|
|
Prepublished online as a Blood First Edition Paper on February 20, 2003; DOI 10.1182/blood-2002-10-3059.
Previous Article | Table of Contents | Next Article 
Blood, 15 June 2003, Vol. 101, No. 12, pp. 5010-5013
NEOPLASIA Brief report
The CNS is a sanctuary for leukemic cells in mice receiving imatinib mesylate for Bcr/Abl-induced leukemia
Nicholas C. Wolff,
James A. Richardson,
Merrill Egorin, and
Robert L. Ilaria, Jr
From the Division of Hematology/Oncology, Department of Medicine, Simmons Cancer Center and the Hamon Center for Therapeutic Oncology Research, and the Department of Pathology, University of Texas Southwestern Medical Center, Dallas, TX; and the Departments of Medicine and Pharmacology, University of Pittsburgh Cancer Institute, Pittsburgh, PA.
 |
Abstract
|
|---|
The chronic myelogenous leukemia (CML)like myeloproliferative disorder observed in the BCR/ABL murine bone marrow transduction and transplantation model shares several features with the human disease, including a high response rate to the tyrosine kinase inhibitor imatinib mesylate (STI571). To study the impact of chronic imatinib mesylate treatment on the CML-like illness, mice were maintained on therapeutic doses of this drug and serially monitored. Unexpectedly, despite excellent systemic control of the CML-like illness, many of the mice developed progressive neurologic deficits after 2 to 4 months of imatinib mesylate therapy because of central nervous system (CNS) leukemia. Analysis of imatinib mesylate cerebral spinal fluid concentrations revealed levels 155- fold lower than in plasma. Thus, in the mouse, the limited ability of imatinib mesylate to cross the blood-brain barrier allowed the CNS to become a sanctuary for Bcr/Abl-induced leukemia. This model will be a useful tool for the future study of novel anti-CML drugs and in better defining the mechanisms for limited imatinib mesylate penetration into the CNS.
 |
Introduction
|
|---|
The murine BCR/ABL retroviral transduction and transplantation model of chronic myelogenous leukemia (CML) and Philadelphia chromosomepositive (Ph+) hematologic malignancies has provided important insights into the molecular pathophysiology of Bcr/Abl-induced leukemia. Although this mouse model is best known for the CML-like myeloproliferative disorder, Bcr/Abl-induced leukemias of the lymphoid and macrophage lineages have also been reported.1-5 With recent improvements in the retroviral transduction of CML target cells,5 however, 100% of mice die from the fulminant CML-like illness before they have the opportunity to manifest the acute lymphoblastic leukemia (ALL) or macrophage tumor diseases. Previously, we demonstrated that the tyrosine kinase inhibitor imatinib mesylate (STI571, Gleevec; Novartis, Basel, Switzerland) prolongs the survival of mice with CML-like myeloproliferative disorder, resulting in a disease closely resembling CML in chronic phase.6
Because of the marked efficacy of imatinib mesylate in humans with Ph+ hematologic malignancies,7-12 it is likely that a significant cohort of CML patients will be managed chronically on imatinib mesylate therapy.13 Imatinib mesylateresistant Ph+ leukemia has already been reported by several groups,14-18 but thus far it appears to be a relatively rare event. Whether imatinib mesylate will permanently control or even cure CML is unknown. To address these questions, mice reconstituted with BCR/ABL-transduced bone marrow (BM) cells were maintained chronically on imatinib mesylate and monitored by serial physical exam and peripheral blood counts. Unexpectedly, most mice developed focal neurologic signs indicative of central nervous system (CNS) leukemia.
 |
Study design
|
|---|
Murine BM retroviral transduction and transplantation
Lethally irradiated Balb/c mice (Charles River laboratories, Wilmington, MA) were reconstituted with syngeneic 5-fluorouracilprimed BM cells transduced with a replication-defective P210BCR/ABL retrovirus as previously described.6 Mice received 50 mg/kg imatinib mesylate every morning and 100 mg/kg every evening orally beginning on day 10 after BM reconstitution.6 Complete brain pathologic and necropsy analysis was performed on 8 mice.
