|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Prepublished online as a Blood First Edition Paper on October 10, 2002; DOI 10.1182/blood-2002-08-2404.
GENE THERAPY
From the Department of Pediatrics, Herman B Wells
Center for Pediatric Research, Departments of Biochemistry,
Microbiology/Immunology, Pathology, and Medicine, Walther Oncology
Center, Indiana University School of Medicine, Indianapolis, IN; and
Walther Cancer Institute, Indianapolis, IN.
Fanconi anemia (FA) is a chromosomal instability disorder
characterized by a progressive bone marrow (BM) failure and an
increased incidence of myeloid leukemias. Children with FA are
currently being enrolled in clinical trials to evaluate the safety of
retroviral-mediated gene transfer. Previously, we used
Fancc Fanconi anemia (FA) is a heterogeneous autosomal
recessive disorder manifested by congenital malformations, bone marrow
(BM) failure, clonal hematopoietic disorders including myelodysplasia, and malignancies, especially acute myelogenous
leukemia.1-5 Although multiple organ systems are affected
by the loss of FA protein function, the major causes of morbidity and
mortality of FA relate to the hematopoietic disease, with 80% of
patients dying from BM failure. In addition, 10% of FA patients
develop myeloid leukemias, with a mean age of death being 19 years.3 Currently, the only definitive treatment for the
hematologic manifestations of FA is HLA-identical hematopoietic stem
cell (HSC) transplantation. There are 7 cDNAs corresponding to distinct
FA complementation types that have been cloned (FANCA,
FANCC, FANCD2, FANCE, FANCF, FANCG, and
BRCA2),6-13 raising the potential of using gene
transfer technology to introduce a functional cDNA into autologous
stem cells.
An initial phase 1 trial designed to evaluate the safety of
gene transfer for FA patients did not result in long-term hematopoietic reconstitution with genetically corrected stem cells in 4 FA
complementation type C (FA-C) patients.14 Although it is
difficult to assess why long-term reconstitution of transduced cells
was not observed, potential explanations include decreased survival of
HSCs during ex vivo culture, low HSC transduction efficiency, inability
of transduced HSCs to engraft and outcompete endogenous HSCs, and/or insufficient retroviral-mediated FANCC expression to correct long-term repopulating ability. In other systems, murine models have provided significant advancements in answering basic questions related to
transduction and expression of retroviral-mediated transgenes in HSCs
as well as the impact of gene transfer on HSC proliferation and
self-renewal potential. The availability of murine models deficient in
FA protein expression are especially valuable to evaluate HSC function
before and after gene replacement therapy, since in vivo reconstitution
represents the only universally accepted functional assay for HSCs.
Two recent studies examined whether retroviral-mediated gene transfer
of Fancc restored normal sensitivity to genotoxins 4 to 6 months after transplantation.15,16 These data showed that transduced repopulating cells had increased resistance to genotoxins, including mitomycin C (MMC). However, no data are available examining the potential of recombinant Fancc (rFancc) to restore HSC
repopulating ability, a key physiologic function critical for
successful treatment of BM failure in FA-C patients. In addition, no
data are available evaluating the potential of gene transfer technology
to prevent clonal hematopoietic disorders in FA.
Previously, we and others established that HSCs from
Fancc Mouse colonies
Retroviral constructs
High-titer stable ecotropic packaging lines for MSCVpac, MSCV-EGFP, and
MSCV-Fancc were established as previously described for
MFG-FAC,19 except selection was conducted using either
puromycin resistance or EGFP expression. Retroviral supernatants were
collected from packaging cells once 80% confluent and stored at
Transduction protocol To obtain sufficient numbers of cells for competitive repopulation experiments, BM cells were harvested from 20 to 30 Fancc / mice and 6-10 WT mice for each of the
3 experiments. The transduction protocol was as previously described
with minor modifications.19,21,22 Low-density cells
(Ficoll-Hypaque density 1.119; Sigma, St Louis, MO) were prestimulated
with 200 units/mL human (h)IL-6 and 100 ng/mL murine stem cell factor
(mSCF) (Peprotech, Rocky Hill, NJ) for 48 hours. After prestimulation,
cells were transduced on recombinant human fibronectin fragment CH-296,
RetroNectin (a generous gift from TAKARA BIO, Otsu, Japan) as
previously described.19,21,22 Fancc/ cells were transduced with either a
control retrovirus (MSCVpac or MSCV-EGFP) or a retrovirus encoding
rFancc (MFG-FAC or MSCV-Fancc), and WT cells were transduced with a
control retrovirus only. An aliquot of cells from each transduction
group was plated in progenitor assays with MMC as previously
described,23 while the majority of transduced cells were
either directly transplanted into lethally irradiated recipients or
used in competitive repopulation assays.
