| |
|
|
|
|
|
|
|||
|
Prepublished online as a Blood First Edition Paper on October 17, 2002; DOI 10.1182/blood-2002-07-2042.
IMMUNOBIOLOGY
From the Laboratory of Experimental Immunology,
Université Libre de Bruxelles; Department of Pathology,
Hôpital Erasme, Université Libre de Bruxelles; and
Laboratory of Physiology, Medical School of Vrije Universiteit Brussel,
Brussels, Belgium.
Dendritic cells (DCs) genetically engineered to overexpress CD95
(Fas) ligand (CD95L-DC) were proposed as tools to induce peripheral
tolerance to alloantigens. Herein, we observed that CD95L-DC obtained
after retroviral gene transfer in bone marrow (BM) precursors derived
from CD95-deficient (lpr/lpr) mice elicit much stronger allospecific
type 1 helper T-cell and cytotoxic T-cell activities than control DCs
upon injection in vivo, although they induce lower T-cell responses in
vitro. Indeed, a single injection of CD95L-DC prepared from C57BL/6
mice was sufficient to prime bm13 recipients for acute rejection of
C57BL/6 skin allografts that were otherwise tolerated in the context of
this single weak major histocompatibility complex (MHC) class I
incompatibility. Massive neutrophil infiltrates depending on
interleukin (IL)-1 signaling were observed at sites of CD95L-DC
injection. Experiments in IL-1 receptor-deficient mice or in animals
injected with depleting anti-Gr1 monoclonal antibody (mAb) established
that neutrophil recruitment is required for the development of vigorous
T-cell responses after injection of CD95L-DC in vivo.
(Blood. 2003;101:1469-1476) CD95 (Fas)-mediated apoptosis of activated T
lymphocytes is critically involved in the homeostasis of the T-cell
pool1,2 and the maintenance of peripheral tolerance to
self antigens.3 Moreover, it has been proposed that the
immune privilege status of particular anatomic sites could be related
to local expression of CD95L4-6 and that expression of
CD95L by tumor cells might protect them from immune
attack.7-9 On this basis, it has been considered that
expression of CD95L on allo- or xenografts might promote their
acceptance by deleting host T cells specific for transplanted antigens.
Indeed, CD95L expression on Sertoli cells was suggested to be directly
responsible for testis allograft survival.4,10 It was then
reported that implantation of syngeneic muscle cells transfected with
CD95L together with allogeneic grafted pancreatic islets allowed
long-term survival of the transplanted islets.11 More
recently, CD95L overexpression on allogeneic endothelium was shown to
inhibit transplant-associated intimal hyperplasia.12 However, several of these observations have
been refuted13-15 so that the role of CD95L in conferring
immune privilege is currently a matter of controversy. Furthermore,
chemoattraction of neutrophils leading to a massive inflammatory
reaction has emerged as a major consequence of CD95L overexpression. As
a matter of fact, neutrophil infiltration leading to graft destruction was observed after implantation of pancreatic islets in which the CD95L
gene was overexpressed.16 Likewise, CD95L transgenic islet
In order to promote deletion of allospecific T cells without inducing
inflammation at the graft level, it has been proposed to condition
allograft recipients with antigen-presenting cells overexpressing CD95L
prior to transplantation. Indeed, allogeneic macrophages transduced
with murine CD95L induced profound alloantigen-specific T-cell
unresponsiveness.19 Dendritic cells (DCs) represent a suitable cell type for such an approach as indicated by the report of
Matsue et al showing that injection of an ovalbumin-pulsed DC line
transfected with murine CD95L induced antigen-specific T-cell
hyporesponsiveness.20 In the transplantation setting, Min
et al reported significant enhancement of heart allograft survival in
mice repeatedly injected with high doses of donor-type bone marrow
(BM)-derived DCs transfected with human CD95L.21
Herein, DCs genetically engineered to overexpress CD95L were derived
from BM precursors of CD95-deficient lpr/lpr mice, as rapid apoptosis
was observed when wild-type mice were used as BM donors. We assessed
the allostimulatory capacities of CD95L-DC in 2 models involving either
a single major histocompatibility complex (MHC) class I or MHC
class II disparity.22,23 Unexpectedly, CD95L-DCs were
found to elicit stronger TH1-type and cytotoxic T-cell
(CTL) responses than control DCs in vivo. These observations led
us to investigate the role of neutrophils during the induction phase of
alloreactive T-cell responses triggered by CD95L-DCs and to revisit the
consequences of the injection of CD95L-DCs on the fate of a
subsequent tissue allograft.