Immunohistochemistry (IHC) and polymerase chain reaction (PCR)
Pathologic sections from brain, spinal cord, and liver were examined by routine hematoxylin and eosin (H&E) staining, or by IHC using anti-CD45R/B220 or anti-Mac3 antibodies (BD PharMingen, San Diego, CA) with appropriate isotype controls. To confirm the presence of BCR/ABL, pathologic sections from focal brain lesions or an adjacent region of unaffected brain were dissected using laser-capture microdissection19 and analyzed by PCR using the P210BCR/ABL primers (all 5' to 3'), AGGAAGATGATGAGTCTCCGGGG (forward) and TCACTGGGTCCAGCGAGAAGGT (reverse); and the ribosomal-associated protein L7 primers, GAAGCTCATCTATGAGAAGGC (forward) and L7 AAGACGAAGGAGCTGCAGAAC (reverse).
Analysis of mouse imatinib mesylate cerebral spinal fluid (CSF) and plasma concentrations
CSF samples were obtained from nonleukemic imatinib mesylatetreated or sham-treated mice as described.20 After CSF was obtained, plasma samples were obtained from the same animals by retro-orbital venipuncture. Concentrations of imatinib mesylate and its metabolite, CGP 74588, were determined by a validated high-pressure liquid chromatography (HPLC)/mass spectrometry (MS) assay.21
 |
Results and discussion
|
|---|
Many of the imatinib mesylatetreated CML mice developed focal and progressive neurologic signs, including altered posture, problems with coordination, and cranial nerve palsy (Figure 1A, upper), from day 56 to day 108 (46 and 98 days of imatinib mesylate treatment, respectively) after BM reconstitution (Figure 1A, lower). Besides modest peripheral blood granulocytosis and splenomegaly, the animals appeared clinically well.

View larger version (94K):
[in this window]
[in a new window]
|
Figure 1.. Clinical, pathological, and molecular characterization of Bcr/Abl-induced CNS leukemia. (A) A mouse with CML-like myeloproliferative disorder with right forelimb paresis and right ptosis that developed on imatinib mesylate therapy, and a timeline illustrating the onset of neurologic signs ( ; N=11). (B) H&Estained section of a parenchymal lesion in the cerebral cortex (i-ii) and a meningeal infiltrate in the Virchow Robin space (iii-iv; the associated blood vessel is shown at the large arrow) composed of cells with abundant cytoplasm and punctate nucleoli. Note occasional binucleated forms (ii, small arrow). AntiMac-3 IHC of the brain lesion (v) or a control section from the liver of a mouse with Bcr/Abl-induced macrophage leukemia (vi)1,2 confirms the cells are of the macrophage lineage. Scale bars are 50 µM. (C) A massive infiltration of the pyriform sinus (i-ii) and spinal cord meninges (iii-iv) by a homogeneous population of medium-sized cells with scant cytoplasm and indistinct nucleoli. AntiB-lymphoid cell antibody (CD45R/B220) staining of the pyriform mass (v) and control normal mouse spleen (vi) confirms the B-lymphoid cell lineage. Scale bars are 50 µM. (D) A laser-dissected brain lesion (right photomicrograph; lane 4) and an adjacent area of normal brain (acumbens) composed of small neurons (left photomicrograph; lane 3) were analyzed by PCR using primers specific for the P210BCR/ABL cDNA junction (B/A, top blot). For comparison, a section from the liver of a mouse with macrophage leukemia (lane 6) or normal liver (lane 5) was processed in the same fashion. 32D cells expressing P210 Bcr/Abl (lane 2) or neomycin alone (lane 1), or water only (), were amplified using the same primers. To control for equivalent specimen quality, samples were also analyzed using primers detecting expression of the ribosomal-associated gene L7. Sizes of the PCR products are shown at right. The results depicted were confirmed in 3 additional PCR experiments from 2 independent sets of tissue dissections. Original magnification, x 10.