Competitive repopulation assays/secondary transplants Four independent competitive repopulation experiments were conducted similar to previous methods.17 Experiments 1 to 3 used transduced cell populations as donor cells: (1) WT cells transduced with control virus; (2) Fancc/
cells transduced with control virus, and (3)
Fancc/ cells transduced with a retrovirus
containing either the human or (4) murine Fancc cDNA. One to
two million cells from each of the 3 test cell populations were mixed
with a common pool of B6.BoyJ low-density competitors
(3-7 × 105 cells) that had been prestimulated with hIL-6
and mSCF for 48 to 72 hours. Experiment 4 used
Fancc/ and WT cells that had either been
freshly isolated or cultured for 4 days with hIL-6 and mSCF. In order
to obtain approximately equivalent levels of donor chimerism in mice
transplanted with freshly isolated cells, a 6:1 test-to-competitor cell
ratio was used for recipients transplanted with
Fancc/ test cells and a 3:1
test-to-competitor cell ratio for mice transplanted with WT test cells.
Each cell mixture was resuspended in 0.5 mL Iscove modified Dulbecco medium (IMDM; GIBCO BRL, Gaithersburg, MD), 20% fetal calf serum (FCS) (Hyclone Laboratories, Logan, UT), and injected into the tail vein of 5 to 8 lethally irradiated recipients. Six mice were transplanted with only competitor cells (CD45.1+) to ensure that donor chimerism measurements (CD45.2+) were not contaminated by endogenous hematopoiesis from lethally irradiated C57Bl/6J recipients (CD45.2+). CD45.1 and CD45.2 chimerism were analyzed as previously described.17 Mean donor chimerism were analyzed using a Mann-Whitney nonparametric test to evaluate for significant differences between transduction groups. A Fisher exact test was used to determine whether the number of mice that exhibited high chimerism was different between transduction groups. Secondary transplants were conducted using unfractionated BM cells
harvested from 2 to 3 primary recipients in each of the 4 experimental
groups from experiment 3: control Fancc Progenitor assays using BM from mice receiving transplants Low-density cells (density, 1.119 g/mL) were harvested from selected primary recipients in experiment 2 to examine MMC and inhibitory cytokine sensitivity in progenitors. Chimeric BM cells were stained with CD45.2-fluorescein isothiocyanate (PharMingen, San Diego, CA). Cells were washed, resuspended in cold phosphate-buffered saline (PBS) 0.1% bovine serum albumin (BSA), and sorted for CD45.2+ cells using a Becton Dickinson FACSTAR sorter (San Jose, CA) to purify donor cells and exclude competitor cells from progenitor assays. Sorted CD45.2+ cells were plated in the absence or presence of either MMC (10-200 nM), IFN-
(10 ng/mL), TNF- (10 ng/mL), or MIP-1 (50 ng/mL) as previously
described.23 In addition, the proportion of
CD45.2+ progenitors in S phase was estimated using
3H-thymidine suicide assays as previously
described.23
Histologic analysis of femur/spleen The spleen and one long bone from selected mice were collected and fixed in 1% formaldehyde at room temperature for 6 hours and then embedded in paraffin. Hematoxylin and eosin (H&E) staining was performed using routine methods. All antibodies and immunohistochemical reagents were purchased from DAKO (Carpinteria, CA) unless otherwise specified. Immunohistochemical staining of spleen sections was performed with antibodies that identify myeloid cells (myeloperoxidase and lysozyme), T lymphocytes (CD3), and B lymphocytes (B220; PharMingen). Spleen slides were treated with 3% H2O2 for 15 minutes and then incubated with primary antibodies to either myeloperoxidase (5 minutes), lysozyme (10 minutes), CD3 (30 minutes), or B220 (30 minutes). Slides were then stained with secondary rabbit anti-human antibody for 5 minutes, incubated with streptavidin conjugated to horseradish peroxidase (10 minutes), followed by diaminobenzidine (DAB) treatment (5 minutes) and counterstaining with diluted hematoxylin. All slides were evaluated by an experienced hematopathologist (Dr Attilio Orazi), who was blinded to experimental treatment groups.Polyclonal antibody production Polyclonal antibodies were developed in female New Zealand rabbits against a synthetic peptide RSEKLARELLKELRTQV corresponding to carboxy terminal residues of human FANCC (amino acids 541-558) containing a cysteine residue on both the N- and C-termini for coupling. The peptide was coupled to keyhole limpet hemocyanin (KLH) as described by the manufacturer (Pierce Chemical, Rockford, IL). The rabbits were given a primary injection of 0.25 mg peptide-KLH emulsified in Freund complete adjuvant and subsequently injected with 0.1 mg peptide-KLH emulsified in Freund incomplete adjuvant at 2-week intervals. Rabbit serum was analyzed for reactive antibody against both human and murine Fancc by Western blotting. The antibody was purified by column chromatography using the peptide as the antigen.Western blotting Whole cell lysates were obtained from 5 × 106 BM cells and quantitated using a bicinchoninic (BCA) assay (Pierce Chemical). Whole cell lysates from Fancc/