Mice
Reagents and cell lines
Generation of bone marrow-derived DCs To generate DCs from bone marrow cultures, we used a modified protocol described by Lutz et al.27 Briefly, bone marrow was flushed from the femurs and tibiae of mice, disintegrated by vigorous pipetting, filtered through a nylon mesh, and depleted of red blood cells with ammonium chloride. At day 0, bone marrow progenitors were seeded in a 6-well plate at the rate of 1 × 106 per well in 4 mL of RPMI 1640 (BioWhittaker) medium containing 10% heat-inactivated FBS (SB0012; BioWhittaker), 20 mM HEPES [N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid], 2 mM glutamine, 1 mM nonessential amino acids (BioWhittaker), sodium pyruvate (BioWhittaker), 2-mercaptoethanol, and 20 ng/mL of rmGM-CSF. At day 3, another 4 mL of complete medium containing 20 ng/mL rmGM-CSF was added to each well. At days 6 and 8, half of the culture supernatant was collected and centrifuged, and the cell pellet was resuspended in 4 mL fresh medium supplemented with 20 ng/mL rmGM-CSF and given back into the original well. On day 10, DCs were harvested by gentle pipetting. When indicated, LPS was added at 100 ng/mL for the last 48 hours of the DC culture. For phenotypic analysis, DCs were incubated with the biotinylated mAbs directed against CD80 (1G10) CD86 (GL1) or MHC class II (I-Ab,25-9-17) surface molecules in the presence of 2.4G2 supernatant, a rat mAb directed against the mouse FcRII/III (CD32/CD16) receptor. Binding of the mAbs was revealed by
a second incubation with phycoerythrin (PE)-labeled streptavidin
(Pharmingen, San Diego, CA). CD40 expression was revealed with
unlabeled anti-CD40 mAb (HM40-3) and fluorescein isothiocyanate
(FITC)-conjugated F(ab')2 mouse anti-rat IgG
(Jackson ImmunoResearch, West Grove, PA). The DC culture purity was
evaluated with an FITC-conjugated anti-CD11c mAb (HL3) in the presence
of 2.4G2 supernatant. All mAbs were purchased from Becton Dickinson Pharmingen (Mountain View, CA), and cells were analyzed on a
FACScalibur flow cytometer (Becton Dickinson).
Cloning of retroviral vector constructs For retrovirus production the retroviral vector MFG, derived from Moloney murine leukemia virus, was used. This vector does not contain a drug-resistance marker, nor does it express any potential antigenic protein other than the inserted cDNA.28 The P1A and CD95L cDNAs were obtained by PCR. The amplification products were sequenced before insertion into the MFG vector. P1A gene was amplified from P1HTR cells and cloned in pMFG/Nco1-BamH1. The P1A recombinant retrovirus was used to generate the "control" transduced DCs. The CD95/CD95L cytotoxic activity was reported to be more effective in mFasL.2 mice than in mFasL.1 mice.29 We therefore decided to generate an mFasL.2 recombinant retroviral vector. The cDNA encoding mFasL.2, the murine CD95L gene, was obtained by reverse transcriptase-polymerase chain reaction (RT-PCR) on RNA from activated T cells of BALB/c origin. After cloning in pCR2, the mCD95L gene was excised from the plasmid as a BspH1-BamH1 fragment and cloned in pMFG/Nco1-BamH1. The eGFP (enhanced green fluorescent protein) gene was obtained as a Nco1-Bcl1 fragment by digestion of peGFP-C1 (Clonetech Westburg, Leusden, The Netherlands) and ligated in pMFG/Nco1-BamH1.Retrovirus production and DC transduction Ten million PhoenixECO producer cells were transfected with 40 µg of retroviral vector DNA by the calcium phosphate precipitation method.30 Cells were incubated in complete DMEM medium supplemented with 25 µM chloroquine (Sigma-Aldrich) at 37°C for 10 hours. The medium was renewed with Opti-MEM (Gibco BRL, Merelbeke, Belgium) after 14 hours, and the retrovirus-containing medium was harvested 48 hours after transfection. The retroviral supernatants were filtered (0.22-µm pore size), snap-frozen, and stored at 80°C. On days 1, 2, and 3 after the start of the bone
marrow cell culture, the medium was removed and replaced with 2 mL
viral supernatant containing 8 µg/mL polybrene (Sigma-Aldrich). The
cells were transduced by centrifugation of the 6-well plates for 2 hours at 2400 rpm and at room temperature. The retroviral supernatant
was removed, and the cells were resuspended in cytokine-containing
medium. To evaluate our retroviral transduction efficiency, we used
eGFP as a reporter system. Transduction efficiency was monitored by flow cytometry on day 10 of the DC culture. We consistently obtained up
to 85% of green fluorescent DCs.
