Prepublished online as a Blood First Edition Paper on October 17, 2002; DOI 10.1182/blood-2002-08-2617.
 Previous Article | Table of Contents | Next Article 
Blood, 1 March 2003, Vol. 101, No. 5, pp. 2001-2007
RED CELLS
Induction of fetal hemoglobin expression by the histone
deacetylase inhibitor apicidin
Olaf Witt,
Sven Mönkemeyer,
Gabi Rönndahl,
Bernhard Erdlenbruch,
Dirk Reinhardt,
Katrin Kanbach, and
Arnulf Pekrun
From the Laboratory for Hematological and Cancer
Research, Children's Hospital, University of Goettingen, Goettingen,
Germany.
 |
Abstract |
Pharmacologic stimulation of fetal hemoglobin (HbF) expression may
be a promising approach for the treatment of  -thalassemia. In this
study, we have investigated the HbF-inducing activity and molecular
mechanisms of specific histone deacetylase (HDAC) inhibitors in human
K562 erythroleukemia cells. Apicidin was the most potent agent compared
with other HDAC inhibitors (trichostatin A, MS-275, HC-toxin,
suberoylanilide hydroxamic acid [SAHA]) and previously tested
compounds (butyrate, phenylbutyrate, isobutyramide, hydroxyurea,
5-aza-cytidine), leading to a 10-fold stimulation of HbF expression at
nanomolar to micromolar concentrations. Hyperacetylation of histones
correlated with the ability of HDAC inhibitors to stimulate HbF
synthesis. Furthermore, analysis of different mitogen-activated protein (MAP) kinase signaling pathways revealed that p38
signaling was activated following apicidin treatment of cells and that
inhibition of this pathway abolished the HbF-inducing effect of
apicidin. Additionally, activation of the A -globin promoter by
apicidin could be inhibited by p38 inhibitor SB203580. In summary, the novel HDAC inhibitor apicidin was found to be a potent inducer of HbF
synthesis in K562 cells. The present data outline the role of histone
hyperacetylation and p38 MAP kinase signaling as molecular targets for
pharmacologic stimulation of HbF production in erythroid cells.
(Blood. 2003;101:2001-2007)
© 2003 by The American Society of Hematology.
| |
Introduction |
Severe -thalassemia (thalassemia major, Cooley
anemia) is characterized by insufficient production of adult -globin
chains with subsequent excess of  -globin chains leading to
ineffective erythropoiesis, intramedullar degradation of erythroid
cells, and lifelong transfusion requirement of affected
patients.1 One molecular treatment strategy of this
disease comprises the reactivation of fetal -globin production to
substitute for the lack of -globin chains and to correct the
imbalance of /non- chains.2 Several pharmacologic
agents such as 5-azacytidine, hydroxyurea, erythropoietin, butyrate
derivatives and combinations of these drugs have been shown to possess
-globin chain-inducing activity.3
Among these compounds, butyrate analogues have been studied over many
years now, and clinical benefit in some patients with -thalassemia
has been reported.4-8 However, several pharmacologic problems are associated with these substances. First, many analogues have a very short half-life, requiring continuous intravenous application. Second, butyrate derivatives need a plasma concentration in the millimolar range to be effective, requiring large amounts of
drugs to be applied. Third, induction of -globin chain is relatively
weak, which might account for the inconsistent clinical effects
observed. Fourth, many derivatives have an offensive odor, making these
compounds less suitable for a long-term patient compliance. Therefore,
identification of new agents that might be able to stimulate -globin
chain via similar molecular mechanisms as butyrates but are more
efficient at lower concentrations is warranted. A reasonable approach
would be to investigate compounds that mimic the molecular effects of
butyrate on erythroid cells.
Butyrate has been found to possess inhibitory activity on histone
deacetylases, leading to hyperacetylation of  -amino groups of lysine
residues in histones.9-11 This in turn causes a decreased association of basic core histone proteins with the DNA, rendering certain genes more accessible to the transcriptional machinery. In
fact, trichostatin A, a specific histone deacetylase (HDAC) inhibitor
was found to possess some fetal hemoglobulin (HbF)-inducing activity
in human and mouse erythroleukemia cells,12,13 suggesting that the histone deacetylase-inhibiting properties of butyrate contribute to its mode of action.
In this report, we have investigated several specific HDAC inhibitors
with respect to their HbF-inducing activity in K562 cells. Apicidin was
by far the most efficient HbF-inducing agent at nanomolar to micromolar
concentrations. Our data further demonstrate that, in addition to HDAC
inhibition, p38 mitogen-activated protein (MAP) kinase signaling
appears to be involved in apicidin-mediated stimulation of HbF synthesis.
| |
Materials and methods |
Cell culture
The human leukemia cell line K562 was obtained from American
Type Culture Collection (ATCC), Philadelphia, PA (CCL-243). Cells were
cultured in RPMI containing 10% fetal calf serum with addition of
penicillin/streptomycin. For experiments, cells were seeded at a
density of 4 × 105 cells/4 mL in 35-mm dishes and
cultured for 4 days in the presence or absence of the
inducing/inhibiting agents as indicated. Viable cell counts were
determined by using trypan-blue dye exclusion test. For measurement of
fetal hemoglobin and total hemoglobin, cells were centrifuged and
washed with phosphate-buffered saline (PBS), and the cell
pellet was resuspended in lysis buffer (100 mM potassium phosphate, pH
7.8, 0.2% Triton X-100) and incubated 10 minutes at room temperature.