murine embryonic fibroblasts transduced with MSCV-Fancc were used as a
positive control. Equivalent amounts of protein (100 µg) from BM
samples were loaded on a 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel and transferred onto a
nitrocellulose membrane. Membranes were blocked with Tris-buffered
saline (TBS) Tween containing 5% nonfat milk for 1 hour. For
immunodetection of Fancc protein, rabbit anti-Fancc antibody was used
at a 1:100 dilution for one hour, and the secondary antibody,
anti-rabbit-horseradish peroxidase (HRP) (Amersham
Biosciences, Piscataway, NJ) was used at a 1:1000 dilution for 1 hour
before visualizing by chemiluminescence (Amersham Biosciences). Equal
protein loading was documented by using  -actin as an internal control.
Semiquantitative PCR HEL cells were transduced with a limiting dilution of retroviral supernatant to obtain a single integration per transduced cell. EGFP-positive cells were sorted by fluorescence cytometry and expanded to use as a standard for dilutional PCR. Genomic DNA was isolated from HEL and "test" peripheral blood cells using a Puregene DNA isolation kit (Gentra Systems, Minneapolis, MN). Ten nanograms of DNA from the "test" sample were amplified using EGFP-specific primers (forward primer 5'GAAGTTCATCTGCACCACCGGCAA3' and reverse primer 5'TAGTGGTTGTCGGGCAGCAGCACG3'). In addition, the single copy standard DNA was diluted 1:5, 1:10, 1:50, 1:100, and 1:500 before amplification to compare "test" DNA signal. Each sample was amplified for 30 cycles (94°C for 60 seconds, 64°C for 60 seconds, and 72°C for 60 seconds). Amplified PCR products were run on a 1% agarose gel and assessed for the intensity of the 468-base pair (bp) band similar to previously described methods.24-26
Expression of rFancc in Fancc / cells were transduced with one of 2 recombinant retroviruses encoding the Fancc transgene and
transplanted into lethally irradiated, WT mice. Six months following
transplantation, BM cells were evaluated for Fancc expression by
Western blotting, and colony assays were conducted to examine whether
introduction of the Fancc transgene into BM progenitors from
reconstituted mice corrected MMC hypersensitivity. One of 4 representative Western blots showed that BM harvested from a mouse
transplanted with Fancc/ cells transduced
with MSCV-Fancc clearly expressed rFancc (Figure 1A, lane 2), while BM from a mouse
transplanted with Fancc/ cells transduced
with a control virus did not (lane 3). Furthermore, BM progenitors from
all mice transplanted with Fancc/ cells
transduced with MSCV-Fancc displayed a normal sensitivity to MMC
equivalent to that observed in progenitors from mice transplanted with
WT cells transduced with the control virus (Figure 1B). Similar results
were obtained when Fancc/ cells were
transduced with MFG-FAC (data not shown). Consistent with previous
studies using other constructs,15,16 these data suggest
that the Fancc transgene was introduced into long-term reconstituting cells and was sufficiently expressed in progeny cells to
correct the characteristic hypersensitivity to bifunctional alkylating
agents such as MMC.
Ex vivo culture and transplantation of control
Fancc / HSCs
have a marked reduction in repopulating ability compared to WT
HSCs.17 To determine whether the repopulating defect could be corrected via expression of rFancc,
Fancc/ BM cells were transduced with a
retrovirus encoding Fancc or, alternatively, a reporter gene
and used as donor cells in competitive repopulation studies. Donor
cells (CD45.2+) from each transduction group were
cotransplanted into irradiated recipients with a common pool of
syngeneic competitor cells (CD45.1+, Figure
2). Peripheral blood chimerism of
transplanted mice was evaluated by fluorescence cytometry. Three
independent experiments were conducted with similar results. Table
1 summarizes retroviral vectors that were
used in each experiment, and the number of mice receiving transplants
for each transduction group.