|
|
The neurologic findings were not a direct neurotoxic effect of chronic imatinib mesylate treatment since an animal treated with the same regimen for 118 days was normal. Moreover, a synchronous cohort of mice receiving total body irradiation, followed by reconstitution with syngeneic vector-control BM cells and 7 months of imatinib mesylate treatment, also did not develop any signs of neurologic impairment (n = 3). Overall, of the 16 imatinib mesylatetreated CML mice studied, 13 developed definite focal neurologic physical findings, and 3 animals had suspicious but nondiagnostic neurologic signs, compared with 0 of 3 imatinib mesylatetreated mice reconstituted with vector control BM cells (P = .02, Fisher exact test). These findings suggested that the neurologic syndromes of mice with the CML-like myeloproliferative disorder on chronic imatinib mesylate therapy were unlikely to be explained by side effects of CNS radiation, imatinib mesylate, or the combination.
To determine the cause of the neurologic deficits, affected mice were examined by complete necropsy. Surprisingly, many of the animals had multifocal brain and meningeal mass lesions. These masses were composed of cells with abundant cytoplasm and an eccentrically placed nucleus (Figure 1Bi-ii), morphologic features of macrophages. Some cells appeared dysplastic, with prominent nucleoli and occasional binucleate forms (Figure 1Bii
[PDB]
, small arrow). Some mice had primarily parenchymal brain lesions, while others had isolated cellular infiltrates along the meningeal surface, often forming focal aggregates within the Virchow Robin spaces (Figure 1Biii-iv). Macrophage meningeal infiltrates were also observed along the spinal cord in some animals (data not shown). Analysis of these brain lesions by anti-MAC3 IHC confirmed the cells to be of the macrophage lineage (Figure 1Bv). Interestingly, the cells had the same morphology and IHC features as the previously described Bcr/Abl-induced macrophage tumor (Figure 1Bvi
[PDB]
).1,2 However, in contrast to mice with the macrophage tumor disease, animals receiving chronic imatinib mesylate therapy for murine CML had no evidence of macrophage infiltration outside of the CNS (data not shown).
In some cases, brain masses and spinal cord infiltrates were composed of smaller mononuclear cells with oval nuclei, prominent nucleoli, and scant cytoplasm, morphologic features of lymphoblasts (Figure 1C). These cells formed tumorlike lesions in brain parenchyma (Figure 1Ci-ii, pyriform sinus) and also infiltrated the meninges (Figure 1Ciii-iv). Immunostaining with anti-B220 (CD45) antibody confirmed the B-cell nature of these cellular infiltrates (Figure 1Cv). None of the imatinib mesylatetreated mice with CNS lymphoid infiltrates had evidence of peripheral blood lymphocytosis or adenopathy, as might be expected in murine Bcr/Abl-induced B-cell ALL (data not shown).
CNS leukemia and chloroma-like brain masses have not been previously reported in this murine CML model. To determine whether these cells were a manifestation of a Bcr/Abl-induced leukemia, a focal brain lesion (Figure 1D, right) was dissected from paraffin-embedded sections by laser-capture microdissection19 and examined by PCR for the presence of P210BCR/ABL. As a negative control, an adjacent, similarly sized area of normal brain (the acumbens) was analyzed (Figure 1D, left). BCR/ABL was readily detected in the focal brain lesions by PCR (Figure 1D, lane 4) but not detected in unaffected areas (Figure 1D, lane 3), confirming that the infiltrates represented a Bcr/Abl-induced CNS leukemia or chloroma.
The observation that mice developed CNS leukemia while otherwise experiencing excellent systemic response to imatinib mesylate suggested that imatinib mesylate did not penetrate across the blood-brain barrier. To test this hypothesis, a cohort of 9 mice were started on oral imatinib mesylate treatment for several days to ensure steady-state plasma drug concentrations, and parallel blood and CSF samples were obtained and analyzed for the concentration of imatinib mesylate and its metabolite CGP 74588.22 Because an average of only 15 to 20 µL CSF can be obtained from mice without risk of blood contamination,20 CSF samples were pooled and compared with the average plasma values of the entire cohort (Table 1).