After pelleting cellular debris, the supernatant was collected and
stored at  20°C until further use. For MAP kinase immunoblot
analysis, cell pellets were directly lysed in sodium dodecyl
sulfate (SDS) sample buffer (62.5 mM Tris [tris(hydroxymethyl)aminomethane]-HCl, pH 6.8, 2% SDS, 10%
glycerol, 50 mM DTT [dithiothreitol], 0.1% bromophenol blue),
incubated for 5 minutes at 95°C, cooled on ice for 5 minutes, and
stored at 20°C until further use.
Reporter gene experiments
A 1436-bp fragment of the human A-globin promoter (+64 to
1372 relative to the start site of transcription) was amplified from
human genomic DNA using standard polymerase chain reaction (PCR)
methods. The promoter fragment was cloned into the
NheI/XhoI site of the reporter gene plasmid pGL3
basic (Promega, Madison, WI). The correct sequence of the construct was
verified by automated DNA sequencing. Transient transfection of K562
cells was done by lipofection using 3 µL lipofectamine 2000 (Gibco-Life Technologies, Karlsruhe, Germany) per microgram
DNA. A stock suspension of 6 × 106 K562 cells/6 mL was
transfected with 12 µg DNA according to the manufacturer's protocol.
After 24 hours of transfection, the transfected stock suspension was
divided into 500-µL aliquots, diluted 1:4 with RPMI medium containing
10% fetal calf serum (FCS), and cultured in the presence or
absence of 0.5 µM apicidin for the various times indicated.
Apicidin-treated and untreated control cells were harvested in parallel
at the different time points indicated; luciferase activity was
determined by the luciferase assay kit (Promega) as described
previously14 and normalized by protein concentration of
lysates. Normalized luciferase activity from apicidin-treated cells was
corrected by the activity of untreated control cells harvested at the
same time points to take into account basal, unstimulated reporter gene
transcription. Because transfection was carried out in a stock
suspension of cells before splitting into aliquots, there was no need
to correct for different transfection efficacies by cotransfection of a
constitutively expressed plasmid. To rule out direct activation of the
luciferase gene or enzyme by apicidin, we performed control experiments
by transfecting cells with the promoterless pGL3basic luciferase
plasmid. Apicidin-treated cells did not show significant increase of
luciferase activity compared with untreated control cells exhibiting a
basal luciferase activity. Furthermore, direct incubation of luciferase
activity containing cell lysates with apicidin did not stimulate
enzyme activity.
Determination of total hemoglobin and HbF
Hemoglobin concentration was determined by using the plasma
hemoglobin kit from Sigma (St Louis, MO) according to the
manufacturer's instructions. This assay is based on the catalytic
action of any hemoglobin on the oxidation of benzidine by hydrogen
peroxide. After measurement of protein concentration of the lysate by
the Coomassie method, nanogram hemoglobin per microgram total cellular protein was calculated.
Concentration of fetal hemoglobin was measured by enzyme-linked
immunosorbent assay (ELISA) based on a 2-antibody sandwich principle as
follows: microtiter plates were coated at 37°C for 1 hour with 100 µL sheep antihemoglobin F antibody (1 mg/mL; Bethyl Laboratories,
Montgomery, TX) diluted 1:1000 in 100 mM
Na2CO3/NaHCO3, pH 9.6. After
washing 4 times with Tris-buffered saline containing 0.02% (vol/vol)
Tween-20 (TBS-T), unspecific binding sites were blocked with 200 µL
40 mM Tris/HCl, pH 7.6, 137 mM NaCl, 0.02% (vol/vol) Tween-20, 3%
(wt/vol) bovine serum albumin at 4°C for 12 hours. After washing 4 times with TBS-T, 100 µL K562 cell lysate, diluted 1:10.000 with
lysate buffer (40 mM Tris/HCl, pH 7.6, 137 mM NaCl, 0.02% [vol/vol]
Tween-20, 0.5% [wt/vol] bovine serum albumin) was applied to each
well and incubated at room temperature for 1 hour. After washing 4 times with TBS-T, 100 µL mouse-antihuman hemoglobin -chain
antibody (Accurate Chemical, New York) diluted 1:10 000 with lysate
buffer was added at room temperature for 1 hour. After washing 4 times
with TBS-T, wells were incubated with 100 µL peroxidase-linked
sheep-antimouse immunoglobulin (Amersham-Pharmacia, Piscataway,
NJ) and diluted 1:1000 with lysate buffer at room temperature
for 1 hour. After washing 4 times with TBS-T, bound antibody was
detected by addition of 100 µL substrate solution (BM Blue
POD [peroxidase] substrate; Boehringer Mannheim, Mannheim, Germany). Substrate reaction was stopped by addition of 25 µL 1 M H2SO4, and color reaction was determined at
450 nm (690 nm as reference) in an ELISA reader. As HbF standards, we
used erythrocyte lysates obtained from a premature newborn shown to
consist of pure HbF by cellulose acetate electrophoresis. The
ELISA was linear at HbF concentrations ranging from 125 pg/mL to
2.5 ng/mL and was about 1000-fold more sensitive for detection of
HbF than of adult hemoglobin (HbA).
Quantitative RT-PCR
Quantification of mRNA expression was done by real-time reverse
transcription (RT)-PCR with Sybr Green using an ABI Prism 7700 thermal
cycler (Perkin-Elmer Applied Biosystems, Foster City, CA). Total RNA
was prepared from 106 cells with the RNeasy-kit from
Quiagen (Chatsworth, CA) according to the manufacturer's instructions.