Donor chimerism of individual recipients from all experiments were
analyzed 6 months following transplant (Figure
3). As expected, mean donor chimerism of
mice transplanted with Fancc
The elevated chimerism in the 7 animals in the
Fancc expression protects primary and secondary recipients from developing aberrant hematopoiesis To determine whether the observed abnormalities in reconstitution predisposed mice to develop BM failure or clonal hematopoietic disorders, mice from experiments 1 to 3 were analyzed for evidence of hematologic alterations in primary or secondary recipients. Mice in experiment 1 were analyzed as primary recipients 6 months following transplantation. These studies revealed that peripheral blood counts and BM cellularity of all mice were unremarkable between transduction groups. However, the mouse transplanted with / control cells and
97% chimerism (Figure 3, mouse 1; Table 2) developed splenomegaly (198 mg vs
normal transplanted mice 102 ± 11 mg), although the histology was
normal (data not shown).
We hypothesized that 6 months may be insufficient time after
transplantation for the evolution of BM failure or
myelodysplasia/leukemia. To determine whether the high aberrant
chimerism in control Fancc
The increase in chimerism in mice 3 to 6 suggested that
Fancc To examine whether the aberrant chimerism predisposed mice 3, 5, and 6 to develop hematologic defects, mice in experiment 2 were killed 16 months following transplantation, and peripheral blood counts (red blood cells [RBCs], white blood cells [WBCs] with differential, and platelets), BM cellularity, spleen weight, and BM and spleen histology were examined. Abnormal hematologic findings were detected only in mice with high chimerism (summarized in Table 2). Mouse 3 displayed pancytopenia with reduced BM cellularity (BM cellularity 4.6 × 106 cells compared to +/+ control 38.4 ± 0.8 × 106 cells/2 femurs) and splenomegaly (spleen weight, 217 mg). Histologic examination revealed a hypoplastic BM (Figure 6C-D) and a high proportion of immature myeloid precursors in the spleen with loss of normal splenic architecture (Figure 6E-F). Mouse 5 displayed profound splenomegaly (spleen weight, 228 mg) with normal BM and spleen histology. Histologic analysis of mouse 6 demonstrated a profound myeloid hyperplasia associated with discrete areas of myelofibrosis (demonstrated by increased reticulin staining), containing immature appearing myeloid cells (Figure 6G-J). Collectively, these data suggest that ex vivo culture provided an environment for the evolution of clones with adaptive mutations increasing the risk of transplanted mice to develop hematopoietic defects that are reminiscent of human FA hematologic manifestations. Mice from experiment 3 were used for secondary
transplant studies 8 months after ex vivo culture and transplantation
to address 3 experimental questions. First, was the secondary
repopulating defect of Fancc
Consistent with previously published data,18 chimerism of
most secondary recipients transplanted with BM cells from mice in the
To evaluate secondary recipients for evidence of hematologic defects,
peripheral blood counts (RBCs, WBCs with differentials, and platelets),
BM cellularity, spleen weight, and BM and spleen histology were
examined in 3 secondary recipients from each of the 4 experimental
groups (
Infusing autologous gene-corrected HSCs is a potential therapy for multiple diseases affecting the hematopoietic system. FA is an excellent candidate disease to assess the feasibility and effectiveness of gene therapy, since gene-corrected HSC should have a selective advantage over mutant endogenous stem cells. Theoretically, this competitive advantage should allow progeny from the gene-corrected HSC to reconstitute the entire hematopoietic system, thus preventing the hematologic manifestations of FA. In initial studies, we addressed the improvement in
Fancc Expression of rFancc in Fancc An intriguing observation, reproducible in 4 independent experiments
but not detected in competitive repopulation experiments conducted with
fresh BM cells (Figure 4, and Haneline et al17), was that
Fancc Since the loss of Fancc leads to a profound proapoptotic
phenotype in human and murine hematopoietic cells,23,33
and Fancc It is also conceivable that the chromosomal instability inherent to FA
cells led to secondary mutations during ex vivo culture with
pharmacologic doses of cytokines that stimulate cells to proliferate.