Despite an average plasma imatinib mesylate concentration of 6958 ng/mL (11.8 µM, n = 9; some animals received an additional imatinib mesylate dose 4 to 5 hours after their previous dose to ensure adequate plasma levels at the time of CSF harvest), the concentration of imatinib mesylate in the CSF was only 45 ng/mL (0.08 µM), 155 times lower than in the plasma and 3-fold lower than the level required to achieve 50% inhibition of cellular Bcr/Abl-related tyrosine phosphorylation (0.25 µM).23 The poor penetration of imatinib mesylate into the CSF was not anticipated on the basis of the published data regarding this small-molecule kinase inhibitor. In fact, only one case report has been published concerning concentrations of imatinib mesylate in the CSF. In this report, a patient with CML in lymphoid blast crisis was treated with imatinib mesylate, and although an excellent systemic response was achieved, the patient experienced a lymphoid CNS relapse. Further investigation revealed a CSF imatinib mesylate concentration 2-log lower than in plasma,24 remarkably similar to what was found in our mouse study. These results suggest that the mechanism for limited imatinib mesylate CSF penetration may be shared across species.
The development of CNS lymphoid leukemia in some of our animals on chronic imatinib mesylate therapy shares some features in common with human Ph+ ALL, in which patients treated with imatinib mesylate alone would be considered at high risk for an isolated CNS relapse without appropriate intrathecal chemotherapy.25 Although the Bcr/Abl-induced macrophage tumor illness in mice does not have a known correlate in humans, the striking propensity for these cells to survive and proliferate in the brain led us to search for any evidence of other myeloid lineage cell involvement in the CNS. We found no evidence of granulocytic or myeloblast infiltration of the brain or spinal cord in any of our imatinib mesylatetreated mice, however; although a small aggregation of basophils was found in one animal. This suggests that although the CNS was a potential sanctuary site for malignant lymphoid and macrophage cells in our model, this site did not offer a suitable environment for the survival and expansion of myeloid progenitors responsible for the CML-like illness. Perhaps in humans, the CNS will also prove to be an unsuitable location for CML progenitors to survive and avoid therapeutic doses of imatinib mesylate.
In summary, we have demonstrated that the murine BM retroviral transduction and transplantation model of Bcr/Abl-induced leukemia shares yet another similarity with the human disease: the therapeutic agent imatinib mesylate has a quite limited ability to cross the blood-brain barrier. The feasibility of CSF drug measurements in this CML mouse may prove useful in defining the mechanisms for limited imatinib mesylate penetration across the blood-brain barrier in CNS leukemia and in the study of future anti-CML drugs.
 |
Acknowledgements
|
|---|
We thank Elisabeth Buchdunger, Sandra Silberman, and Jose Leis for helpful advice; Robert Parise for assistance with the HPLC/MS CSF and plasma analysis; Shashank Heda and Adi Gazdar for assistance with the laser-capture microdissection; John Shelton for preparing scaled photomicrographs; and David Holtzman for sharing details about mouse CSF harvest prior to publication. We also thank Richard Gaynor and John Minna for critical review of the manuscript.
 |
Footnotes
|
|---|
Submitted October 8, 2002;
accepted February 5, 2003.
Prepublished online as Blood First Edition Paper, February 20, 2003; DOI 10.1182/blood-2002-10-3059.
Supported by National Institutes of Health grant RO1 CA61764 and the Leukemia Association of North Central Texas.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Robert L. Ilaria Jr, Simmons Cancer Center, UT Southwestern Medical Center, 5323 Harry Hines Blvd, MC 8593, Dallas, TX 75390-8593; e-mail: rilari{at}mednet.swmed.edu.