For reverse transcription (RT), 1 µg total RNA was randomly primed
for 10 minutes at 60°C and then subjected to reverse transcription
for 1 hour at 37°C by using Moloney murine leukemia virus
(MMLV)-RT from Invitrogen (Karlsruhe, Germany). For PCR: cDNA
aliquots were quantified for globin gene expression by using the
threshold cycle (Ct) method normalized for the house keeping gene
-actin. The following exon-spanning primer sequences were used
(5'-3' orientation): -actin (cDNA amplicon length 151 bp),
GCATCCCCCAAAGTTCACAA (forward) and AGGACTGGGCCATTCTCCTT (reverse);
-globin (cDNA amplicon length 372 bp), GACAAGACCAACGTCAAGGCCGCC (forward) and CAGGAACTTGTCCAGGGAGGC (reverse); -globin (cDNA amplicon length 489 bp), ACTCGCTTCTGGAACGTCTGA (forward) and
GTATCTGGAGGACAGGGCACT (reverse). PCR was performed in triplicates using
the qPCR Mastermix for Sybr Green 1 kit from Eurogentic (Seraing,
Belgium) with the following protocol: after initial denaturing of the
cDNA (10 minutes at 95°C), a 2-step PCR was performed (15 seconds at
95°C, 1 minute at 60°C, 40 cycles). Dilution experiments were
performed to ensure similar efficiency of the PCRs, and standard curves
were calculated referring the Ct (the PCR cycle at which a specific
fluorescence becomes detectable) to the log of each cDNA dilution step.
Specific amplification was verified by generation of a melting curve as well as agarose gel electrophoresis. Threshold cycle (Ct)
values obtained for - and -globin were normalized by
corresponding Ct values of -actin. Results from apicidin-treated
cells were expressed relative to untreated control cells.
Materials
The following HDAC inhibitors were used: TSA (trichostatin
A; Calbiochem, San Diego, CA), SAHA (suberoylanilide hydroxamic acid; Calbiochem), MS-275
(N-(2-aminophenyl)-4-[pyridine-3-ylmethoxycarbonyl)aminomethyl]benzamide; Calbiochem), HC-toxin (cyclo-D-Pro-L-Ala-D-L-2-amino-8-oxo-9, 10-epoxydecanoic acid; Sigma), apicidin
(cyclo-[L- (2-amino-8-oxodecanoyl)-L-(N-methoxytryptophan)-L-isoleucyl-D-pipecolinyl); Calbiochem). The substances were dissolved in dimethyl
sulfoxide (DMSO) or ethanol as recommended by the supplier and
added to the culture medium to give the final concentrations as
indicated. The final concentration of DMSO and ethanol in the culture
medium was kept below 0.1% (vol/vol). At this concentration, the
solvents did not influence hemoglobin synthesis of K562 cells.
Furthermore, the respective volume of solvent was used in all control
experiments. Sodium butyrate, isobutyramide, sodium valproate,
hemin, hydroxyurea, 5-aza-cytidine, and sodium phenylacetate were
purchased from Sigma. Sheep antihemoglobin F antibody was purchased
from Bethyl Laboratories, and mouse antihuman-hemoglobin- chain
antibody was from Accurate Chemical. The following antibodies were
obtained from Calbiochem: anti-ERK1/2 (extracellular signal-related
kinase 1/2) phosphorylated, anti-Jun N-terminal kinase
(JNK)1/2 phosphorylated, and anti-p38 total. Antibodies obtained from
Sigma were anti-p38 phosphorylated, anti-ERK1/2 total, and JNK1/2
total. The p38-specific inhibitor SB203580 was from Calbiochem, and the
ERK pathway inhibitor UO126 was from Promega. Antiacetyl H4 histone
antibodies were from Upstate Biotechnology (Lake Placid, NY).
Immunoblot analysis
Detection of phosphorylated MAP kinase proteins.
Cell lysates were subjected to SDS-polyacrylamide gel electrophoresis
(PAGE) using 10% polyacrylamide gels and transferred to polyvinylidene
fluoride (PVDF) membranes (Millipore, Bedford, MA) by using a
semidry electroblot chamber. Transfer of proteins was assessed by
ponceau-red staining. Membranes were blocked in tris-buffered saline,
pH 7.4, containing 0.1% Tween-20 and 5% bovine serum albumin for 1 hour at room temperature. Incubations with primary antibodies were
carried out at 4°C overnight by using antibody dilutions as
recommended by the manufacturer in tris-buffered saline, pH 7.4, 0.1%
Tween-20. Following 1 hour of incubation with goat-antirabbit
peroxidase-conjugated antibody (Promega) at room temperature, proteins
were detected by the electrogenerated chemiluminescence (ECL)
method (Amersham-Pharmacia) according to the manufacturer's
instructions. Blots were stripped at 50°C for 30 minutes in 100 mM
2-mercaptoethanol, 2% SDS, 62.5 mM Tris-HCl, pH 6.7, and reprobed
as indicated.
Detection of acetylated H4 histone proteins.