Several laboratories have shown that an accumulation of mutations is
required for progression to myelodysplasia or leukemia.35
Our data show that while ex vivo culture increased the risk of
transplanted mice to develop aberrant hematopoietic phenotypes, an
extended period of evaluation in primary and/or secondary recipients
(16 months) was required before detecting histologic changes. These
data suggest that either additional mutations are occurring in vivo,
allowing for an accumulation of mutations over time, or alternatively
that the mutations incurred during in vitro culture required several
months after transplantation before altering normal BM/spleen
histology. Collectively, these data provide an experimental model
system to utilize Fancc Additionally, Fancc In summary, our data show that transduction of rFancc into
Fancc
The authors gratefully acknowledge Dr Manuel Buchwald (Hospital for
Sick Children, University of Toronto) for providing the Fancc
+/
Submitted August 8, 2002; accepted September 26, 2002.
Prepublished online as Blood First Edition Paper, October 10, 2002; DOI 10.1182/blood-2002-08-2404.
Supported by US Public Health Services grants P01 HL53586, P30 DK49218, R01 HL63219, R01 HL56416, and K08 HLDK04071-01 and the American Cancer Society no. IRG-84-002-16.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Laura S. Haneline, Cancer Research Institute, 1044 W Walnut Street, Room 476, Indianapolis, IN 46202-5254; e-mail: lhanelin{at}iupui.edu.
1. Fanconi G. Familial constitutional panmyelocytopathy, Fanconi anemia (F.A.). Sem in Hem. 1967;4:233-240 2. Liu J. Fanconi's anemia. In: Young NS, ed. Bone Marrow Failure Syndromes. Philadelphia, PA: WB Saunders; 2000:47-68. 3. Alter B, Young N. The bone marrow failure syndromes. In: Nathan D,Oski F, eds. Hematology of Infancy and Childhood Vol 1. 5th ed. Philadelphia, PA: WB Saunders; 1998:27-335. 4. Auerbach A, Verlander P. Disorders of DNA replication and repair. Cur Opin in Pediatr. 1997;9:600-616.
5.
D'Andrea A, Grompe M.
Molecular biology of Fanconi anemia: implications for diagnosis and therapy.
Blood.
1997;90:1725-1736 6. Apostolou S, Whitmore S, Crawford J, et al. Consortium: TFABC. Positional cloning of the Fanconi anaemia group A gene. Nat Genet. 1996;14:324-328[CrossRef][Medline] [Order article via Infotrieve]. 7. Lo Ten Foe J, Rooimans M, Bosnoyan-Collins L, et al. Expression cloning of a cDNA for the major Fanconi anaemia gene, FAA. Nat Genet. 1996;14:320-323[CrossRef][Medline] [Order article via Infotrieve]. 8. Strathdee C, Gavish H, Shannon W, Buchwald M. Cloning of cDNAs for Fanconi's anaemia by functional complementation. Nature. 1992;356:763-767[CrossRef][Medline] [Order article via Infotrieve]. 9. Timmers C, Taniguchi T, Hejna J, et al. Positional cloning of a novel Fanconi anemia gene, FANCD2. Mol Cell. 2001;7:241-248[CrossRef][Medline] [Order article via Infotrieve]. 10. de Winter JP, Leveille F, van Berkel M, et al. Isolation of a cDNA representing the Fanconi Anemia Complementation Group E gene. Am J Hum Genet. 2000;67. 11. de Winter JP, Rooimans MA, van Der Weel L, et al. The Fanconi anaemia gene FANCF encodes a novel protein with homology to ROM. Nat Genet. 2000;24:15-16[CrossRef][Medline] [Order article via Infotrieve]. 12. de Winter J, Waisfisz Q, Rooimans M, et al. The Fanconi anaemia group G gene FANCG is identical with XRCC9. Nat Genet. 1998;20:281-283[CrossRef][Medline] [Order article via Infotrieve]. 13. Howlett NG, Taniguchi T, Olson S, et al. Biallelic inactivation of BRCA2 in Fanconi anemia. Science. 2002;13:13. 14. Liu JM, Kim S, Read EJ, et al. Engraftment of hematopoietic progenitor cells transduced with the Fanconi anemia group C gene (FANCC). Hum Gene Ther. 1999;10:2337-2346[CrossRef][Medline] [Order article via Infotrieve].
15.
Gush KA, Fu KL, Grompe M, Walsh CE.
Phenotypic correction of Fanconi anemia group C knockout mice.
Blood.
