late Effects of Childhood Cancer Therapy Pediatrics, March 1, 2007; 119(3): 554 - 568. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Hershman, A. I. Neugut, J. S. Jacobson, J. Wang, W.-Y. Tsai, R. McBride, C. L. Bennett, and V. R. Grann Acute Myeloid Leukemia or Myelodysplastic Syndrome Following Use of Granulocyte Colony-Stimulating Factors During Breast Cancer Adjuvant Chemotherapy J Natl Cancer Inst, February 7, 2007; 99(3): 196 - 205. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M.-C. Le Deley, F. Suzan, B. Cutuli, S. Delaloge, A. Shamsaldin, C. Linassier, S. Clisant, F. de Vathaire, P. Fenaux, and C. Hill Anthracyclines, Mitoxantrone, Radiotherapy, and Granulocyte Colony-Stimulating Factor: Risk Factors for Leukemia and Myelodysplastic Syndrome After Breast Cancer J. Clin. Oncol., January 20, 2007; 25(3): 292 - 300. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. Pelizzari, M. Drera, M. D'Adda, M. Ungari, D. Marocolo, F. Facchetti, D. Bellotti, S. Barlati, and G. Rossi Recombinant granulocyte-colony stimulating factor as treatment for poor prognosis oligoblastic acute myeloid leukemia in elderly patients Haematologica, January 1, 2007; 92(1): 106 - 109. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Bhatia, M. D. Krailo, Z. Chen, L. Burden, F. B. Askin, P. S. Dickman, H. E. Grier, M. P. Link, P. A. Meyers, E. J. Perlman, et al. Therapy-related myelodysplasia and acute myeloid leukemia after Ewing sarcoma and primitive neuroectodermal tumor of bone: a report from the Children's Oncology Group Blood, January 1, 2007; 109(1): 46 - 51. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. B. Travis The Epidemiology of Second Primary Cancers Cancer Epidemiol. Biomarkers Prev., November 1, 2006; 15(11): 2020 - 2026. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Holleman, M. L. den Boer, M. H. Cheok, K. M. Kazemier, D. Pei, J. R. Downing, G. E. Janka-Schaub, U. Gobel, U. B. Graubner, C.-H. Pui, et al. Expression of the outcome predictor in acute leukemia 1 (OPAL1) gene is not an independent prognostic factor in patients treated according to COALL or St Jude protocols Blood, September 15, 2006; 108(6): 1984 - 1990. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. J. Smith, J. Khatcheressian, G. H. Lyman, H. Ozer, J. O. Armitage, L. Balducci, C. L. Bennett, S. B. Cantor, J. Crawford, S. J. Cross, et al. 2006 Update of Recommendations for the Use of White Blood Cell Growth Factors: An Evidence-Based Clinical Practice Guideline J. Clin. Oncol., July 1, 2006; 24(19): 3187 - 3205. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Kaushansky Lineage-specific hematopoietic growth factors. N. Engl. J. Med., May 11, 2006; 354(19): 2034 - 2045. [Full Text] [PDF]
|
|
|
|
|
|
R. Bhatia, K. Van Heijzen, A. Palmer, A. Komiya, M. L. Slovak, K. L. Chang, H. Fung, A. Krishnan, A. Molina, A. Nademanee, et al. Longitudinal Assessment of Hematopoietic Abnormalities After Autologous Hematopoietic Cell Transplantation for Lymphoma J. Clin. Oncol., September 20, 2005; 23(27): 6699 - 6711. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. C. C. Rocha, C. Cheng, W. Liu, S. Kishi, S. Das, E. H. Cook, J. T. Sandlund, J. Rubnitz, R. Ribeiro, D. Campana, et al. Pharmacogenetics of outcome in children with acute lymphoblastic leukemia Blood, June 15, 2005; 105(12): 4752 - 4758. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Wolfler, S. J. Erkeland, C. Bodner, M. Valkhof, W. Renner, C. Leitner, W. Olipitz, M. Pfeilstocker, C. Tinchon, W. Emberger, et al. A functional single-nucleotide polymorphism of the G-CSF receptor gene predisposes individuals to high-risk myelodysplastic syndrome Blood, May 1, 2005; 105(9): 3731 - 3736. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. V. Relling, W. Yang, S. Das, E. H. Cook, G. L. Rosner, M. Neel, S. Howard, R. Ribeiro, J. T. Sandlund, C.-H. Pui, et al. Pharmacogenetic Risk Factors for Osteonecrosis of the Hip Among Children With Leukemia J. Clin. Oncol., October 1, 2004; 22(19): 3930 - 3936. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Kishi, W. Yang, B. Boureau, S. Morand, S. Das, P. Chen, E. H. Cook, G. L. Rosner, E. Schuetz, C.-H. Pui, et al. Effects of prednisone and genetic polymorphisms on etoposide disposition in children with acute lymphoblastic leukemia Blood, January 1, 2004; 103(1): 67 - 72. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C.-H. Pui, J. T. Sandlund, D. Pei, G. K. Rivera, S. C. Howard, R. C. Ribeiro, J. E. Rubnitz, B. I. Razzouk, M. M. Hudson, C. Cheng, et al. Results of Therapy for Acute Lymphoblastic Leukemia in Black and White Children JAMA, October 15, 2003; 290(15): 2001 - 2007. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2003 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
in the days immediately following etoposide
T polymorphism in the NAD(P)H:quinone oxidoreductase (NQO1) gene in patients with primary and therapy-related myeloid leukemia.
Blood.
1999;94:803-807