Histones were purified from nuclear proteins by acid extraction as
described.15 Briefly, 2 × 106 K562 cells
were collected by centrifugation, washed with phosphate-buffered saline, and resuspended in 1 mL ice-cold lysis buffer (10 mM Tris/HCl, pH 6.5, 50 mM sodium bisulfite, 1% [vol/vol] Triton X-100, 10 mM
MgCl2, 8.6% sucrose). Cells were disrupted by using a
dounce homogenizer, and nuclei were pelleted by centrifugation for 10 minutes at 1000g. Pellets were washed 3 times with lysis
buffer and once with 10 mM Tris/HCl, pH 7.4, 13 mM EDTA
(ethylenediaminetetraacetic acid). Pellets were then dissolved in 100 µL ice-cold water by vortexing. Acid extraction of nuclear histone
proteins was carried out by adding 7 µL 6 N
H2SO4 to give a final concentration of 0.4 N
H2SO4 and incubated at 4°C for at least 1 hour. After pelleting acid-insoluble proteins (5 minutes full speed,
microfuge), supernatants were collected and 1 mL ice-cold
acetone was added, and acid-soluble proteins were precipitated
at 20°C overnight. After pelleting for 5 minutes at full speed in a
microfuge, proteins were air dried for 5 to 10 minutes and dissolved in
50 µL water. For detection of acetylated histones, acid-extracted
nuclear proteins were separated by 15% SDS-polyacrylamide gel
electrophoresis and transferred to a nitrocellulose membrane by
electroblotting. The blotted membrane was blocked with freshly prepared
TBS containing 3% nonfat dry milk (TBS-milk) for 1 hour at room
temperature. The nitrocellulose membrane was incubated with 1:2000
dilution of antiacetyl histone H4, chromatin immunoprecipitation
(ChIP) grade (Upstate Biotechnology) in TBS-milk, overnight at
4°C. The membrane was washed 3 times with water and incubated with
donkey antirabbit immunoglobulin G (IgG) 1:10 000 in TBS-milk for 1.5 hours at room temperature. Blots were washed 3 times with water and
once with TBS-0.05% Tween 20 for 5 minutes. After rinsing the membrane
with 4 changes of water, detection of bound antibodies was carried out
by using the ECL detection Kit (Amersham-Pharmacia) according to the
manufacturer's instructions.
| |
Results |
Stimulation of fetal hemoglobin production by HDAC
inhibitors
We have investigated the HbF-stimulating potential of the HDAC
inhibitors trichostatin A, SAHA, HC-toxin, MS-275, and apicidin in
human K562 erythroleukemia cells. These cells are widely used as an in
vitro model system for the investigation of compounds with HbF-inducing
activity. Cells were cultured with increasing concentrations of the
respective HDAC inhibitor for 4 days. HbF concentrations in
total cellular extracts were determined by ELISA as described.
Figure 1 shows that the HbF-inducing
potential of the HDAC inhibitors varied significantly. Whereas
trichostatin A, SAHA, and HC-toxin showed relatively weak stimulation,
apicidin increased HbF synthesis up to 10-fold compared with untreated control cells at a concentration of 0.1 to 1 µM (Figure 1, black bars). At the concentrations effective in stimulating HbF synthesis, inhibition of cell proliferation also varied significantly (Figure 1,
white bars). Apicidin showed relative low cytotoxicity in this regard.
View larger version (32K):
[in this window]
[in a new window]
| Figure 1.
Induction of HbF synthesis in K562 cells by HDAC
inhibitors.
Cells were treated with increasing concentrations of the HDAC
inhibitors TSA, SAHA, HC-toxin, MS-275, apicidin, or solvent only (0 value) for 4 days. HbF was determined from total cellular extracts by
ELISA, normalized by total protein concentrations of extracts, and
expressed as nanogram HbF per microgram protein (black bars).
Cytotoxicity was assessed by counting cell numbers (white bars). Cell
numbers were expressed relative to untreated cells (100%). Each
experiment was performed at least 4 times, and standard errors were
calculated as indicated.
|
|
At the cellular level, apicidin increased the number of
benzidine-positive (ie, hemoglobin-containing) cells from 3% up to 70% after 4 days of treatment (Figure
2). Butyrate, a compound with
well-documented hemoglobin-inducing activity in K562 cells, leads to
detectable hemoglobin in 20% of cells in the same time. After removal
of the compounds, apicidin-treated K562 cells remained benzidine
positive for at least another 8 days, whereas benzidine-positivity reverted back to untreated control levels in butyrate-induced cells.
This finding suggests that apicidin, in contrast to butyrate, is an
irreversible inhibitor of HDAC in vivo, as has been found in HeLa
cells.16 Alternatively, the compound may persist in cells
much longer than butyrate, resulting in continuous blockage of HDAC
activity.
View larger version (99K):
[in this window]
[in a new window]
| Figure 2.
Benzidine staining of K562 cells treated with butyrate
and apicidin.
Cells were cultured in the absence (control) or presence of 0.5 µM
apicidin (left panels) or 0.6 mM butyrate (right panels) for 4 days (4 d+). Thereafter, the compounds were removed from medium and cultured
for another 4 days (4 d+/4 d) or 8 days (4 d+/8 d), respectively.
After harvesting, intracellular hemoglobin was detected by benzidine
staining, and cell smears were subjected to microscopy using × 400
magnification.
|
|
Comparison of the HDAC inhibitors (Figure
3A, black bars) with previously tested
agents (Figure 3A, gray bars) at concentrations with maximum
HbF-inducing activity revealed that apicidin was much more effective in
stimulating HbF-production than butyrate, hydroxyurea, 5-azacytidine,
phenylacetate, isobutyramide, and valproic acid. At the
concentrations used, the inhibitory action on cell proliferation varied
among the different compounds tested (Figure 3B). Again, apicidin
revealed relatively low cytotoxicity at a concentration with maximum
HbF-inducing activity. To investigate the specificity of HDAC
inhibitors on fetal hemoglobin stimulation, we determined the HbF/total
hemoglobin ratio (Figure 3C). All HDAC inhibitors investigated
increased the proportion of HbF relative to total hemoglobin in K562
cells. Apicidin caused a 3-fold increase of the HbF/Hb ratio compared
with untreated control cells.
