Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
Prepublished online as a Blood First Edition Paper on October 3, 2002; DOI 10.1182/blood-2002-08-2434.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2002-08-2434v1
101/4/1513    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mao, X.
Right arrow Articles by Whittaker, S. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mao, X.
Right arrow Articles by Whittaker, S. J.
Related Collections
Right arrow Neoplasia
Right arrow Oncogenes and Tumor Suppressors
Right arrow Gene Expression
Right arrow Clinical Trials and Observations
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, 15 February 2003, Vol. 101, No. 4, pp. 1513-1519

NEOPLASIA

Amplification and overexpression of JUNB is associated with primary cutaneous T-cell lymphomas

Xin Mao, Guy Orchard, Debra M. Lillington, Robin Russell-Jones, Bryan D. Young, and Sean J. Whittaker

From the Skin Tumour Unit and Dermatopathology Department, St John's Institute of Dermatology, St Thomas' Hospital, Cancer Research UK Medical Oncology Unit, Saint Bartholomew's Hospital, London, United Kingdom.


    Abstract
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Primary cutaneous lymphomas (PCLs) represent a heterogeneous group of extranodal T- and B-cell malignancies. The underlying molecular pathogenesis of this malignancy remains unclear. This study aimed to characterize oncogene abnormalities in PCLs. Using genomic microarray, we detected oncogene copy number gains of RAF1 (3p25), CTSB (8p22), PAK1 (11q13), and JUNB (19p13) in 5 of 7 cases of mycosis fungoides (MF)/Sezary syndrome (SS) (71%), gains of FGFR1 (8p11), PTPN (20q13), and BCR (22q11) in 4 cases (57%), and gains of MYCL1 (1p34), PIK3CA (3q26), HRAS (11p15), MYBL2 (20q13), and ZNF217 (20q13) in 3 cases (43%). Amplification of JUNB was studied in 104 DNA samples from 78 PCL cases using real-time polymerase chain reaction. Twenty-four percent of cases, including 7 of 10 cases of primary cutaneous CD30+ anaplastic large-cell lymphoma (C-ALCL), 4 of 14 MF, 4 of 22 SS, and 2 of 23 primary cutaneous B-cell lymphoma (PCBCL) showed amplification of JUNB, and high-level amplification of this oncogene was present in 3 C-ALCL and 2 MF cases. JUNB protein expression was analyzed in tissue sections from 69 PCL cases, and 44% of cases, consisting of 21 of 23 SS, 6 of 8 C-ALCL, 5 of 10 MF, and 9 of 21 PCBCL, demonstrated nuclear expression of JUNB by tumor cells. Overexpression of JUNB also was detected in 5 C-ALCL and 2 SS cases. These results have revealed, for the first time, amplification and expression patterns of JUNB in PCL, suggesting that JUNB may be critical in the pathogenesis of primary cutaneous T-cell lymphomas. (Blood. 2003;101:1513-1519)

© 2003 by The American Society of Hematology.

    Introduction
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Primary cutaneous lymphomas (PCLs) represent a heterogeneous group of extranodal T- and B-cell malignancies with an annual incidence of 0.5-1 per 100 000.1-3 This group of lymphomas has been classified into mycosis fungoides (MF)/Sezary syndrome (SS), accounting for 70% of PCL cases, primary cutaneous B-cell lymphoma (PCBCL), constituting more than 20% of cases, primary cutaneous CD30+ anaplastic large cell lymphoma (C-ALCL), constituting 10% of cases, and blastic natural killer cell lymphoma (NK), accounting for 1% of cases.1-3 These subtypes of PCL have distinctive clinicopathologic and immunophenotypic features.1-3 However, the underlying etiology and pathogenesis remains unclear.

Most malignancies accumulate a series of genetic events including activation of oncogenes and loss of tumor suppressor genes, which lead to a malignant phenotype. Previous studies have shown allelic losses at 9p, 10q, and 17p; microsatellite instability and mutations of p53 in primary cutaneous T-cell lymphomas (CTCLs);4-6 and hypermethylation of p15 and p16 in both CTCL and PCBCL.7,8 However, little is known about genome-wide genetic alterations in PCL. We have studied a series of PCL cases using comparative genomic hybridization (CGH) and have identified consistent and distinctive patterns of chromosomal imbalances (CI) in both MF and SS and in PCBCL.9,10 Genomic microarray is a novel technique of genomic analysis used to rapidly screen for genomic imbalances (GI) in a tumor genome.11 Previous studies have revealed oncogene copy number changes in several epithelial cancers.11-14 We also have detected oncogene gains and losses in PCBCLs using this technique,10 but at present there is no data available in CTCLs.

The aim of this study was to screen for oncogene abnormalities in PCLs. We began with a study of 7 cases of MF/SS using genomic microarray, which showed gains of several oncogenes, including JUNB. We then analyzed 104 DNA samples from 78 PCL patients for JUNB amplification using real-time-polymerase chain reaction (RT-PCR) and correlated these findings with the results of immunohistochemistry (IHC) analysis of formalin-fixed, paraffin-embedded tissue sections from 69 PCL cases.