 |
References
|
|---|
- Daley GQ, Van Etten RA, Baltimore D. Induction of chronic myelogenous leukemia in mice by the P210bcr/abl gene of the Philadelphia chromosome. Science. 1990;247: 824-830.[Abstract/Free Full Text]
- Elefanty AG, Hariharan IK, Cory S. bcr-abl, the hallmark of chronic myeloid leukemia in man, induces multiple hematopoietic neoplasms in mice. EMBO J. 1990;9: 1069-1078.[Medline]
[Order article via Infotrieve]
- Kelliher MA, McLaughlin J, Witte ON, Rosenberg N. Induction of a chronic myelogenous leukemia-like syndrome in mice with v-abl and bcr/abl. Proc Natl Acad Sci U S A. 1990;87: 6649-6653.[Abstract/Free Full Text]
- Gishizky MI, Johnson-White J, Witte ON. Efficient transplantation of BCR-ABL-induced chronic myelogenous leukemia-like syndrome in mice. Proc Natl Acad Sci U S A. 1993;90: 3755-3759.[Abstract/Free Full Text]
- Pear WS, Miller JP, Xu L, et al. Efficient and rapid induction of a chronic myelogenous leukemia-like myeloproliferative disease in mice receiving P210 bcr/abl-transduced bone marrow. Blood. 1998;92: 3780-3792.[Abstract/Free Full Text]
- Wolff NC, Ilaria RL Jr. Establishment of a murine model for therapy-treated chronic myelogenous leukemia using the tyrosine kinase inhibitor STI571. Blood. 2001;98: 2808-2816.[Abstract/Free Full Text]
- Druker BJ, Sawyers CL, Kantarjian H, et al. Activity of a specific inhibitor of the BCR-ABL tyrosine kinase in the blast crisis of chronic myeloid leukemia and acute lymphoblastic leukemia with the Philadelphia chromosome. N Engl J Med. 2001;344: 1038-1042.[Abstract/Free Full Text]
- Druker BJ, Talpaz M, Resta DJ, et al. Efficacy and safety of a specific inhibitor of the BCR-ABL tyrosine kinase in chronic myeloid leukemia. N Engl J Med. 2001;344: 1031-1037.[Abstract/Free Full Text]
- Sawyers CL, Hochhaus A, Feldman E, et al. Imatinib induces hematologic and cytogenetic responses in patients with chronic myelogenous leukemia in myeloid blast crisis: results of a phase II study. Blood. 2002;99: 3530-3539.[Abstract/Free Full Text]
- Talpaz M, Silver RT, Druker BJ, et al. Imatinib induces durable hematologic and cytogenetic responses in patients with accelerated phase chronic myeloid leukemia: results of a phase 2 study. Blood. 2002;99: 1928-1937.[Abstract/Free Full Text]
- Kantarjian H, Sawyers C, Hochhaus A, et al. Hematologic and cytogenetic responses to imatinib mesylate in chronic myelogenous leukemia. N Engl J Med. 2002;346: 645-652.[Abstract/Free Full Text]
- Kantarjian HM, Cortes J, O'Brien S, et al. Imatinib mesylate (STI571) therapy for Philadelphia chromosome-positive chronic myelogenous leukemia in blast phase. Blood. 2002;99: 3547-3553.[Abstract/Free Full Text]
- Goldman JM, Druker BJ. Chronic myeloid leukemia: current treatment options. Blood. 2001;98: 2039-2042.[Abstract/Free Full Text]
- Gorre ME, Mohammed M, Ellwood K, et al. Clinical resistance to STI-571 cancer therapy caused by BCR-ABL gene mutation or amplification. Science. 2001;293: 876-880.[Abstract/Free Full Text]
- Barthe C, Cony-Makhoul P, Melo JV, Mahon JR. Roots of clinical resistance to STI-571 cancer therapy [letter]. Science. 2001;293: 2163.[CrossRef][Medline]
[Order article via Infotrieve]
- Hochhaus A, Kreil S, Corbin A, et al. Roots of clinical resistance to STI-571 cancer therapy. Science [letter]. 2001;293: 2163.
- von Bubnoff N, Schneller F, Peschel C, Duyster J. BCR-ABL gene mutations in relation to clinical resistance of Philadelphia-chromosome-positive leukaemia to STI571: a prospective study. Lancet. 2002;359: 487-491.[CrossRef][Medline]
[Order article via Infotrieve]
- Hofmann WK, Jones LC, Lemp NA, et al. Ph(+) acute lymphoblastic leukemia resistant to the tyrosine kinase inhibitor STI571 has a unique BCR-ABL gene mutation. Blood. 2002;99: 1860-1862.[Abstract/Free Full Text]
- Bonner RF, Emmert-Buck M, Cole K, et al. Laser capture microdissection: molecular analysis of tissue. Science. 1997;278: 1481-1483.[Free Full Text]
- DeMattos RB, Bales KR, Parsadanian M, et al. Plaque-associated disruption of CSF and plasma amyloid-beta (Abeta) equilibrium in a mouse model of Alzheimer's disease. J Neurochem. 2002;81: 229-236.[CrossRef][Medline]
[Order article via Infotrieve]
- Parise RA, Ramanathan RK, Hayes MJ, Egorin MJ. A sensitive high-performance liquid chromatography-mass spectrometry assay for quantitation of imatinib and its main metabolite (CGP 74588) in plasma. J Chromatology B. In press.