View larger version (31K):
[in this window]
[in a new window]
| Figure 3.
Comparison of various HbF-inducing compounds on HbF
synthesis and globin mRNA expression in K562 cells.
Cells were treated with HDAC inhibitors (black bars) and different
HbF-inducing compounds (gray bars) by using concentrations with maximum
HbF-inducing activity or solvent only (white bars) for 4 days. HbF per
total protein (A) and cell numbers (B) were expressed relative to
untreated control cells. (C) HbF per total Hb. Each experiment was
performed 4 times, and standard errors were calculated as indicated. Co
indicates untreated control cells; But, 0.6 mM butyrate; PA, 2 mM
phenylacetate; Iso, 2 mM isobutyramide; Hu, 100 µM hydroxyurea; 5-aC,
5 µM 5-aza-cytidine; and Val, 2 mM valproate. (D) Analysis of globin
mRNA expression in untreated () and apicidin-treated (+) K562 cells
by quantitative real-time RT-PCR. mRNA expression of untreated and
apicidin-treated cells was quantified by real-time RT-PCR, values were
normalized by -actin mRNA, and data expressed relative to untreated
control cells. Experiments were repeated 3 times and standard errors
were calculated.
|
|
Because the HbF-inducing activity of apicidin is expected to be related
to increased transcription of the -globin genes, we measured
-globin mRNA levels by quantitative real-time RT-PCR. As shown in
Figure 3D, apicidin induced a 16-fold increase of -globin mRNA
expression, but only a 2- to 3-fold increase of -globin mRNA
expression compared with untreated control cells. Similar results were
obtained for butyrate (not shown). Thus, apicidin appears to exhibit
relative specificity for -globin mRNA expression as the protein data
suggested (Figure 3C).
Induction of histone hyperacetylation correlates with stimulation
of HbF synthesis
The difference of the HbF-stimulating potential of the HDAC
inhibitors tested might be due to their different ability to induce hyperacetylation of histones in K562 cells. To address this question, we have treated cells with a weak (TSA), a medium (MS-275), and a
strong HbF inducer (apicidin), respectively, and compared the degree of
histone H4 hyperacetylation by Western blot analysis using antiacetyl
histone H4 antibodies (Figure 4). The
immunoblot indicates that the degree of H4 acetylation correlated well
with the potential of the compounds to stimulate HbF synthesis, ie, TSA
less than MS-275 less than apicidin.
View larger version (48K):
[in this window]
[in a new window]
| Figure 4.
Induction of histone hyperacetylation correlates with
stimulation of HbF synthesis.
K562 cells were treated with the HDAC inhibitors TSA, MS-275, apicidin,
or DMSO (co) for 1 hour, respectively. Histone proteins were prepared
by acid extraction, and acetylation of histone H4 was determined by
Western blot analysis by using a specific antiacetyl H4 histone
antibody (top panel). Coomassie staining of the corresponding gel shows
equal loading (20 µg) of histone proteins (H2A, H2B, H4) on each lane
(middle panel). Bottom panel shows stimulation of HbF synthesis by the
respective HDAC inhibitor after 4 days of treatment. H4 ac indicates
acetylated histone H4; H2A, H2B, H4; histone proteins H2A, H2B,
H4.
|
|
Apicidin modulates MAP kinase signal transduction pathways
We have previously reported that inhibition of ERK and
activation of p38 kinase of the MAP kinase signal transduction system are involved in butyrate-mediated erythroid differentiation of K562
cells.17 If these modulations are associated with the HDAC inhibitory activity of butyrate, apicidin treatment of cells should lead to a similar change in the phosphorylation pattern of MAP kinases.
Figure 5 shows that phosphorylation of
p38 kinase started to increase 3 hours after addition of apicidin to
cells and remained activated for the entire experimental period of 4 days. In contrast, phosphorylation of ERK did not change significantly
during the experimental period. Phosphorylation of JNK was not
detected, and changes in phosphorylation patterns were not observed.
Thus, apicidin activates p38 signaling but has no effect on ERK- or JNK-MAP kinase pathways.
View larger version (78K):
[in this window]
[in a new window]
| Figure 5.
Changes in MAP kinase phosphorylation patterns following
apicidin treatment of K562 cells.
Cells were treated with 0.5 µM apicidin for the various times
indicated and harvested, and 20 µg cell lysate was subjected to
Western blot analysis by using specific antibodies against
phosphorylated p38, ERK1/2, and JNK1/2, respectively. Blots were
stripped and reprobed with pan antibodies against p38, ERK1/2, and
JNK1/2, referred to as total in the figure. Lower panel shows HbF
synthesis during the course of the experiment. Similar results were
obtained in a second series of experiments.
|
|
To further investigate the role of p38 signaling, we next examined the
influence of the specific p38 inhibitor SB20358018-20 on
HbF stimulation by apicidin. Previously, we found that SB203580 inhibited butyrate- but not hemin-induced stimulation of hemoglobin synthesis in K562 cells.17 This finding indicated that
this p38 MAP kinase inhibitor is not a general inhibitor of erythroid differentiation in K562 cells. SB203580 inhibited the HbF-inducing effect of apicidin in a concentration-dependent manner (Figure 6A, black bars). At a concentration of 5 to 10 µM, SB203580 completely abolished the HbF-inducing effect of
apicidin. In contrast, ERK pathway inhibitor UO12621
rather increased apicidin-induced HbF synthesis in K562 cells (Figure
6A, gray bars). Interestingly, p38 inhibitor SB203580 also reverted the
apicidin-induced increment of the HbF/total Hb ratio back to untreated
control level (Figure 6B, black bars), whereas ERK inhibitor UO126 did
not significantly influence the HbF/Hb ratio (Figure 6B, gray bars),
indicating that activation of p38 signaling might be specific for
induction of -globin gene expression. At the concentrations used,
SB203580 did not influence cell proliferation (Figure 6C). UO126
decreased cell numbers by 40% to 50% but was not toxic for K562 cells
as evidenced by trypan blue staining (not shown).