    Materials and methods
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Samples

Initially, 7 cases of MF/SS with noticeable CI detected by CGH9 were selected for genomic microarray study (Table 1). This included 5 SS (nos. 1 [sample 1524], 3 [1650], 4 [1530], 5 [1278], and 23 [2211]) and 2 MF (nos. 25 [1416] and 32 [1536]) cases (Table 1). Subsequently, 104 DNA samples from 78 patients with PCL, consisting of 41 samples from 22 SS cases, 14 MF samples, 16 samples from 10 C-ALCL cases, 23 PCBCL samples, 7 cutaneous blastic NK cell lymphoma samples, 2 systemic follicular lymphoma (FL) samples, and 1 lymphomatoid papulosis (LyP) sample were selected for RT-PCR study according to specific clinicopathologic features, immunophenotypes, and T-cell receptor/immunoglobulin gene analysis (Table 2).2,3 In addition, formalin-fixed, paraffin-embedded tissue sections from 69 of 78 PCL cases analyzed by RT-PCR (23 SS, 10 MF, 8 C-ALCL, 21 PCBCL, 4 cutaneous NK cell lymphoma, 2 systemic FL, and 1 LyP) were selected for IHC study (Table 2). This project was approved by the St Thomas' Hospital Research Ethics Committee for sampling (EC02/089).

                              
View this table:
[in this window]
[in a new window]
 
Table 1. A summary of genomic microarray findings in 7 MF/SS cases


                              
View this table:
[in this window]
[in a new window]
 
Table 2. A summary of RT-PCR and IHC analyses of JUNB in PCL

Genomic microarray

This experiment was conducted as previously described.10 After probe labeling, hybridization, and posthybridization washes, fluorescent images of the hybridized microarray chips, AmpliOnc I DNA array (Vysis, Downers Grove, IL), which contains 59 clones from 57 oncogenes (BCL2 and AR are represented by both 5' and 3' genomic clones) representing genomic regions that have been reported to be amplified in human tumors (Vysis, Downers Grove, IL) were captured and analyzed using the GenoSensor Reader System (Vysis). The fluorescence ratio thresholds for gains and losses of oncogene copy number were set according to our control experiments using test and reference DNA from healthy individuals and lymphoma patients.10 Thus, ratios equivalent to 1 ± 0.2 were set as the level for disomy (normal gene copy number), whereas ratios > 1.25 represented trisomy (gain of gene copy number), and ratios < 0.75 were indicative of monosomy (loss of gene copy number).10

RT-PCR

To further confirm amplification of JUNB in PCL, RT-PCR studies were performed. This experiment, based on the TaqMan assay,15 was carried out using the ABI Prism 7700 Sequence Detector System (ABI/Perkin Elmer, Foster City, CA) as previously reported.10,16 Primer and TaqMan probe sequences were designed using the Primer Express version 1.0 software (ABI/Perkin Elmer) and GenBank sequence numbers were M29039, M12523, and M17987 for JUNB, ALB, and B2M, respectively, with the following primer sequences: JUNB: forward CTACGGGATACGGCCGG, reverse AGGCTCGGTTTCAGGAGTTTG, ALB: forward AGGGTAAAGAGTCGTCGATATGCT, reverse CAATCTCAACCCACTGTCAGCTA, B2M: forward GGAATTGATTTGGGAGAGCATC, reverse CAGGTCCTGGCTCTACAATTTACTAA.

The TaqMan probes were JUNB: 5'-(FAM)-CCCCTGGTGGCCTCTCTCTACACGACTA-(TAMRA)-3', ALB: 5'-(FAM)-CAAACGCATCCATTCTACCAACTTGAGCAT-(TAMRA)-3', B2M: 5'-(FAM)-AGTGTGACTGGGCAGATCATCCACCTTC-(TAMRA)-3'.

PCR mixes (25 µL) contained 12.5 µL of 2 × TaqMan Universal PCR master mix, 2.5 µL of each primer, and 2.5 µL of TaqMan probe with 1 to 2.5 µL of DNA. The Universal master mix contains ROX (6-carboxy-X-rhodamine), the passive reference fluorochrome that normalizes for pipetting volume errors. Thermal cycling consisted of 2 minutes at 50°C, 10 minutes at 95°C, followed by 40 cycles at 95°C for 15 seconds, and 60°C for 1 minute. Each assay included a "no template" control and a standard curve for JUNB, ALB, and B2M produced by normal placental DNA, and all were carried out in triplicate (96-well maximum). The parameter CT is defined as the fractional cycle number at which the fluorescence generated by cleavage of the probe passes a fixed threshold above baseline. The target gene copy number (JUNB) is quantified by measuring CT and by using a standard curve to determine the starting copy number. The ratio of the target gene copy number to the reference gene copy number normalizes the amount and quality of genomic DNA. The ratio defining the level of increased copy number of the target gene was termed as "N" and was determined as follows: n = copy number of target gene/copy number of reference gene. An N value > 2 was set for gene amplification (+), > 4 (++), > 8 (+++), and > 16 (++++) (Table 2).10,15,16 An N value < 0.5 was regarded as decreased copy number (Table 2).