- Bakhtiar R, Khemani L, Hayes M, Bedman T, Tse F. Quantification of the anti-leukemia drug STI571 (Gleevec) and its metabolite (CGP 74588) in monkey plasma using a semi-automated solid phase extraction procedure and liquid chromatography-tandem mass spectrometry. J Pharm Biomed Anal. 2002;28: 1183-1194.[CrossRef][Medline]
[Order article via Infotrieve]
- Druker BJ, Tamura S, Buchdunger E, et al. Effects of a selective inhibitor of the Abl tyrosine kinase on the growth of Bcr-Abl positive cells. Nat Med. 1996;2: 561-566.[CrossRef][Medline]
[Order article via Infotrieve]
- Petzer AL, Gunsilius E, Hayes M, et al. Low concentrations of STI571 in the cerebrospinal fluid: a case report. Br J Haematol. 2002;117: 623-625.[CrossRef][Medline]
[Order article via Infotrieve]
- Leis JF, Stepan DE, Curtin PT, et al. Low penetration of Imatinib (STI571) into the CSF indicates the need for standard CNS prophylaxis in patients with CML in lymphoid blast crisis and Philadelphia chromosome positive AL [abstract]. Blood. 2001;98: 140a.

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
N. Larmonier, N. Janikashvili, C. J. LaCasse, C. B. Larmonier, J. Cantrell, E. Situ, T. Lundeen, B. Bonnotte, and E. Katsanis
Imatinib Mesylate Inhibits CD4+CD25+ Regulatory T Cell Activity and Enhances Active Immunotherapy against BCR-ABL- Tumors
J. Immunol.,
November 15, 2008;
181(10):
6955 - 6963.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. R. Alvarez, A. Klein, J. Castro, G. I. Cancino, J. Amigo, M. Mosqueira, L. M. Vargas, L. F. Yevenes, F. C. Bronfman, and S. Zanlungo
Imatinib therapy blocks cerebellar apoptosis and improves neurological symptoms in a mouse model of Niemann-Pick type C disease
FASEB J,
October 1, 2008;
22(10):
3617 - 3627.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. I. Cancino, E. M. Toledo, N. R. Leal, D. E. Hernandez, L. F. Yevenes, N. C. Inestrosa, and A. R. Alvarez
STI571 prevents apoptosis, tau phosphorylation and behavioural impairments induced by Alzheimer's {beta}-amyloid deposits
Brain,
September 1, 2008;
131(9):
2425 - 2442.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Porkka, P. Koskenvesa, T. Lundan, J. Rimpilainen, S. Mustjoki, R. Smykla, R. Wild, R. Luo, M. Arnan, B. Brethon, et al.
Dasatinib crosses the blood-brain barrier and is an efficient therapy for central nervous system Philadelphia chromosome-positive leukemia
Blood,
August 15, 2008;
112(4):
1005 - 1012.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. T. Williams, W. den Besten, and C. J. Sherr
Cytokine-dependent imatinib resistance in mouse BCR-ABL+, Arf-null lymphoblastic leukemia
Genes & Dev.,
September 15, 2007;
21(18):
2283 - 2287.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P Raanani, O Shpilberg, and I Ben-Bassat
Extramedullary disease and targeted therapies for hematological malignancies--is the association real?
Ann. Onc.,
January 1, 2007;
18(1):
7 - 12.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Yokota, S. Kimura, S. Masuda, E. Ashihara, J. Kuroda, K. Sato, Y. Kamitsuji, E. Kawata, Y. Deguchi, Y. Urasaki, et al.