View larger version (27K):
[in this window]
[in a new window]
| Figure 6.
Effect of p38 inhibitor SB203580 and ERK inhibitor UO126
on apicidin-mediated induction of HbF synthesis in K562 cells.
Cells were cultured for 4 days in the presence of 0.5 µM apicidin
(gray and black bars) or 0.1% (vol/vol) DMSO (white bars).
p38-specific inhibitor SB203580 (black bars) or ERK pathway inhibitor
UO126 (gray bars) were added in increasing concentrations 1 hour prior
to apicidin. After harvesting, cells were lysed, and HbF, total Hb, and
total protein concentrations were determined. HbF per total protein (A)
and HbF per total hemoglobin (B) were calculated as indicated. Cell
numbers relative to untreated control cells (100%) are depicted in
(C). Each experiment was performed 4 times, and standard errors were
calculated as shown in the figure.
|
|
Apicidin activates A-globin gene promoter
To investigate the influence of apicidin on A-globin
promoter activity, we conducted reporter gene experiments. The
1436-bp A-globin promoter fragment was cloned into a luciferase
reporter gene plasmid, and the construct was transiently transfected
into K562 cells by lipofection. The time course of A-globin promoter activity following apicidin treatment of cells is depicted in Figure
7. Apicidin stimulated promoter activity
as early as 3 hours after addition to culture medium, and promoter
activity peaked after 24 hours of treatment (Figure 7, white bars).
Again, inhibition of p38 signaling by SB203580 resulted in inhibition of A-globin promoter activation by apicidin (Figure 7, hatched bars), suggesting that p38 signaling is involved in apicidin-induced activation of the A-globin promoter.
View larger version (22K):
[in this window]
[in a new window]
| Figure 7.
Activation of A-globin gene promoter by apicidin in
K562 cells.
Cells were transiently transfected with a 1435-bp
A-promoter/luciferase reporter gene construct and subsequently
treated with 0.5 µM apicidin for the various times indicated. After
determination of luciferase activity from cell lysates as described in
"Materials and methods," values were expressed relative to the
activity of the 0 [h] value. Hatched bars show results of transfected
cells that have been treated with p38 inhibitor SB203580 prior to
addition of apicidin. Each experiment was performed 3 times, and
standard errors were calculated as indicated.
|
|
To investigate the influence of p38 signaling on histone
hyperacetylation, we have pretreated K562 cells with SB203580 and then
looked for induction of H4 hyperacetylation by apicidin. We observed no
influence of inhibition of p38 signaling on histone acetylation (data
not shown).
| |
Discussion |
Butyrate analogues have long been recognized as inducers of fetal
hemoglobin expression in erythroid cells; therefore, these compounds
have been used in small clinical trials for the treatment of
-thalassemia.4-8 However, because of rapid metabolism,
inconvenient mode of application, and relatively weak HbF-inducing
activity of butyrate analogues, alternative substances with
HbF-inducing activity are warranted. One approach would be to search
for compounds that mimic the molecular action of butyrate. In this
regard, butyrate has been shown to inhibit histone deacetylases
(HDACs), leading to hyperacetylation of nuclear
histones.9-11 Acetylation neutralizes the positively
charged histones and subsequently weakens interactions with DNA,
resulting in an open nucleosomal configuration.22,23 Such
a conformation facilitates access for transcriptional
regulators,24,25 and histone acetylation patterns have
recently been shown to play a role in the developmental control of
murine -globin gene expression.26 Furthermore, the
specific HDAC inhibitors trichostatin A, trapoxin, and HC-toxin have
been found to induce -globin gene expression in erythroid
cells.12,27 However, the HbF-inducing potential of these
compounds is relatively weak, being in the order of 1.5- to 2-fold over
HbF production in untreated control cells. The hemoglobin-inducing
potential of these specific HDAC inhibitors is even lower compared with
arginine butyrate in K562 cells.12
In the present paper, we show that a recently identified HDAC
inhibitor, apicidin, is a very potent HbF-inducing compound. Apicidin
was originally isolated as a fungal metabolite from Fusarium species that exhibits broad spectrum antiprotozoal activity by inhibiting parasite histone deacetylases.28 It has been
shown to induce morphologic changes in tumor cells and to induce
expression of the cell cycle-regulating proteins p21WAF1
and gelsolin.16 Compared with other HDAC inhibitors,
apicidin has a relative low IC50 (concentration that
inhibits 50%) of 0.7 nM28 and 5 nM,16
indicative of a high HDAC affinity. We found that apicidin strongly
induced hyperacetylation of H4 histones in K562 erythroid cells and was
the most potent inducer of HbF synthesis compared with the HDAC
inhibitors TSA, HC-toxin, SAHA, MS-275, and butyrate. Furthermore,
apicidin caused a 3-fold increase in HbF/total Hb ratio at the protein
level and induced -globin mRNA expression 16-fold, whereas
-globin mRNA was stimulated only 2- to 3-fold. This finding was
indicative of specific action on -globin gene expression. At the
concentration with maximum HbF-inducing activity, apicidin showed
relatively low cytotoxicity. Taken together, these data suggest that
apicidin could be an effective HbF inducer in vivo, and further
investigations using murine models of thalassemia are required.