2000;95:700-704 16. Noll M, Bateman RL, D'Andrea AD, Grompe M. Preclinical protocol for in vivo selection of hematopoietic stem cells corrected by gene therapy in Fanconi anemia group C. Mol Ther. 2001;3:14-23[CrossRef][Medline] [Order article via Infotrieve].
17.
Haneline LS, Gobbett TA, Ramani R, et al.
Loss of FancC function results in decreased hematopoietic stem cell repopulating ability.
Blood.
1999;94:1-8 18. Carreau M, Gan OI, Liu L, Doedens M, Dick JE, Buchwald M. Hematopoietic compartment of Fanconi anemia group C null mice contains fewer lineage-negative CD34+ primitive hematopoietic cells and shows reduced reconstitution ability. Exp Hematol. 1999;27:1667-1674[CrossRef][Medline] [Order article via Infotrieve]. 19. Freie B, Dutt P, Clapp D. Correction of Fanconi anemia type C phenotypic abnormalities using a clinically suitable retroviral vector infection protocol. Cell Transplantation. 1996;5:385-393[CrossRef][Medline] [Order article via Infotrieve]. 20. Hawley RG, Lieu FHL, Fong AZC, Hawley TS. Versatile retroviral vectors for potential use in gene therapy. Gene Ther. 1994;1:136-138[Medline] [Order article via Infotrieve]. 21. Clapp D, Freie B, Srour E, Yoder M, Fortney K, Gerson S. Myeloproliferative sarcoma virus directed expression of B-galactosidase following retroviral transduction of murine hematopoietic cells. Exp Hematol. 1995;23:630-638[Medline] [Order article via Infotrieve].
22.
Hiatt KK, Ingram DA, Zhang Y, Bollag G, Clapp DW.
Neurofibromin GTPase-activating protein-related domains restore normal growth in Nf1-/- cells.
J Biol Chem.
2001;276:7240-7245
23.
Haneline LS, Broxmeyer HE, Cooper S, et al.
Multiple inhibitory cytokines induce deregulated progenitor growth and apoptosis in hematopoietic cells from Fac-/- mice.
Blood.
1998;91:4092-4098 24. Haneline L, Marshall K, Clapp D. The highest concentration of primitive hematopoietic progenitor cells in cord blood is found in extremely premature infants. Pediatr Res. 1996;39:820-825[Medline] [Order article via Infotrieve].
25.
Clapp D, Freie B, Lee W-H, Zhang Y.
Molecular evidence that in situ-transduced fetal liver hematopoietic stem/progenitor cells give rise to medullary hematopoiesis in adult rats.
Blood.
1995;86:2113-2122 26. Bernstein J, Boyle D, Srour E, et al. Variation in long-term engraftment of a large consecutive series of lambs transplanted in utero with human hematopoietic cells. Biol of Blood and Marrow Transplant. 1997;3:247-254.
27.
Harrison D.
Competitive repopulation: a new assay for long-term stem cell functional capacity.
Blood.
1980;55:77-81
28.
Szilvassy S, Humphries R, Lansdorp P, Eaves A, Eaves C.
Quantitative assay for totipotent reconstituting hematopoietic stem cells by a competitive repopulation strategy.
Proc Natl Acad Sci U S A.
1990;87:8736-8740 29. Yoder MC, Hiatt K, Dutt P, Mukherjee P, Bodine DM, Orlic D. Characterization of definitive lymphohematopoietic stem cells in the day 9 murine yolk sac. Immunity. 1997;7:335-344[CrossRef][Medline] [Order article via Infotrieve].
30.
Harrison D, Astle C.
Short- and long-term multilineage repopulating hematopoietic stem cells in late fetal and newborn mice: models for human umbilical cord blood.
Blood.
1997;90:174-181 31. Harrison DE, Jordan CT, Zhong RK, Astle CM. Primitive hemopoietic stem cells: direct assay of most productive populations by competitive repopulation with simple binomial, correlation and covariance calculations. Exp Hematol. 1993;21:206-219[Medline] [Order article via Infotrieve]. 32. Zhong R, Astle C, Harrison D. Distinct developmental patterns of short-term and long-term functioning lymphoid and myeloid precursors defined by competitive limiting dilution analysis in vivo. J of Immunol. 1996;157:138-145[Abstract].
33.
Rathbun R, Faulkner G, Ostroski M, et al.
Inactivation of the Fanconi anemia group C gene augments interferon-gamma-induced apoptotic responses in hematopoietic cells.
Blood.