IHC

To further investigate the expression pattern of JUNB in PCL, immunohistochemical studies were performed using the DAKO ChemMate horseradish peroxidase system and DAKO DAB substrate system according to the supplier's instruction (DAKO, Carpinteria, CA).17 Briefly, deparaffinized tissue sections were first treated with 3% H2O2 for 10 minutes to inhibit endogenous peroxidase and then microwaved at 700 watts for 18 minutes in 0.01 M sodium citrate buffer solution (pH 6.0) for 30 minutes. After a series of washes, the sections were incubated with primary mouse monoclonal antibody against JUNB (C-11: sc-8051) (Santa Cruz Biotechnology, Santa Cruz, CA) at room temperature for 1 hour at a final antibody concentration of 2 µg/mL diluted in blocking serum solution. After further incubation with universal biotinylated link antibody and peroxidase-labeled streptavidin, the reaction was developed with DAB substrate-chromogen solution for 10 minutes, followed by counterstaining with Harris hematoxylin. To test the specific reactivity of antibody with JUNB, C-11, paraffin sections from colorectal adenocarcinoma, keratosis, and normal lymph nodes (5 samples each) were initially stained with C-11 and an antibody of nonhuman reactive rabbit IgG (Santa Cruz Biotechnology), which was used as the negative control. All colorectal adenocarcinomas and epidermal basal and suprabasal keratinocytes in keratosis showed strong nuclear JUNB expression as previously reported.17,18 However, 5 normal lymph nodes had negative staining for JUNB. In addition, all the samples tested were negative staining for the nonhuman reactive rabbit IgG. To further exclude false-positive and false-negative results in each experiment, a positive control consisting of a colorectal adenocarcinoma and epidermal basal and suprabasal keratinocytes in each sample with known expression of JUNB and a negative control consisting of the rabbit IgG and normal lymph nodes without expression of this oncoprotein were used. The slides were analyzed for the proportion of tumor cells showing nuclear positivity. The level of JUNB expression was qualitatively defined as (+) when 5%-45% of tumor cells were positive, (++) when 50%-90% of tumor cells were positive, and (+++) when 100% of tumor cells were positive.19


    Results
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Genomic microarray

All 7 MF/SS cases studied showed GI (100%). Oncogene copy number gains of RAF1 (3p25), CTSB (8p22), PAK1 (11q13), and JUNB (19p13) were identified in 5 cases (71%), gains of FGFR1 (8p11), PTPN (20q13), and BCR (22q11) in 4 cases (57%), gains of MYCL1 (1p34), PIK3CA (3q26), HRAS (11p15), MYBL2 (20q13), and ZNF217 (20q13) in 3 cases (43%), and gains of KRAS2 (12p12), GLI (12q13), IGFR1 (15q25), FES (15q26), and YES1 (18p11) in 2 cases (29%) (Table 1) (Figure 1). Two female patients showed gains of AR5' and AR3' as evidence for hybridization efficiency. There was a similar pattern of GI in SS and MF (Table 1) (Figure 1).


View larger version (102K):
[in this window]
[in a new window]
 
Figure 1. Illustration of an analyzed chart of the AmpliOnc microarray chip hybridized with the DNA sample from a patient with an SS patient (case 5, sample 1278). The x-axis lists all informative oncogene probes and the y-axis represents the detected fluorescence ratio changes of tumor (T) against reference (R). The T/R ratio of JUNB (arrow) was beyond the threshold of 1.25 indicating gains of these oncogenes.

RT-PCR

Of 78 PCL cases analyzed with RT-PCR, 19 cases showed amplification of JUNB (24%) (Table 2). This included 7 C-ALCL (70%), 4 MF (29%), 4 SS (18%), 2 PCBCL (9%), 1 NK cell lymphoma (14%), and 1 systemic FL (50%). High-level amplification of JUNB (+++) was present in 3 C-ALCL (30%) and 2 MF cases (14%) (Table 2). Decreased copy number of JUNB also was seen in 1 MF, 1 FCCL, and 1 NK cell lymphoma each (Table 2). When multiple samples such as blood and skin lesions from the same individual were analyzed, results were consistent. Three cases (nos. 5, 20, 21) showing gain of JUNB detected with genomic microarray also revealed amplification of JUNB using RT-PCR, but case 1 had gain of JUNB by genomic microarray without RT-PCR evidence of amplification of JUNB (Table 2).

IHC

Of 69 PCLs analyzed by IHC, 44 cases showed nuclear JUNB expression in a proportion of tumor cells (64%) (Table 2). This included 21 (91%) of 23 SS, 6 (75%) of 8 C-ALCL, 5 (50%) of 10 MF, 9 (43%) of 21 PCBCL, 2 (50%) of 4 NK cell lymphoma, and 1 (50%) of 2 systemic FL (Table 2). Seven cases (10%) revealed expression of JUNB by all tumor cells (+++) (overexpression), including 5 C-ALCL (63%) and 2 SS cases (9%) (Table 2; Figures 2-3). Epidermal basal and suprabasal keratinocytes also expressed JUNB, which represented a useful internal control to indicate the efficiency of immunohistochemistry (Figure 2). All the positively stained PCBCL cases showed only occasional cells expressing JUNB (+) (Table 2), and in this case it is difficult to conclusively establish whether expression is restricted to tumor cells or activated B cells on morphology.


View larger version (150K):
[in this window]
[in a new window]
 
Figure 2. Illustration of IHC staining of JUNB in an SS patient (case 8). This photograph (original magnification × 40) revealed strong nuclear expression of JUNB by large epidermotropic tumor cells with absent expression in small dermal mononuclear cells. Epidermal basal keratinocytes also expressed JUNB, representing a useful internal control.