The different HbF-inducing potencies of the investigated HDAC
inhibitors might be due to their different affinities for the respective histone deacetylases associated with the fetal globin genes
or other involved target genes. For example TSA exhibits much lower
IC50 values for HDAC1 compared with HDAC4, and trapoxin B
has a 3000-fold higher IC50 value for HDAC6 compared with
HDAC1.29
In addition to affecting chromatin structure by histone
hyperacetylation, HDAC inhibitors may induce other biologic responses in cells as well. We have observed that the MAP kinase signal transduction system contributes to the molecular action of butyrate, a
compound with HDAC-inhibiting activity, during erythroid
differentiation of K562 cells.17 In the present report, we
found that activation of p38 MAP kinase is also involved in the
HbF-inducing activity of apicidin. P38 belongs to a group of kinases
known to be activated by cellular stress such as heat, hyperosmolarity,
x-radiation, and heavy metal ions,30,31 and, thus, we were
able to show in a previous report that heat shock and hyperosmolarity
can induce hemoglobin production in K562 cells.32
Additionally, p38 has been shown to be involved in
erythropoietin-induced erythroid differentiation of mouse
erythroleukemia cells,33,34 demonstrating that HDAC
inhibitors and cytokines might share the same signaling pathways with
respect to induction of globin gene expression. In contrast to
butyrate, apicidin did not affect ERK signaling, but ERK pathway
inhibitor UO126 acted synergistically with both butyrate and apicidin
on stimulation of hemoglobin production in K562 cells. The molecular
link between inhibition of histone deacetylase activity and p38 MAP
kinase signaling needs further investigation.
In summary, we have identified the HDAC inhibitor apicidin as a
compound with strong HbF-inducing potential at nanomolar to micromolar
concentrations. Our data outline the role of HDAC inhibition and p38
MAP kinase signaling as molecular targets for pharmacologic stimulation
of HbF production in erythroid cells. Further studies need to
investigate the in vivo potential of apicidin in the treatment of
-thalassemia.
| |
Footnotes |
Submitted September 8, 2002; accepted October 1, 2002.
Prepublished
online as Blood First Edition Paper, October 17, 2002; DOI
10.1182/blood-2002-08-2617.
Supported by a grant from the Deutsche Forschungsgemeinschaft
(Wi 1461/3) and by the B. Braun-Stiftung, Melsungen.
The publication costs of this
article were defrayed in part by
page charge payment. Therefore,
and solely to indicate this fact,
this article is hereby marked
"advertisement"
in accordance with 18 U.S.C.
section 1734.
Reprints: Olaf Witt, Laboratory for Hematological and
Cancer Research, Children's Hospital, University of Göttingen,
Robert-Koch-Str. 40; D-37075 Göttingen, Germany; e-mail:
owitt{at}gwdg.de.
| |
References |
1.
Olivieri NF.
The beta-thalassemias.
N Engl J Med.
1999;341:99-109[Free Full Text].
2.
Atweh GF, Loukopoulos D.
Pharmacological induction of fetal hemoglobin in sickle cell disease and beta-thalassemia.
Semin Hematol.
2001;38:367-373[CrossRef][Medline]
[Order article via Infotrieve].
3.
Rodgers GP, Sauntharajah Y.
Advances in experimental treatment of beta-thalassaemia.
Exp Opin Invest Drugs.
2001;10:925-934.
4.
Perrine SP, Ginder GD, Faller DV, et al.
A short-term trial of butyrate to stimulate fetal-globin-gene expression in the beta-globin disorders.
N Engl J Med.
1993;328:81-86[Abstract/Free Full Text].
5.
Blau CA, Constantoulakis P, Shaw CM, Stamatoyannopoulos G.
Fetal hemoglobin induction with butyric acid: efficacy and toxicity.
Blood.
1993;81:529-537[Abstract/Free Full Text].
6.
Dover GJ, Brusilow S, Charache S.
Induction of fetal hemoglobin production in subjects with sickle cell anemia by oral sodium phenylbutyrate.
Blood.
1994;84:339-343[Abstract/Free Full Text].
7.
Sher GD, Ginder GD, Little J, Yang S, Dover GJ, Olivieri NF.
Extended therapy with intravenous arginine butyrate in patients with beta-hemoglobinopathies.
N Engl J Med.
1995;332:1606-1610[Abstract/Free Full Text].
8.
Reich S, Bührer C, Henze G, et al.
Oral isobutyramide reduces transfusion requirements in some patients with homozygous beta-thalassemia.
Blood.
2000;96:3357-3363[Abstract/Free Full Text].
9.
Cousens LS, Gallwitz D, Alberts BM.
Different accessibilities in chromatin to histone acetylase.
J Biol Chem.
1978;254:1716-1723.
10.
Candido EMP, Reeves R, Davie JR.
Sodium butyrate inhibits histone deacetylation in cultured cells.
Cell.
1978;14:105-113[CrossRef][Medline]
[Order article via Infotrieve].
11.
Doenecke D, Gallwitz D.
Acetylation of histones in nucleosomes.
Mol Cell Biochem.
1982;44:113-128[CrossRef][Medline]
[Order article via Infotrieve].
12.
McCaffrey PG, Newsome DA, Fibach E, Yoshida M, Su MSS.
Induction of gamma-globin by histone deacetylase inhibitors.
Blood.
1997;5:2075-2083.
13.
Yoshida M, Nomura S, Beppu T.
Effects of trichostatins on differentiation of murine erythroleukemia cells.
Cancer Res.