Apoptosis assay The untransfected and mCD95-transfected P815 target cells were labeled with 5 µCi (0.185 MBq)/mL of [3H]-thymidine (ICN, Asse-Relegem, Belgium) during an overnight incubation at 37°C and 5% C02. Labeled target cells were harvested, washed, and seeded in 96-well round-bottom plates (Greiner, Wemmel, Belgium) at a density of 10 000 cells/well. Effector cells were washed and added to the target cells at the indicated ratios. After 18 hours of incubation at 37°C and 5% C02, intact nuclei were harvested on Unifilter plates, and the radioactivity was measured on a microplate beta counter (Topcount; Packard Instrument, Meriden, CT). Data were expressed as percentages of cytotoxicity calculated by the following formula: [1-(cpm with effector/cpm without effector)] × 100. When indicated, recombinant mouse Fas/human Fc chimera (mFas-hFc TNFRSF6; R&D systems, Minneapolis, MN) was added to the culture at 10 µg/mL.Flow cytometry of peritoneal exudate cells (PECs) Sixteen hours after intraperitoneal injection of 8 × 105 transduced DCs, mice were killed by carbon dioxide asphyxiation. PECs were harvested with 8 mL cold Ca and Mg-free Hanks balanced salt solution (HBSS) medium containing red phenol (BioWhittaker). PECs were washed and characterized by flow cytometry using FITC-conjugated anti-CD11b mAb (M1/70) and biotinylated anti-GR1 mAb (RB6-8C5) plus PE-labeled streptavidin (BD Pharmingen) in the presence of 2.4G2 mAb. Cytospins of freshly isolated PECs were incubated with May-Grünwald-Giemsa staining solution to identify polymorphonuclear leukocytes.Production of cytokines in mixed lymphocyte culture 106 responder T cells from draining popliteal and inguinal lymph nodes (LNs) of naive or primed (5 days after the immunization) mice were seeded in 48-well flat-bottom plates (NUNC, Roskilde, Denmark) with 3 × 105 irradiated (20 Gy) allogeneic DCs or 2.5 × 106 splenocytes in 1 mL culture medium. Supernatants were harvested after 24 hours of culture for determination of IL-2 levels and after 72 hours for interferon (IFN)- , IL-5, and IL-4 detection. Culture medium for mixed
lymphocyte cultures (MLCs) was RPMI 1640 supplemented with 5%
heat-inactivated FBS (1 578 075, Greiner), 20 mM HEPES, 2 mM
glutamine, 1 mM nonessential amino acids, sodium pyruvate, and
2-mercaptoethanol. Quantification of cytokines in MLC supernatants was
made using commercially available enzyme-linked immunosorbent assay
(ELISA) (Duoset; R&D systems, Minneapolis, MN) for IFN- ,
IL-2 and IL-4, and Opt EIA set (Pharmingen) for IL-5. The detection
limits were 15 pg/mL for IL-2, IL-4, and IL-5, and 30 pg/mL for
IFN- .
Generation of CTL responses 5 × 106 popliteal and inguinal lymph node responder cells were cultured with 5 × 106 irradiated (20 Gy) allogeneic spleen cells in 24-well plates (NUNC, Roskilde, Denmark). Cultures were incubated at 37°C and 5% CO2 in humidified air for 5 days. Target cells were prepared in 24-well plates by incubation of 2 × 106 spleen cells per well with 4 µg of Concanavalin A (Sigma-Aldrich) in 2 mL complete RPMI medium containing 10% heat-inactivated FBS (5SB0007; BioWhittaker) for 2 days and pulsed overnight with 10 µCi (0.37 MBq) of [3H]-thymidine. Effector cells were harvested, washed, and plated at various E:T ratios in 96-well round-bottom plates (NUNC) containing 5 × 103 radio-labeled target cells. After 4 hours of incubation at 37°C and 5% C02, cultures were harvested on Unifilter plate and residual radioactivity was measured on a microplate beta counter (Topcount; Packard Instrument, Meriden, CT).Skin transplantation Skin grafts were prepared from tails of sex-matched mice and grafted onto the flanks of the recipients as previously described.31 Petroleum gauze was placed over the grafts, and sticking plaster was applied around the trunk. The bandages were removed after 7 days, and the grafts were monitored daily until day 30. Skins were considered rejected when complete epithelial breakdown had occurred. For histologic analysis, tissue sections (5 µm) of unboned feet were stained with hematoxylin and eosin after fixation in 10% neutral formalin solution and paraffin embedding.PCR detection of the lpr/lpr mutation Inguinal, popliteal, or mesenteric LNs of DC-primed mice were frozen in liquid nitrogen after collection. For the lpr genotype of lpr/lpr-bm12 mice, tail pieces were digested by proteinase K (Sigma-Aldrich). DNA was extracted using the NucleoSpin Tissue kit (Macherey-Nagel, Düren, Germany). PCR amplification of DNA was carried out with forward and reverse specific primers (Life Technologies, Paisley, United Kingdom). Briefly, PCR was performed on a Biometra thermocycler (Clonetech, Westburg) as follows: (a) denaturation, 4 minutes at 94°C; (b) amplification, 27 cycles for -actin and 35 for the lpr mutation and
wild-type gene, 30 seconds at 94°C; 20 seconds at 55°C for
-actin; and 20 seconds at 58°C for the lpr mutation and WT gene,
30 seconds at 72°C; and (c) extension, 10 minutes at
72°C. Of each sample, 15 microliters were run on a 2% agarose gel
stained with ethidium bromide. For semiquantitative PCR, DNA bands were
digitalized under UV and quantified with Multi-Analyst PC software
(Bio-Rad Laboratories, Hercules, CA). DNA levels were normalized
against -actin and expressed as a ratio of lpr/ actin. To
differentiate heterozygous and homozygous lpr/lpr mice, PCR
amplification of DNA was carried out with 2 couples of primers
(Life Technologies). For detection of the lpr mutation (retroviral
insertion in the CD95 gene), forward: AAGCCGTGCCCTAGGAAACA (upstream of
the insert); reverse: AGCAGCTCGCAACGTGAACG (in the retrovirus insert),
the expected fragment size was 359 bp. For detection of the wild-type
gene: forward: AAGCCGTGCCCTAGGAAACA (upstream of the insert); reverse:
AGTAATGGGCTCAGTGCAGC (downstream of the insert), the expected fragment
size was 195 base pair (bp). Primers for the -actin were: forward:
TGGAATCCTGTGGCATCCATGAAAC; reverse: TAAAACGCAGCTCAGTAACAGTCCG; the
expected fragment size was 349 bp.