View larger version (156K):
[in this window]
[in a new window]
 
Figure 3. Illustration of IHC staining of JUNB in a C-ALCL patient (case 38). This photograph (original magnification × 40) showed strong nuclear expression of JUNB by large anaplastic cells with no expression by small reactive lymphocytes.

There was a striking concordance between the results of RT-PCR and IHC (Table 2). Fifteen cases (6 C-ALCL, 4 SS, 2 MF, 2 PCBCL, and 1 systemic FL) with amplification of JUNB identified by RT-PCR also showed expression of JUNB by tumor cells (Table 2). In addition, 25 cases (12 PCBCL, 5 MF, 2 SS, 2 C-ALCL, 2 NK cell lymphoma, 1 systemic FL, and 1 LyP) without amplification of JUNB did not express JUNB protein by tumor cells (Table 2).


    Discussion
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

This genomic microarray study of CTCL variants has shown a global picture of oncogene copy number changes in MF and SS. Seventy-one percent of cases revealed gains of JUNB, RAF1, CTSB, and PAK1, and 57% demonstrated gains of FGFR1, PTPN, and BCR. In addition, a consistent pattern of GI was present in SS and MF, supporting our previous hypothesis that both SS and MF represent part of a spectrum of the same disease as suggested by a similar pattern of CI detected by CGH.9 In contrast, these results are different from our previous observations in PCBCL,10 which is consistent with a different pathogenesis. RT-PCR analysis of PCL showed amplification of JUNB in 70% of C-ALCL, 29% of MF, 18% of SS, 14% of cutaneous NK cell lymphoma, and 9% of PCBCL cases. JUNB expression in more than 50% of CTCL variants was present in a majority of tumor cells. In contrast, expression of JUNB in PCBCL was limited to a minority of the cellular infiltrate. There was general concordance between the results of JUNB detected by these 3 different techniques. For instance, high-level amplification and overexpression of JUNB was consistently detected in C-ALCL, MF, and SS using RT-PCR and IHC. Occasional rare discrepancies were noted and are likely to be due to the different detection sensitivity of these techniques. These findings suggest that amplification and overexpression of JUNB may be a key pathogenetic event in CTCL.

JUNB protein is one of the principal components of the activating protein-1 (AP-1) transcription factor complex, consisting of the JUN (C-JUN, JUNB, and JUND) and FOS (C-FOS, FOSB, FRA1, and FRA2) families, which has been implicated in a variety of biologic processes.20,22-24 For example, previous studies have shown that JUNB is involved in control of the cell cycle by inducing high level expression of the cyclin-dependent kinase inhibitor p16(INK4a) and down-regulating cyclin D expression, producing a decrease in pRb hyperphosphorylation and G1-phase extension leading to premature cell senescence.21,25,26 In addition, in T cells JUNB has been found to promote T-helper-2 cell (TH2) differentiation through up-regulation of interleukin-4 (IL-4).27-29 Transforming growth factor-beta1 (TGFB1) also induces expression of JUNB in human leukemic cells,26 and interestingly, a TH2 immunophenotype and overexpression of TGFB1 are characteristic of CTCL.30-32 The TAX oncoprotein of human T-cell leukemia virus type 1 (HTLV-1) also induces JUNB expression,33,34 although all the cases in this study were HTLV-1 negative, and HTLV-1 is not associated with MF/SS.35 JUNB is expressed in epidermal keratinocytes, consistent with our observation in this study, and is thought to have a role in wound healing, photoaging, and UV-induced skin carcinogenesis.18 It has been suggested that JUNB and JUND are proliferation inhibitor or tumor suppressors.20,22,23,36-39 In contrast, C-JUN functions as a promoter of cell proliferation and as an apoptosis inhibitor due to down-regulation of p53, p21, and p16, and up-regulation of cyclin-dependent kinases.20,22,23,36-39 These studies would appear to suggest that amplification and overexpression of JUNB would be apoptotic and inhibit tumor cell proliferation in CTCL. However, recent knock-in mouse studies have shown that JUNB can substitute for the absence of C-JUN during mouse development and cell proliferation,39,40 and this is thought to be through the constitutive activation of transcription factor NF-kappa B, which controls the activation of JUNB.41 This may explain why overexpression of C-JUN and JUNB proteins are detected in human colorectal, ovarian, and cervical cancers but not in normal tissues, whereas JUND protein is present in normal tissues but rarely in tumors.17,42,43 Amplification and/or overexpression of JUNB also have been described in Hodgkin lymphoma cell lines, cervical cancer cell lines, and endometrial cancers.41,44,45 In this study, we identified copy number gain of JUNB in 5 MF/SS cases using genomic microarray. This was supported by RT-PCR and IHC studies, which revealed amplification and expression of JUNB in 8 and 28 cases, respectively. In addition, high-level amplification and overexpression of JUNB were identified in CTCL variants. This was in contrast to findings in PCBCL, in which only rare cases showed amplification and expression of JUNB, and in fact decreased copy number of JUNB was detected in 3 cases.10 Taken together, these results suggest that up-regulation of JUNB is frequently associated with CTCL variants rather than PCBCL. Further studies of C-JUN, C-FOS, and JUND are now required in PCL.