1987;47:3688-3691[Abstract/Free Full Text].
14.
Witt O, Albig W, Doenecke D.
Transcriptional regulation of the human replacement histone gene H3.3B.
FEBS Lett.
1997;408:255-260[CrossRef][Medline]
[Order article via Infotrieve].
15.
Yoshida M, Kijima M, Akita M, Beppu T.
Potent and specific inhibition of mammalian histone deacetylase both in vivo and in vitro by trichostatin A.
J Biol Chem.
1990;265:17174-17179[Abstract/Free Full Text].
16.
Han JW, Ahn SH, Park SH, et al.
Apicidin, a histone deacetylase inhibitor, inhibits proliferation of tumor cells via induction of p21 WAF1/Cip1 and gelsolin.
Cancer Res.
2000;60:6068-6074[Abstract/Free Full Text].
17.
Witt O, Sand K, Pekrun A.
Butyrate induced erythroid differentiation of human K562 cells involves inhibition of ERK and activation of p38 MAP kinase-pathways.
Blood.
2000;95:2391-2396[Abstract/Free Full Text].
18.
Lee JC, Laydon JT, McDonnell PC, et al.
A protein kinase involved in the regulation of inflammatory cytokine biosynthesis.
Nature.
1994;372:739-746[CrossRef][Medline]
[Order article via Infotrieve].
19.
Cuenda A, Rouse J, Doza YN, et al.
SB 203580 is a specific inhibitor of a MAP kinase homologue which is stimulated by cellular stresses and interleukin-1.
FEBS Lett.
1995;364:229-233[CrossRef][Medline]
[Order article via Infotrieve].
20.
Badger AM, Bradbeer JN, Votta B, Lee JC, Adams JL, Griswold DE.
Pharmacological profile of SB 203580, a selective inhibitor of cytokine suppressive binding protein/p38 kinase, in animal models of arthritis, bone resorption, endotoxin shock and immune function.
J Pharmacol Exp Ther.
1996;279:1453-1461[Abstract/Free Full Text].
21.
Favata M, Horiuchi KY, Manos EJ, et al.
Identification of a novel inhibitor of mitogen activated protein kinase kinase.
J Biol Chem.
1998;273:18623-18632[Abstract/Free Full Text].
22.
Hansen JC, Tse C, Wolffe AP.
Structure and function of the core histone N-termini: more than meets the eye.
Biochemistry.
1998;37:17637-17641[CrossRef][Medline]
[Order article via Infotrieve].
23.
Walia H, Chen HY, Sun JM, Holth LT, Davie JR.
Histone acetylation is required to maintain the unfolded nucleosome structure associated with transcribing DNA.
J Biol Chem.
1998;273:14516-14522[Abstract/Free Full Text].
24.
Nightinghale KP, Wellinger RE, Sogo JM, Becker PB.
Histone acetylation facilitates RNA polymerase II transcription of the Drosophila hsp26 gene in chromatin.
EMBO J.
1998;17:2865-2876[CrossRef][Medline]
[Order article via Infotrieve].
25.
Tse C, Sera T, Wolffe AP, Hansen JC.
Disruption of higher order folding by core histone acetylation dramatically enhances transcription of nucleosomal arrays by RNA polymerase III.
Mol Cell Biol.
1998;18:4629-4638[Abstract/Free Full Text].
26.
Forsberg EC, Downs KM, Christensen HM, Im H, Nuzzi PA, Bresnick EH.
Developmentally dynamic histone acetylation pattern of a tissue-specific chromatin domain.
Proc Natl Acad Sci U S A.
2000;97:14494-14499[Abstract/Free Full Text].
27.
Smith RD, Li J, Noguchi CT, Schechter AN.
Quantitative PCR analysis of HbF inducers in primary human adult erythroid cells.
Blood.
2000;95:863-869[Abstract/Free Full Text].
28.
Darkin-Rattray SJ, Gurnett AM, Myers RW, et al.
Apicidin: a novel antiprotozoal agent that inhibits parasite histone deacetylase.
Proc Natl Acad Sci U S A.
1996;93:13143-13147[Abstract/Free Full Text].
29.
Yoshida M, Furumai R, Nishiyama M, Komatsu Y, Nishino N, Horinouchi S.
Histone deacetylase as a new target for cancer chemotherapy.
Cancer Chemother Pharmacol.
2001;48(suppl 1):S20-S26[Medline]
[Order article via Infotrieve].
30.
Lewis TS, Shapiro PS, Ahn NG.
Signal transduction through MAP kinase cascades.
Adv Cancer Res.
1998;74:49-139[Medline]
[Order article via Infotrieve].
31.
Seger R, Krebs EG.
The MAPK signaling cascade.
FASEB J.
1995;9:726-735[Abstract].
32.
Witt O, Schulze S, Kanbach K, Roth C, Pekrun A.
Tumor cell differentiation by butyrate and environmental stress.
Cancer Lett.
2001;171:173-182[CrossRef][Medline]
[Order article via Infotrieve].
33.
Nagata Y, Takahashi N, Davis RJ, Todokoro K.
Activation of p38 MAP kinase and JNK but not ERK is required for erythropoietin-induced erythroid differentiation.
Blood.
1998;92:1859-1869[Abstract/Free Full Text].
34.
Nagata Y, Todokoro K.
Requirement of activation of JNK and p38 for environmental stress-induced erythroid differentiation and apoptosis and of inhibition of ERK for apoptosis.
Blood.
1999;94:853-863[Abstract/Free Full Text].
 CiteULike  Connotea  Del.icio.us  Digg |
Top
Abstract
Introduction