Statistical analysis Statistical analysis was performed using the 2-tailed Mann-Whitney nonparametric test and when indicated, the 2-tailed Student t test. Graft survival curves were compared by the log-rank test.
DCs overexpressing CD95L function as killer DCs in vitro In a first set of experiments, DCs were generated from wild-type C57BL/6 BM-progenitors during a 10-day culture in the presence of mGM-CSF and were submitted to mFasL.2 MFG retroviral transduction. This resulted in massive cell death as more than 90% of BM cells were annexin V- and propidium iodide-positive 48 hours after the first CD95L transduction, compared with 5% after the control transduction. Suicidal or fratricidal death was most likely involved, since more than 85% viability of CD95L-transduced DCs was obtained at the end of the culture when CD95-deficient lpr/lpr mice were used as BM donors. After transduction of lpr/lpr BM progenitors with either mFasL.2 or control retrovirus and culture in granulocyte-macrophage colony-stimulating factor (GM-CSF), around 85% of the cells were CD11c+ GR1low DCs with an immature phenotype as indicated by low expression of MHC class II, CD80, CD86, and CD40 (Figure 1).
DCs transduced with CD95L induced a dose-dependent lysis of
CD95+ cells that was dependent on CD95-CD95L interaction,
since it was blocked by the addition of mFas-hFc fusion protein (Figure 2). As expected from their immature
phenotype, DCs transduced with control vector induced only low T-cell
proliferation in mixed leukocyte culture, and this was further reduced
when CD95L-DCs were used as stimulators. Whatever the retroviral vector
used, immature DCs did not induce significant production of IFN-
DCs overexpressing CD95L induce vigorous TH1 and CTL responses in vivo and prime for acute allograft rejection The next series of experiments were designed to determine whether lpr/lpr CD95L-DCs would inhibit alloreactive responses in vivo. We first observed that injection of CD95L-DC in the footpad of bm12 mice was followed by swelling of the draining popliteal LNs with a significant increase in cellularity as compared to LN draining at the site of injection of control DCs (Figure 3A). In parallel, we assessed the presence of DCs in LNs using a semiquantitative PCR for the lpr/lpr mutation. As shown in Figure 3B, similar levels of donor-type DNA were found after injection of CD95L-DCs or control DCs, suggesting that CD95L overexpression did not influence DC migration.
To characterize the T-cell responses induced in vivo by C57BL/6 lpr/lpr
CD95L-DCs or control DCs, MLCs were prepared between responder LN T
cells from bm12 (MHC class II mismatch) or bm13 (MHC class I mismatch)
mice inoculated with the transduced DCs and donor-type or third-party
splenocytes as stimulators. Consistent with previous
studies,32,33 the response elicited by control DCs in MHC
class II incompatible mice was TH2 skewed as indicated by a
high production of IL-4 and IL-5 and a low production of IL-2 and
IFN-
When similar experiments were repeated in MHC class I incompatible bm13
mice as recipients, we found that the injection of CD95L-DC
significantly enhanced the production of IFN-
Neutrophils infiltrate sites of CD95L-DC injection CD95L was reported as a potent chemoattractant of neutrophils in vitro and in vivo.34,35 Indeed, histologic examination of footpads 5 days after injection of CD95L-DCs revealed a major thickening of the dermis, which was massively infiltrated with neutrophils (Figure 7B-C). A highly invasive neutrophil infiltration also was observed in the underneath muscle cells layer. The injection of control DCs did not modify the skin structure and resulted only in a minor mononuclear cell infiltration in the dermis (Figure 7A). A dominant neutrophil recruitment also was observed in peritoneal cavities of bm12 mice injected 16 hours before with lpr/lpr CD95L-DC, as revealed by flow cytometry (Figure 8A) and May-Grünwald-Giemsa staining (Figure 8B, panels i-ii). In mice injected with CD95L-DCs, 67% ± 10.7% (mean ± SEM, n = 8) of the peritoneal exudate cells were Gr1+CD11b+ neutrophils with characteristic nuclear morphology (Figure 8B, panel i), whereas only 2.5% ± 2.1% of these cells were found in mice injected with control DCs (n = 6). The neutrophil recruitment induced by CD95L-DCs was strictly dependent on CD95-CD95L interactions as it was not observed after injection in CD95-deficient lpr/lpr bm12 mice (Figure 8A). In agreement with previous reports,36,37 we found that the neutrophil influx triggered by injection of CD95L-DCs in footpads was dramatically reduced in IL-1R / mice. In
those animals, the only change in the dermis consisted in a moderate
infiltrate of mononuclear cells and eosinophils (Figure 7E-F). In
parallel, we observed that the influx of GR1+
CD11b+ neutrophils after intraperitoneal injection of
CD95L-DCs was drastically decreased in IL1-R / mice
(mean ± SEM of GR1+ CD11b+ cells: 22% ± 7% in IL1R / mice versus 67% ± 10% in C57BL/6
wild-type mice).