Apart from JUNB, other oncogenes such as RAF1, CTSB, and PAK1 also were frequently identified in MF/SS. RAF1 (v-raf-1 murine leukemia viral oncogene homolog 1) is a mitogen-activated protein kinase that acts downstream of RAS viral oncogene homolog and is regulated by BCL2 and other apoptosis-related proteins.46 CTSB encodes cathepsin B, a lysosomal cysteine protease that cleaves amyloid precursor protein and is involved in tumor invasion.46 PAK1 (p21/Cdc42/Rac1-activated kinase 1) belongs to the PAK family composed of serine/threonine p21-activating kinases, which are involved in cytoskeleton reorganization and nuclear signaling. PAK1 regulates cell motility and morphology.46 Previous studies have shown amplification of RAF1, CTSB, and PAK1 in breast, esophageal, and urinary bladder carcinomas, respectively.47-49 At present there are no data on alterations of these oncogenes in nodal lymphomas. Therefore, further studies are required to confirm amplification of these oncogenes in PCLs with functional studies to establish the significance of these findings.

In summary, we have found consistent patterns of GI in MF/SS and frequent amplification and overexpression of JUNB in C-ALCL, MF, and SS, suggesting that this oncogene may play an important role in the pathogenesis of CTCL.


    Footnotes

Submitted August 19, 2002; accepted September 14, 2002.

Prepublished online as Blood First Edition Paper, October 3, 2002; DOI 10.1182/blood-2002-08-2434.

Supported by grants from the British Skin Foundation, Dermatrust, and St John's Special Purpose Fund.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: Xin Mao, Skin Tumour Unit, St John's Institute of Dermatology, St Thomas' Hospital, Lambeth Palace Road, London SE1 7EH, United Kingdom; e-mail: mxmayo{at}hotmail.com or mxmayo{at}yahoo.co.uk.


    References
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

1. Willemze R, Kerl H, Sterry W, et al. EORTC classification for primary cutaneous lymphomas: a proposal from the Cutaneous Lymphoma Study Group of the European Organization for Research and Treatment of Cancer. Blood. 1997;90:354-371[Abstract/Free Full Text].

2. Harris NL, Jaffe ES, Diebold J, et al. The World Health Organization classification of neoplastic diseases of the haematopoietic and lymphoid tissues: report of the Clinical Advisory Committee meeting, Airlie House, Virginia, November 1997. Histopathology. 2000;36:69-86[CrossRef][Medline] [Order article via Infotrieve].

3. Jaffe ES, Harris NL, Stein H, Vardiman JW. World Health Organization classification of tumours: pathology and genetics of tumours of haematopoietic and lymphoid tissues. Lyon, France: IARC Press; 2001.

4. McGregor JM, Crook T, Fraser-Andrews EA, et al. Spectrum of p53 gene mutations suggests a possible role for ultraviolet radiation in the pathogenesis of advanced cutaneous lymphomas. J Invest Dermatol. 1999;112:317-321[CrossRef][Medline] [Order article via Infotrieve].

5. Scarisbrick JJ, Woolford AJ, Russell-Jones R, Whittaker SJ. Loss of heterozygosity on 10q and microsatellite instability in advanced stages of primary cutaneous T-cell lymphoma and possible association with homozygous deletion of PTEN. Blood. 2000;95:2937-2942[Abstract/Free Full Text].

6. Scarisbrick JJ, Woolford AJ, Russell-Jones R, Whittaker SJ. Allelotyping in mycosis fungoides and Sezary syndrome: common regions of allelic loss identified on 9p, 10q, and 17p. J Invest Dermatol. 2001;117:663-670[CrossRef][Medline] [Order article via Infotrieve].

7. Child FJ, Scarisbrick JJ, Calonje E, Orchard G, Russell-Jones R, Whittaker SJ. Inactivation of tumor suppressor genes p15INK4b and p16INK4a in primary cutaneous B cell lymphoma. J Invest Dermatol. 2002;118:941-948[CrossRef][Medline] [Order article via Infotrieve].

8. Scarisbrick JJ, Woolford AJ, Calonje E, et al. Frequent abnormalities of the p15 and p16 genes in mycosis fungoides and sezary syndrome. J Invest Dermatol. 2002;118:493-499[CrossRef][Medline] [Order article via Infotrieve].

9. Mao X, Lillington MD, Scarisbrick J, et al. Molecular cytogenetic analysis of cutaneous T-cell lymphomas: identification of common genetic alterations in Sezary syndrome and mycosis fungoides. Br J Dermatol. 2002;147:464-475[CrossRef][Medline] [Order article via Infotrieve].

10. Mao X, Lillington D, Child F, Russell-Jones R, Young D, Whittaker S. Comparative genomic hybridisation analysis of primary cutaneous B-cell lymphomas: identification of common genomic alterations in disease pathogenesis. Genes Chromosomes Cancer. 2002;35:144-155[CrossRef][Medline] [Order article via Infotrieve].

11. Pinkel D, Segraves R, Sudar D, et al. High resolution analysis of DNA copy number variation using comparative genomic hybridization to microarrays. Nat Genet. 1998;20:207-211[CrossRef][Medline] [Order article via Infotrieve].