1997;90:974-985 34. Lensch MW, Rathbun RK, Olson SB, Jones GR, Bagby GC Jr. Selective pressure as an essential force in molecular evolution of myeloid leukemic clones: a view from the window of Fanconi anemia. Leukemia. 1999;13:1784-1789[CrossRef][Medline] [Order article via Infotrieve]. 35. Reya T, Morrison SJ, Clarke MF, Weissman IL. Stem cells, cancer, and cancer stem cells. Nature. 2001;414:105-111[CrossRef][Medline] [Order article via Infotrieve]. 36. Lewis P, Hensel M, Emerman M. Human immunodeficiency virus infection of cells arrested in the cell cycle. Embo J. 1992;11:3053-3058[Medline] [Order article via Infotrieve]. 37. Naldini L, Blomer U, Gallay P, et al. In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science. 1996;272:263-267[Abstract]. 38. Somia N, Verma IM. Gene therapy: trials and tribulations. Nat Rev Genet. 2000;1:91-99[Medline] [Order article via Infotrieve]. 39. Trono D. Lentiviral vectors: turning a deadly foe into a therapeutic agent. Gene Ther. 2000;7:20-23[CrossRef][Medline] [Order article via Infotrieve].
© 2003 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  M. D. Milsom, B. Schiedlmeier, J. Bailey, M.-O. Kim, D. Li, M. Jansen, A. M. Ali, M. Kirby, C. Baum, L. J. Fairbairn, et al. Ectopic HOXB4 overcomes the inhibitory effect of tumor necrosis factor-{alpha} on Fanconi anemia hematopoietic stem and progenitor cells Blood, May 21, 2009; 113(21): 5111 - 5120. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. R. Saadatzadeh, K. Bijangi-Vishehsaraei, R. Kapur, and L. S. Haneline Distinct roles of stress-activated protein kinases in Fanconi anemia type C-deficient hematopoiesis Blood, March 19, 2009; 113(12): 2655 - 2660. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Li, S. Chen, J. Yuan, Y. Yang, J. Li, J. Ma, X. Wu, M. Freund, K. Pollok, H. Hanenberg, et al. Mesenchymal stem/progenitor cells promote the reconstitution of exogenous hematopoietic stem cells in Fancg-/- mice in vivo Blood, March 5, 2009; 113(10): 2342 - 2351. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Rio, N. W. Meza, A. Gonzalez-Murillo, S. Navarro, L. Alvarez, J. Surralles, M. Castella, G. Guenechea, J. C. Segovia, H. Hanenberg, et al. In vivo proliferation advantage of genetically corrected hematopoietic stem cells in a mouse model of Fanconi anemia FA-D1 Blood, December 15, 2008; 112(13): 4853 - 4861. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Si, A. C. Pulliam, Y. Linka, S. Ciccone, C. Leurs, J. Yuan, O. Eckermann, S. Fruehauf, S. Mooney, H. Hanenberg, et al. Overnight transduction with foamyviral vectors restores the long-term repopulating activity of Fancc-/- stem cells Blood, December 1, 2008; 112(12): 4458 - 4465. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Zhang, X. Shang, F. Guo, K. Murphy, M. Kirby, P. Kelly, L. Reeves, F. O. Smith, D. A. Williams, Y. Zheng, et al. Defective homing is associated with altered Cdc42 activity in cells from patients with Fanconi anemia group A Blood, September 1, 2008; 112(5): 1683 - 1686. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Zhang, D. P. Sejas, Y. Qiu, D. A. Williams, and Q. Pang Inflammatory ROS promote and cooperate with the Fanconi anemia mutation for hematopoietic senescence J. Cell Sci., May 1, 2007; 120(9): 1572 - 1583. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. P. Sejas, R. Rani, Y. Qiu, X. Zhang, S. R. Fagerlie, H. Nakano, D. A. Williams, and Q. Pang Inflammatory Reactive Oxygen Species-Mediated Hemopoietic Suppression in Fancc-Deficient Mice J. Immunol., April 15, 2007; 178(8): 5277 - 5287. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. C. Bagby and G. Meyers Bone Marrow Failure as a Risk Factor for Clonal Evolution: Prospects for Leukemia Prevention Hematology, January 1, 2007; 2007(1): 40 - 46. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Si, S. Ciccone, F.-C. Yang, J. Yuan, D. Zeng, S. Chen, H. J. van de Vrugt, J. Critser, F. Arwert, L. S. Haneline, et al. Continuous in vivo infusion of interferon-gamma (IFN-{gamma}) enhances engraftment of syngeneic wild-type cells in Fanca-/- and Fancg-/- mice Blood, December 15, 2006; 108(13): 4283 - 4287. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Neff, B. C. Beard, and H.-P. Kiem Survival of the fittest: in vivo selection and stem cell gene therapy Blood, March 1, 2006; 107(5): 1751 - 1760. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. S. Haneline, H. White, F.-C. Yang, S. Chen, C. Orschell, R. Kapur, and D. A. Ingram Genetic reduction of class IA PI-3 kinase activity alters fetal hematopoiesis and competitive repopulating ability of hematopoietic stem cells in vivo Blood, February 15, 2006; 107(4): 1375 - 1382. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Bijangi-Vishehsaraei, M. R. Saadatzadeh, A. Werne, K. A. W. McKenzie, R. Kapur, H. Ichijo, and L. S. Haneline Enhanced TNF-{alpha}-induced apoptosis in Fanconi anemia type C-deficient cells is dependent on apoptosis signal-regulating kinase 1 Blood, December 15, 2005; 106(13): 4124 - 4130. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Yang, W. Khalaf, L. van de Locht, J. H. Jansen, M. Gao, M. A. Thompson, B. A. van der Reijden, D. H. Gutmann, R. Delwel, D. W. Clapp, et al. Transcriptional Repression of the Neurofibromatosis-1 Tumor Suppressor by the t(8;21) Fusion Protein Mol. Cell. Biol., July 15, 2005; 25(14): 5869 - 5879. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Liu Clonal escape in Fanconi anemia: new hurdle for gene therapy? Blood, May 1, 2005; 105(9): 3387 - 3387. [Full Text] [PDF]
|
|
|
|
|
|
X. Li, M. M. Le Beau, S. Ciccone, F.-C. Yang, B. Freie, S. Chen, J. Yuan, P. Hong, A. Orazi, L. S. Haneline, et al. Ex vivo culture of Fancc-/- stem/progenitor cells predisposes cells to undergo apoptosis, and surviving stem/progenitor cells display cytogenetic abnormalities and an increased risk of malignancy Blood, May 1, 2005; 105(9): 3465 - 3471. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Li, Y. Yang, J. Yuan, P. Hong, B. Freie, A. Orazi, L. S. Haneline, and D. W. Clapp Continuous in vivo infusion of interferon-gamma (IFN-{gamma}) preferentially reduces myeloid progenitor numbers and enhances engraftment of syngeneic wild-type cells in Fancc-/- mice Blood, August 15, 2004; 104(4): 1204 - 1209. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Chen, S. Shi, L. Acosta, W. Li, J. Lu, S. Bao, Z. Chen, Z. Yang, M. D. Schneider, K. R. Chien, et al. BMP10 is essential for maintaining cardiac growth during murine cardiogenesis Development, May 1, 2004; 131(9): 2219 - 2231. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. R. Saadatzadeh, K. Bijangi-Vishehsaraei, P. Hong, H. Bergmann, and L. S. Haneline Oxidant Hypersensitivity of Fanconi Anemia Type C-deficient Cells Is Dependent on a Redox-regulated Apoptotic Pathway J. Biol. Chem., April 16, 2004; 279(16): 16805 - 16812. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Freie, X. Li, S. L. M. Ciccone, K. Nawa, S. Cooper, C. Vogelweid, L. Schantz, L. S. Haneline, A. Orazi, H. E. Broxmeyer, et al. Fanconi anemia type C and p53 cooperate in apoptosis and tumorigenesis Blood, December 1, 2003; 102(12): 4146 - 4152. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Li, P. A. Plett, Y. Yang, P. Hong, B. Freie, E. F. Srour, C. M. Orschell, D. W. Clapp, and L. S. Haneline Fanconi anemia type C-deficient hematopoietic stem/progenitor cells exhibit aberrant cell cycle control Blood, September 15, 2003; 102(6): 2081 - 2084. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2003 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
/
Top
Abstract
Introduction
),
Fancc
), or wild-type cells transduced with a reporter
gene only (
). BM cells were cultured in methylcellulose progenitor
assays at 5 × 104 cells/mL with increasing
concentrations of MMC. Each condition was plated in triplicate and
scored on day 7 of culture. The percent maximal colony formation was
determined by dividing the number of colonies scored at each MMC
concentration by untreated control cultures. Error bars represent
standard error of the means (SEM), Student t test
*P 
.001.