Involvement of neutrophils in the induction of allospecific TH1 and CTL responses by CD95L-DC To investigate the role of neutrophils in the allospecific T-cell responses induced by CD95L-DCs, we depleted neutrophils by injection of the RB6-8C5 mAb specific for Gr1.38,39 As shown in Figure 8A, mice treated with RB6-8C5 mAb were indeed free of Gr1+CD11b+ neutrophils in the peritoneal cavity after intraperitoneal injection of CD95L-DCs. We then analyzed the helper T-cell responses induced in bm12 mice by intraperitoneal inoculation of CD95L-DCs after injection of either 250 µg of RB6-8C5 or the same amount of control rat IgG mAb given on days 1, 0, 1, 2, and 3. MLCs were performed with mesenteric T cells 5 days after DC
injection. As shown in Figure 9A, the
hyperproduction of IFN- elicited by the injection of CD95L-DCs was
abolished by previous neutrophil depletion but not by injection of the
control rat mAb. This was not related to impaired DC migration, as the
levels of lpr mutation detected in the mesenteric LNs after CD95L-DC
injection were not affected by neutrophil depletion. We also evaluated
the role played by neutrophils in the increased MHC class I-specific
cytotoxic activity elicited by C57BL/6 lpr/lpr CD95L-DC in bm13 mice.
As shown in Figure 5B, neutrophil depletion reduced the cytotoxic
activity to the level observed after injection of control DCs.
Furthermore, when we analyzed the cytokine profile of donor-reactive T
cells in draining LNs after subcutaneous injection of lpr/lpr bm12 DCs into C57BL/6 mice, we found an increased IFN- /IL-5 production ratio
in wild-type but not in IL1-R / mice, a finding
consistent with the involvement of neutrophils in the TH1
skewing of the response induced by CD95L-DCs (Figure 10).
Overall, the data presented in this paper indicated that, when resistant to CD95 engagement, DCs overexpressing CD95L induce vigorous TH1 type as well as cytotoxic T-cell responses that depend on neutrophils recruitment in vivo. In the transplantation setting this property of CD95L-DCs results in priming for allograft rejection instead of the anticipated tolerogenic effect. Our observations contrasts with previous reports providing evidence that such CD95L-DCs are immunosuppressive.20,21 In these earlier studies, DCs transduced with the CD95L gene coexpress a functional CD95 that might predispose them to CD95-mediated apoptosis. Indeed, although unmanipulated DCs or transformed DCs were previously found to be resistant to CD95 engagement,40-42 we found that the overexpression of CD95L obtained by gene transfer at an early stage of DC differentiation promotes their apoptosis. The down-regulation of the T-cell responses observed in previous studies could therefore be related to indirect presentation of alloantigens derived from apoptotic cells by host immature DCs.43 This possible drawback was circumvented in our experiments by the use of CD95-deficient DCs. The first cells to be considered as targets for the injected CD95L-DCs are host T lymphocytes. Indeed, the consequences of CD95 engagement on T cells are not univocal. Depending on the activation status and on the naive versus memory phenotype of the T cells, they either undergo apoptosis or receive costimulatory and proliferation signals.3,44,45 CD95-mediated costimulation was reported to be effective in both CD4+ and CD8+ naive T cells46 and could therefore be involved in the capacity of CD95L-DCs to prime both helper T-cell responses against MHC class II and CTL responses against MHC class I alloantigens. However, CD95L overexpression did not enhance and actually inhibited the capacity of DCs to activate alloreactive T cells in vitro, suggesting that the allostimulatory potential of CD95L-DCs in vivo might depend on their action on other cell types than T cells. Neutrophils are known to be recruited at sites of CD95L overexpression
and to contribute to destruction of tumors and allografts overexpressing CD95L.47-50 It was demonstrated that the
soluble form of CD95L has chemotactic ability for neutrophils in
vitro,34 but the full-length transmembrane CD95L form
appears as the predominant neutrophil chemoattractant in
vivo.35 Caspase activation elicited by CD95 engagement was
shown to be involved in the proinflammatory properties of CD95L by
promoting the processing and secretion of IL-1 Because of their potent immunostimulatory properties in vivo, it is unlikely that CD95L-DCs will find applications in transplantation as initially proposed. We suggest instead to consider CD95L-DC as a possible tool to prime antitumor responses in cancer immunotherapy.
We thank Marie-Line Vanderhaeghen, Claude Habran, and Carlo
Heirman for technical assistance; Philippe Saas for providing us
transfectants; Olivier Denis for providing us the bm13 mice, and
Sandrine Florquin for the IL-1R V.F. is a research associate at the "Fonds National de la Recherche Scientifique."
Submitted July 10, 2002; accepted September 30, 2002.
Prepublished online as Blood First Edition Paper, October 17, 2002; DOI 10.1182/blood-2002-07-2042.
Supported by the Fonds National de la Recherche Médicale of Belgium, a Pôle d'Attraction Inter-universitaire (PAI) of Belgium, and the Biotechnology Program of the European Union. S.B. is supported by the Fonds de la Recherche Industrielle et Agricole of Belgium.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Véronique Flamand, Laboratory of Experimental Immunology, Université Libre de Bruxelles-Campus Erasme, 808 route de Lennik, B-1070 Brussels, Belgium; e-mail: vflamand{at}ulb.ac.be.