12. Daigo Y, Chin SF, Gorringe KL, et al. Degenerate oligonucleotide primed-polymerase chain reaction-based array comparative genomic hybridization for extensive amplicon profiling of breast cancers: a new approach for the molecular analysis of paraffin-embedded cancer tissue. Am J Pathol. 2001;158:1623-1631[Abstract/Free Full Text].

13. Hui AB, Lo KW, Yin XL, Poon WS, Ng HK. Detection of multiple gene amplifications in glioblastoma multiforme using array-based comparative genomic hybridization. Lab Invest. 2001;81:717-723[Medline] [Order article via Infotrieve].

14. Hui AB, Lo KW, Teo PM, To KF, Huang DP. Genome wide detection of oncogene amplifications in nasopharyngeal carcinoma by array based comparative genomic hybridization. Int J Oncol. 2002;20:467-473[Medline] [Order article via Infotrieve].

15. Bièche I, Olivi M, Champème MH, Vidaud D, Lidereau R, Vidaud M. Novel approach to quantitative polymerase chain reaction using real-time detection: application to the detection of gene amplification in breast cancer. Int J Cancer. 1998;78:661-666[CrossRef][Medline] [Order article via Infotrieve].

16. Goff LK, Neat MJ, Crawley CR, et al. The use of real-time quantitative PCR and comparative genomic hybridisation to identify amplification of the REL gene in follicular lymphoma. Br J Haematol. 2001;111:618-625.

17. Wang H, Birkenbach M, Hart J. Expression of Jun family members in human colorectal adenocarcinoma. Carcinogenesis. 2000;21:1313-1317[Abstract/Free Full Text].

18. Angel P, Szabowski A, Schorpp-Kistner M. Function and regulation of AP-1 subunits in skin physiology and pathology. Oncogene. 2001;20:2413-2423[CrossRef][Medline] [Order article via Infotrieve].

19. Weedon D, Strutton G. Skin Pathology. Edinburgh United Kingdom: Churchill Livingstone; 2001.

20. Shaulian E, Karin M. AP-1 as a regulator of cell life and death. Nat Cell Biol. 2002;4:E131-E136[CrossRef][Medline] [Order article via Infotrieve].

21. Passegue E, Wagner EF. JunB suppresses cell proliferation by transcriptional activation of p16(INK4a) expression. EMBO J. 2000;19:2969-2979[CrossRef][Medline] [Order article via Infotrieve].

22. Jochum W, Passegue E, Wagner EF. AP-1 in mouse development and tumorigenesis. Oncogene. 2001;20:2401-2412[CrossRef][Medline] [Order article via Infotrieve].

23. van Dam H, Castellazzi M. Distinct roles of Jun : Fos and Jun : ATF dimers in oncogenesis. Oncogene. 2001;20:2453-2464[CrossRef][Medline] [Order article via Infotrieve].

24. Shaulian E, Karin M. AP-1 in cell proliferation and survival. Oncogene. 2001;20:2390-2400[CrossRef][Medline] [Order article via Infotrieve].

25. Bakiri L, Lallemand D, Bossy-Wetzel E, Yaniv M. Cell cycle-dependent variations in c-Jun and JunB phosphorylation: a role in the control of cyclin D1 expression. EMBO J. 2000;19:2056-2068[CrossRef][Medline] [Order article via Infotrieve].

26. Pachernik J, Soucek K, Hampl A, Hofmanova J, Kozubik A. Transforming growth factor-beta1 induces junB mRNA accumulation, G1-phase arrest, and pRb dephosphorylation in human leukemia HL-60 cells. Folia Biol (Praha). 2001;47:32-35[Medline] [Order article via Infotrieve].

27. Mondino A, Whaley CD, DeSilva DR, Li W, Jenkins MK, Mueller DL. Defective transcription of the IL-2 gene is associated with impaired expression of c-Fos, FosB, and JunB in anergic T helper 1 cells. J Immunol. 1996;157:2048-2057[Abstract].

28. Rincon M, Derijard B, Chow CW, Davis RJ, Flavell RA. Reprogramming the signalling requirement for AP-1 (activator protein-1) activation during differentiation of precursor CD4+ T-cells into effector Th1 and Th2 cells. Genes Funct. 1997;1:51-68[Medline] [Order article via Infotrieve].

29. Li B, Tournier C, Davis RJ, Flavell RA. Regulation of IL-4 expression by the transcription factor junb during T helper cell differentiation. EMBO J. 1999;18:420-432[CrossRef][Medline] [Order article via Infotrieve].

30. Vowels BR, Lessin SR, Cassin M, et al. Th2 cytokine mRNA expression in skin in cutaneous T-cell lymphoma. J Invest Dermatol. 1994;103:669-673[CrossRef][Medline] [Order article via Infotrieve].

31. Rook AH, Gottlieb SL, Wolfe JT, et al. Pathogenesis of cutaneous T-cell lymphoma: implications for the use of recombinant cytokines and photopheresis. Clin Exp Immunol. 1997;107(suppl 1):16-20[Medline] [Order article via Infotrieve].

32. Bagot M, Nikolova M, Schirm-Chabanette F, Wechsler J, Boumsell L, Bensussan A. Crosstalk between tumor T lymphocytes and reactive T lymphocytes in cutaneous T cell lymphomas. Ann N Y Acad Sci. 2001;941:31-38[CrossRef][Medline] [Order article via Infotrieve].