INNO-406, a novel BCR-ABL/Lyn dual tyrosine kinase inhibitor, suppresses the growth of Ph+ leukemia cells in the central nervous system, and cyclosporine A augments its in vivo activity
Blood,
January 1, 2007;
109(1):
306 - 314.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. J. Kim, C. W. Jung, K. Kim, J. S. Ahn, W. S. Kim, K. Park, Y. H. Ko, W. K. Kang, and K. Park
Isolated Blast Crisis in CNS in a Patient With Chronic Myelogenous Leukemia Maintaining Major Cytogenetic Response After Imatinib
J. Clin. Oncol.,
August 20, 2006;
24(24):
4028 - 4029.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Koptyra, R. Falinski, M. O. Nowicki, T. Stoklosa, I. Majsterek, M. Nieborowska-Skorska, J. Blasiak, and T. Skorski
BCR/ABL kinase induces self-mutagenesis via reactive oxygen species to encode imatinib resistance
Blood,
July 1, 2006;
108(1):
319 - 327.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Ye, N. Wolff, L. Li, S. Zhang, and R. L. Ilaria Jr
STAT5 signaling is required for the efficient induction and maintenance of CML in mice
Blood,
June 15, 2006;
107(12):
4917 - 4925.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Nieborowska-Skorska, G. Hoser, L. Rink, M. Malecki, P. Kossev, M. A. Wasik, and T. Skorski
Id1 transcription inhibitor-matrix metalloproteinase 9 axis enhances invasiveness of the breakpoint cluster region/abelson tyrosine kinase-transformed leukemia cells.
Cancer Res.,
April 15, 2006;
66(8):
4108 - 4116.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. C. Wolff, D. R. Veach, W. P. Tong, W. G. Bornmann, B. Clarkson, and R. L. Ilaria Jr
PD166326, a novel tyrosine kinase inhibitor, has greater antileukemic activity than imatinib mesylate in a murine model of chronic myeloid leukemia
Blood,
May 15, 2005;
105(10):
3995 - 4003.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. L. Ilaria Jr.
Pathobiology of Lymphoid and Myeloid Blast Crisis and Management Issues
Hematology,
January 1, 2005;
2005(1):
188 - 194.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. A. Thomas, S. Faderl, J. Cortes, S. O'Brien, F. J. Giles, S. M. Kornblau, G. Garcia-Manero, M. J. Keating, M. Andreeff, S. Jeha, et al.
Treatment of Philadelphia chromosome-positive acute lymphocytic leukemia with hyper-CVAD and imatinib mesylate
Blood,
June 15, 2004;
103(12):
4396 - 4407.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. C. Wolff, D. E. Randle, M. J. Egorin, J. D. Minna, and R. L. Ilaria Jr.
Imatinib Mesylate Efficiently Achieves Therapeutic Intratumor Concentrations in Vivo but Has Limited Activity in a Xenograft Model of Small Cell Lung Cancer
Clin. Cancer Res.,
May 15, 2004;
10(10):
3528 - 3534.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Neville, R. A. Parise, P. Thompson, A. Aleksic, M. J. Egorin, F. M. Balis, L. McGuffey, C. McCully, S. L. Berg, and S. M. Blaney
Plasma and Cerebrospinal Fluid Pharmacokinetics of Imatinib after Administration to Nonhuman Primates
Clin. Cancer Res.,
April 1, 2004;
10(7):
2525 - 2529.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Beppu, J. Jaboine, M. S. Merchant, C. L. Mackall, and C. J. Thiele
Effect of Imatinib Mesylate on Neuroblastoma Tumorigenesis and Vascular Endothelial Growth Factor Expression
J Natl Cancer Inst,
January 7, 2004;
96(1):
46 - 55.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. N. Rich, D. A. Reardon, T. Peery, J. M. Dowell, J. A. Quinn, K. L. Penne, C. J. Wikstrand, L. B. Van Duyn, J. E. Dancey, R. E. McLendon, et al.
Phase II Trial of Gefitinib in Recurrent Glioblastoma
J. Clin. Oncol.,
January 1, 2004;
22(1):
133 - 142.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|