1. Lynch D-H, Ramsdell F, Alderson M-R. Fas and FasL in the homeostatic regulation of immune response. Immunol Today. 1995;16:569-574[CrossRef][Medline] [Order article via Infotrieve].
2.
Nagata S, Golstein P.
The Fas death factor.
Science.
1995;267:1449-1456 3. Siegel R-M, Ka-Ming Chan F, Chun H-J, Lenardo M-J. The multifaced role of Fas signaling in immune cell homeostasis and autoimmunity. Nature Immunol. 2000;1:469-474[CrossRef][Medline] [Order article via Infotrieve]. 4. Bellgrau D, Gold D, Selawry H, Moore J, Franzusoff A, Duke V. A role for CD95 ligand in preventing graft rejection. Nature. 1995;377:630-632[CrossRef][Medline] [Order article via Infotrieve].
5.
Griffith T-S, Brunner T, Fletcher S-M, Green D-R, Ferguson T-A.
Fas ligand-induced apoptosis as a mechanism of immune privilege.
Science.
1995;270:1189-1192 6. Stuart P-M, Griffith T-S, Usui N, Pepose J, Yu X, Ferguson T-A. CD95 Ligand (FasL)-induced apoptosis is necessary for corneal allograft survival. J Clin Invest. 1997;99:396-402[Medline] [Order article via Infotrieve]. 7. O'Connell J, Benett M-W, O'Sullivan G-C, Collins J-K, Shanahan F. The fas counterattack: cancer as a site of immune privilege. Immunol Today. 1999;20:46-52[CrossRef][Medline] [Order article via Infotrieve].
8.
Hahne M, Rimoldi D, Schroter M, et al.
Melanoma cell expression of Fas (Apo-1/CD95) Ligand: implications for tumor immune escape.
Science.
1996;274:1363-1366
9.
Strand S, Hofmann W-J, Hug H, et al.
Lymphocyte apoptosis induced by CD95(Apo-1/Fas) ligand-expressing tumor cells 10. Vaux DL. Immunology: ways around rejection. Nature. 1995;377:576-577[CrossRef][Medline] [Order article via Infotrieve]. 11. Lau H, Yu M, Fontana A, Stoeckert C-J. Prevention of islet allograft rejection with engineered myoblasts expressing FasL in mice. Science. 1996;273:109-112[Abstract].
12.
Sata M, Luo Z, Walsh K.
Fas Ligand overexpression on allograft endothelium inhibits inflammatory cell infiltration and transplant-associated intimal hyperplasia.
J Immunol.
2001;166:6964-6971 13. Vaux DL. Retraction. Nature. 1998;394:133[Medline] [Order article via Infotrieve].
14.
Kang S-M, Hofman A, David L, Springer M-L, Stock P-G, Blau H-M.
Immune response and myoblasts that express Fas ligand.
Science.
1997;278:1322-1324 15. Turvey S, Gonzalez-Nicolini V, Kingsley C-I, et al. Fas Ligand-transfected myoblasts and islet cell transplantation. Transplantation. 2000;69:1972-1976[CrossRef][Medline] [Order article via Infotrieve]. 16. Kang S-M, Schneider D, Lin Z, et al. Fas ligand expression in islets of Langerhans does not confer immune privilege and instead targets them for rapid destruction. Nat Med. 1997;3:738-743[CrossRef][Medline] [Order article via Infotrieve].
17.
Allison J, Georgious H-M, Strasser A, Vaux DL.
Transgenic expression of CD95 ligand on islet
18.
Takeuchi T, Ueki T, Nishimatsu H, et al.
Accelerated rejection of Fas ligand-expressing heart grafts.
J Immunol.
1999;162:518-522
19.
Zhang H-g, Xiao S, Di L, et al.
Induction of specific T cell tolerance by Fas Ligand-expressing antigen-presenting cells.
J Immunol.
1999;162:1423-1430 20. Matsue H, Matsue K, Walters M, Okumura K, Yagita H, Takashima A. Induction of antigen-specific immunosuppression by CD95L cDNA-transfected killer dendritic cells. Nat Med. 1999;5:930-937[CrossRef][Medline] [Order article via Infotrieve].
21.
Min W-P, Gorczynski R, Huang X-Y, et al.
Dendritic cells genetically engineered to express Fas ligand induce donor-specific hyporesponsiveness and prolong allograft survival.
J Immunol.
2000;164:161-167 22. Rosenber A-S, Singer A. Cellular basis of skin allograft rejection: an in vivo model of immune-mediated tissue destruction. Annu Rev Immunol. 1992;10:333-358[Medline] [Order article via Infotrieve]. 23. Nathenson S-G, Geliebter J, Pfaffenbach G-M, Zeff R-A. Murine major histocompatibility complex class-I mutants: molecular analysis and structure-function implications. Annu Rev Immunol. 1986;4:471-502[CrossRef][Medline] [Order article via Infotrieve].
24.