33. Fujii M, Niki T, Mori T, et al. HTLV-1 Tax induces expression of various immediate early serum responsive genes. Oncogene. 1991;6:1023-1029[Medline] [Order article via Infotrieve].

34. Iwai K, Mori N, Oie M, Yamamoto N, Fujii M. Human T-cell leukemia virus type 1 tax protein activates transcription through AP-1 site by inducing DNA binding activity in T cells. Virology. 2001;279:38-46[CrossRef][Medline] [Order article via Infotrieve].

35. Whittaker SJ, Luzzatto L. Deleted HTLV-1 provirus in mycosis fungoides. Science. 1993;259:1470-1471[Free Full Text].

36. Szabowski A, Maas-Szabowski N, Andrecht S, et al. c-Jun and JunB antagonistically control cytokine-regulated mesenchymal-epidermal interaction in skin. Cell. 2000;103:745-755[CrossRef][Medline] [Order article via Infotrieve].

37. Finch S, Joseloff E, Bowden T. JunB negatively regulates AP-1 activity and cell proliferation of malignant mouse keratinocytes. J Cancer Res Clin Oncol. 2002;128:3-10[CrossRef][Medline] [Order article via Infotrieve].

38. Passegue E, Jochum W, Schorpp-Kistner M, Mohle-Steinlein U, Wagner EF. Chronic myeloid leukemia with increased granulocyte progenitors in mice lacking junB expression in the myeloid lineage. Cell. 2001;104:21-32[CrossRef][Medline] [Order article via Infotrieve].

39. Weitzman JB. Juggling jun. Nat Genet. 2002;30:128-129[CrossRef][Medline] [Order article via Infotrieve].

40. Passegue E, Jochum W, Behrens A, Ricci R, Wagner EF. JunB can substitute for Jun in mouse development and cell proliferation. Nat Genet. 2002;30:158-166[CrossRef][Medline] [Order article via Infotrieve].

41. Mathas S, Hinz M, Anagnostopoulos I, et al. Aberrantly expressed c-Jun and JunB are a hallmark of Hodgkin lymphoma cells, stimulate proliferation and synergize with NF-kappa B. EMBO J. 2002;21:4104-4113[CrossRef][Medline] [Order article via Infotrieve].

42. Bauknecht T, Angel P, Kohler M, et al. Gene structure and expression analysis of the epidermal growth factor receptor, transforming growth factor-alpha, myc, jun, and metallothionein in human ovarian carcinomas: classification of malignant phenotypes. Cancer. 1993;71:419-429[CrossRef][Medline] [Order article via Infotrieve].

43. Neyns B, Katesuwanasing, Vermeij J, et al. Expression of the jun family of genes in human ovarian cancer and normal ovarian surface epithelium. Oncogene. 1996;12:1247-1257[Medline] [Order article via Infotrieve].

44. Choo KB, Huang CJ, Chen CM, Han CP, Au LC. Jun-B oncogene aberrations in cervical cancer cell lines. Cancer Lett. 1995;93:249-253[CrossRef][Medline] [Order article via Infotrieve].

45. Bamberger AM, Milde-Langosch K, Rossing E, Goemann C, Loning T. Expression pattern of the AP-1 family in endometrial cancer: correlations with cell cycle regulators. J Cancer Res Clin Oncol. 2001;127:545-550[CrossRef][Medline] [Order article via Infotrieve].

46. NCBI LocusLink. Available at: http://www.ncbi.nlm.nih.gov/LocusLink. Accessed May 25, 2002.

47. Bekri S, Adelaide J, Merscher S, et al. Detailed map of a region commonly amplified at 11q13right-arrowq14 in human breast carcinoma. Cytogenet Cell Genet. 1997;79:125-131[Medline] [Order article via Infotrieve].

48. Hughes SJ, Glover TW, Zhu XX, et al. A novel amplicon at 8p22-23 results in overexpression of cathepsin B in esophageal adenocarcinoma. Proc Natl Acad Sci U S A. 1998;95:12410-12415[Abstract/Free Full Text].

49. Simon R, Richter J, Wagner U, et al. High-throughput tissue microarray analysis of 3p25 (RAF1) and 8p12 (FGFR1) copy number alterations in urinary bladder cancer. Cancer Res. 2001;61:4514-4519[Abstract/Free Full Text].

© 2003 by The American Society of Hematology.
 