Adachi M, Watanabe-Fukunaga R, Nagata S.
Aberrant transcription caused by the insertion of an early transposable element in an intron of the Fas antigen gene of lpr mice.
Proc Natl Acad Sci U S A.
1993;90:1756-1760 25. Fontt E-O, Heirman C, Thielemans K, Vray B. Granulocyte-macrophage colony-stimulating factor: involvement in control of Trypanosoma cruzi infection in mice. Infect Immun. 1996;64:3429-3434[Abstract]. 26. Hestdal K, Ruscetti F-W, Ihle J-N, et al. Characterization and regulation of RB6-8C5 antigen expression on murine bone marrow cells. J Immunol. 1991;147:22-28[Abstract]. 27. Lutz M-B, Kukutsch V, Ogilvie A-L-J, et al. An advanced culture method for generating large quantities of highly pure dendritic cells from mouse bone marrow. J Immunol Methods. 1999;223:77-92[CrossRef][Medline] [Order article via Infotrieve].
28.
Rivière L, Brose K, Nolan G-P.
Effects of retroviral design on expression of human adenosine deaminase in murine bone marrow transplant recipients engrafted with genetically modified cells.
Proc Natl Acad Sci U S A.
1995;92:6733-37
29.
Kayagaki N, Yamagushi N, Nagao F, et al.
Polymorphism of murine Fas ligand that affects the biological activity.
Proc Natl Acad Sci U S A.
1997;94:3914-3919 30. Pear W-S, Scott M-L, Nolan G-P. Generation of high-titer, helper-free retroviruses by transient infection. In: Walker JM, ed. Methods in Molecular Medicine: Gene Therapy Protocols. Totowa, NJ: Humana Press; 1997:41-57. 31. Le Moine A, Flamand V, Noël J-C, Fayt I, Goldman M, Abramowicz D. Chronic rejection of major histocompatibility complex class II-disparate skin grafts after anti-CD3 therapy. Transplantation. 1998;66:1537-1544[CrossRef][Medline] [Order article via Infotrieve].
32.
Foucras G, Coudert J-D, Coureau C, Guéry J-C.
Dendritic cells prime in vivo alloreactive CD4 T lymphocytes toward type 2 cytokine- and TGF-
33.
Le Moine A, Surquin M, Demoor F-X, et al.
IL-5 mediates eosinophilic rejection of MHC class II-disparate skin allografts in mice.
J Immunol.
1999;163:3778-3784
34.
Seino K-I, Iwabushi K, Kayagaki N, et al.
Chemotactic activity of soluble Fas ligand against phagocytes.
J Immunol.
1998;161:4484-4488
35.
Hohlbaum A-M, Moe S, Marshak-Rothstein A.
Opposing effects of transmembrane and soluble fas ligand expression on inflammation and tumor cell survival.
J Exp Med.
2000;191:1209-1219
36.
McIntyre K-W, Stepan G-J, Kolinsky K, et al.
Inhibition of interleukin 1 binding and bioactivity in vitro and modulation of acute inflammation in vivo by IL-1 receptor monoclonal antibody.
J Exp Med.
1991;173:931-939
37.
Miwa K, Asano M, Horai R, Iwakura Y, Nagata S, Suda T.
Caspase 1-independent IL-1
38.
Conlan J-W, North R-J.
Neutrophils are essential for early anti-Listeria defense in the liver, but not in the spleen or peritoneal cavity, as revealed by a granulocyte-depleting monoclonal antibody.
J Exp Med.
1994;179:259-268 39. Chen L, Zhang Z-H, Sendo F. Neutrophils play a critical role in the pathogenesis of experimental cerebral malaria. Clin Exp Immunol. 2000;120:125-133[CrossRef][Medline] [Order article via Infotrieve]. 40. Kusuhara M, Matsue K, Edelbaum D, Loftus J, Takashima A, Matsue H. Killing of naïve T cells by CD95L-transfected dendritic cells: in vivo study using killer DC-DC hybrids and CD4+ T cells from D011.10 mice. Eur J Immunol. 2002;32:1035-1043[CrossRef][Medline] [Order article via Infotrieve].
41.
Rescigno M, Piguet V, Valzasina B, et al.
Fas engagement induces the maturation of dendritic cells (DCs), the release of interleukin-1
42.
Ashany D, Savir A, Bhardwaj N, Elkon K-B.
Dendritic cells are resistant to apoptosis through the Fas (CD95/Apo-1) pathway.
J Immunol.
1999;163:5303-5311
43.
Steinman R-M, Turley S, Mellman I, Inaba K.
The induction of tolerance by dendritic cells that have captured apoptotic cells.
J Exp Med.
2000;191:411-416 44. Budd R-C. Death receptors couple to both cell proliferation and apoptosis. J Clin Invest. 2002;109:437-442[CrossRef][Medline] [Order article via Infotrieve].
45.
Desbarats J, Wade T, Wade WF, Newell MK.
Dichotomy between naive and memory CD4+ T cell responses to Fas engagement.
Proc Natl Acad Sci U S A.
1999;96:8104-8109
46.
Suzuki I, Fink P-J.
The dual functions of Fas ligand in the regulation of peripheral CD8+ and CD4+ T cells.