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Mathas, S. Kreher, K. J. Meaburn, K. Johrens, B. Lamprecht, C. Assaf, W. Sterry, M. E. Kadin, M. Daibata, S. Joos, et al.
Gene deregulation and spatial genome reorganization near breakpoints prior to formation of translocations in anaplastic large cell lymphoma
PNAS, April 7, 2009; 106(14): 5831 - 5836.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. van Doorn, M. S. van Kester, R. Dijkman, M. H. Vermeer, A. A. Mulder, K. Szuhai, J. Knijnenburg, J. M. Boer, R. Willemze, and C. P. Tensen
Oncogenomic analysis of mycosis fungoides reveals major differences with Sezary syndrome
Blood, January 1, 2009; 113(1): 127 - 136.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Garaude, R. Farras, G. Bossis, S. Charni, M. Piechaczyk, R. A. Hipskind, and M. Villalba
SUMOylation Regulates the Transcriptional Activity of JunB in T Lymphocytes
J. Immunol., May 1, 2008; 180(9): 5983 - 5990.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. H. Vermeer, R. van Doorn, R. Dijkman, X. Mao, S. Whittaker, P. C. van Voorst Vader, M.-J. P. Gerritsen, M.-L. Geerts, S. Gellrich, O. Soderberg, et al.
Novel and Highly Recurrent Chromosomal Alterations in Sezary Syndrome
Cancer Res., April 15, 2008; 68(8): 2689 - 2698.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
I. Ayala, M. Baldassarre, G. Giacchetti, G. Caldieri, S. Tete, A. Luini, and R. Buccione
Multiple regulatory inputs converge on cortactin to control invadopodia biogenesis and extracellular matrix degradation
J. Cell Sci., February 1, 2008; 121(3): 369 - 378.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. Huet, M. Bagot, D. Loyaux, J. Capdevielle, L. Conraux, P. Ferrara, A. Bensussan, and A. Marie-Cardine
SC5 mAb Represents a Unique Tool for the Detection of Extracellular Vimentin as a Specific Marker of Sezary Cells
J. Immunol., January 1, 2006; 176(1): 652 - 659.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Watanabe, M. Sasaki, K. Itoh, M. Higashihara, K. Umezawa, M. E. Kadin, L. J. Abraham, T. Watanabe, and R. Horie
JunB Induced by Constitutive CD30-Extracellular Signal-Regulated Kinase 1/2 Mitogen-Activated Protein Kinase Signaling Activates the CD30 Promoter in Anaplastic Large Cell Lymphoma and Reed-Sternberg Cells of Hodgkin Lymphoma
Cancer Res., September 1, 2005; 65(17): 7628 - 7634.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. Willemze, E. S. Jaffe, G. Burg, L. Cerroni, E. Berti, S. H. Swerdlow, E. Ralfkiaer, S. Chimenti, J. L. Diaz-Perez, L. M. Duncan, et al.
WHO-EORTC classification for cutaneous lymphomas
Blood, May 15, 2005; 105(10): 3768 - 3785.
[Abstract] [Full Text] [PDF]


Home page
Arch DermatolHome page
K. K. Sra, M. Babb-Tarbox, S. Aboutalebi, P. Rady, G. L. Shipley, D. D. Dao, and S. K. Tyring
Molecular Diagnosis of Cutaneous Diseases
Arch Dermatol, February 1, 2005; 141(2): 225 - 241.
[Abstract] [Full Text] [PDF]


Home page
J. Mol. Diagn.Home page
G. Troen, V. Nygaard, T.-K. Jenssen, I. M. Ikonomou, A. Tierens, E. Matutes, A. Gruszka-Westwood, D. Catovsky, O. Myklebost, G. Lauritzsen, et al.
Constitutive Expression of the AP-1 Transcription Factors c-jun, junD, junB, and c-fos and the Marginal Zone B-Cell Transcription Factor Notch2 in Splenic Marginal Zone Lymphoma
J. Mol. Diagn., November 1, 2004; 6(4): 297 - 307.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
K. E. Elagib, M. Xiao, I. M. Hussaini, L. L. Delehanty, L. A. Palmer, F. K. Racke, M. J. Birrer, G. Shanmugasundaram, M. A. McDevitt, and A. N. Goldfarb
Jun Blockade of Erythropoiesis: Role for Repression of GATA-1 by HERP2
Mol. Cell. Biol., September 1, 2004; 24(17): 7779 - 7794.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
R. van Doorn, R. Dijkman, M. H. Vermeer, J. J. Out-Luiting, E. M. H. van der Raaij-Helmer, R. Willemze, and C. P. Tensen
Aberrant Expression of the Tyrosine Kinase Receptor EphA4 and the Transcription Factor Twist in Sezary Syndrome Identified by Gene Expression Analysis
Cancer Res., August 15, 2004; 64(16): 5578 - 5586.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. P. Szremska, L. Kenner, E. Weisz, R. G. Ott, E. Passegue, M. Artwohl, M. Freissmuth, R. Stoxreiter, H.-C. Theussl, S. B. Parzer, et al.
JunB inhibits proliferation and transformation in B-lymphoid cells
Blood, December 1, 2003; 102(12): 4159 - 4165.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
D. G. Albertson and D. Pinkel
Genomic microarrays in human genetic disease and cancer
Hum. Mol. Genet., October 15, 2003; 12(90002): R145 - 152.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
L. Kari, A. Loboda, M. Nebozhyn, A. H. Rook, E. C. Vonderheid, C. Nichols, D. Virok, C. Chang, W.-H. Horng, J. Johnston, et al.
Classification and Prediction of Survival in Patients with the Leukemic Phase of Cutaneous T Cell Lymphoma
J. Exp. Med., June 2, 2003; 197(11): 1477 - 1488.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2002-08-2434v1
101/4/1513    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mao, X.
Right arrow Articles by Whittaker, S. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mao, X.
Right arrow Articles by Whittaker, S. J.
Related Collections
Right arrow Neoplasia
Right arrow Oncogenes and Tumor Suppressors
Right arrow Gene Expression
Right arrow Clinical Trials and Observations
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2003 by American Society of Hematology         Online ISSN: 1528-0020