Proc Natl Acad Sci U S A.
2000;97:1707-1712 47. Seino K-I, Kayagaki N, Okumura K, Yagita H. Antitumor effect of locally produced CD95 ligand. Nat Med. 1997;3:165-170[CrossRef][Medline] [Order article via Infotrieve].
48.
Arai H, Gordon D, Nabel E-G, Nabel G-J.
Gene transfer of Fas ligand induces tumor regression in vivo.
Proc Natl Acad Sci U S A.
1997;94:13862-13867
49.
Shimizu M, Fontana A, Takeda Y, Yagita H, Yoshimoto T, Matsuzawa A.
Induction of antitumor immunity with Fas/Apo-1 ligand (CD95L)-transfected neuroblastoma neuro-2a cells.
J Immunol.
1999;162:7350-7357 50. Kang S-M, Braat D, Shneider D-B, et al. A non-cleavable mutant of Fas ligand does not prevent neutrophilic destruction of islet transplants. Transplantation. 2000;69:1813-1817[Medline] [Order article via Infotrieve].
51.
Tateda K, Moore T-A, Deng J-C, et al.
Early recruitment of neutrophils determines subsequent T1/T2 host responses in a murine model of Legionella pneumophila pneumonia.
J Immunol.
2001;166:3355-3361
52.
Bliss S-K, Butcher B-A, Denkers E-Y.
Rapid recruitment of neutrophils containing prestored IL-12 during microbial infection.
J Immunol.
2000;165:4515-4521 53. Chen L, Watanabe T, Watanabe H, Sendo F. Neutrophil depletion exacerbates experimental Chagas' disease in BALB/c, but protects C57BL/6 mice through modulating the Th1/Th2 dichotomy in different directions. Eur J Immunol. 2001;31:265-275[CrossRef][Medline] [Order article via Infotrieve]. 54. Cassatella M-A. The production of cytokines by polymorphonuclear neutrophils. Immunol Today. 1995;16:21-26[CrossRef][Medline] [Order article via Infotrieve]. 55. Wilbanks G-A, Mammolenti M, Streilein J-W. Studies on the induction of anterior chamber-associated immune deviation (ACAID), III: induction of ACAID depends upon intraocular transforming growth factor-beta. Eur J Immunol. 1992;22:165-173[Medline] [Order article via Infotrieve]. 56. Pollanen P, von Euler M, Jahnukainen K, et al. Role of transforming growth factor beta in testicular immunosuppression. J Reprod Immunol. 1993;24:123-137[CrossRef][Medline] [Order article via Infotrieve].
57.
Chen J-J, Sun Y, Nabel G-J.
Regulation of the proinflammatory effects of Fas ligand (CD95L).
Science.
1998;282:1714-1717 58. Restifo N-P. Not so Fas: re-evaluating the mechanisms of immune privilege and tumor escape. Nat Med. 2000;6:493-495[CrossRef][Medline] [Order article via Infotrieve]. 59. O'Connel J, Houston A, Benett M-W, O'Sullivan G-C, Shanahan F. Immune privilege or inflammation? Insights into the Fas ligand enigma. Nat Med. 2001;7:271-274[CrossRef][Medline] [Order article via Infotrieve].
© 2003 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
C. Schutz, M. Fleck, A. Mackensen, A. Zoso, D. Halbritter, J. P. Schneck, and M. Oelke Killer artificial antigen-presenting cells: a novel strategy to delete specific T cells Blood, April 1, 2008; 111(7): 3546 - 3552. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Moore, S. Buonocore, E. Aksoy, N. Ouled-Haddou, S. Goriely, E. Lazarova, F. Paulart, C. Heirman, E. Vaeremans, K. Thielemans, et al. An Alternative Pathway of NF-{kappa}B Activation Results in Maturation and T Cell Priming Activity of Dendritic Cells Overexpressing a Mutated I{kappa}B{alpha} J. Immunol., February 1, 2007; 178(3): 1301 - 1311. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Maksimow, T. S. Soderstrom, S. Jalkanen, J. E. Eriksson, and A. Hanninen Fas costimulation of naive CD4 T cells is controlled by NF-{kappa}B signaling and caspase activity J. Leukoc. Biol., February 1, 2006; 79(2): 369 - 377. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Goriely, C. Molle, M. Nguyen, V. Albarani, N. O. Haddou, R. Lin, D. De Wit, V. Flamand, F. Willems, and M. Goldman Interferon regulatory factor 3 is involved in Toll-like receptor 4 (TLR4)- and TLR3-induced IL-12p35 gene activation Blood, February 1, 2006; 107(3): 1078 - 1084. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Vermaelen and R. Pauwels Pulmonary Dendritic Cells Am. J. Respir. Crit. Care Med., September 1, 2005; 172(5): 530 - 551. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Askenasy, E. S. Yolcu, I. Yaniv, and H. Shirwan Induction of tolerance using Fas ligand: a double-edged immunomodulator Blood, February 15, 2005; 105(4): 1396 - 1404. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Bohana-Kashtan and C. I. Civin Fas Ligand as a Tool for Immunosuppression and Generation of Immune Tolerance Stem Cells, November 1, 2004; 22(6): 908 - 924. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2003 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||