|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Prepublished online as a Blood First Edition Paper on November 27, 2002; DOI 10.1182/blood-2002-09-2800.
GENE THERAPY
From the Clinical Gene Therapy Branch, Genetics
and Molecular Biology Branch, Medical Genetics Branch, National Human
Genome Research Institute, National Institutes of Health, Bethesda, MD;
Genetic Therapy, Gaithersburg MD; Department of Transfusion Medicine,
Clinical Center, National Institutes of Health, Bethesda, MD;
Department of Laboratory Medicine, Clinical Center, National Institutes
of Health, Bethesda, MD; Walter Reed Army Medical Center, Washington,
DC; Hematology Branch, National Heart, Lung, and Blood Institute,
National Institutes of Health, Bethesda, MD; and Fund for
Inherited Disease Research, Newtown, PA.
The first human gene therapy experiment begun in September 1990 used a retroviral vector containing the human adenosine deaminase (ADA)
cDNA to transduce mature peripheral blood lymphocytes from patients
with ADA deficiency, an inherited disorder of immunity. Two patients
who had been treated with intramuscular injections of pegylated bovine
ADA (PEG-ADA) for 2 to 4 years were enrolled in this trial and each
received a total of approximately 1011 cells in 11 or 12 infusions over a period of about 2 years. No adverse events were
observed. During and after treatment, the patients continued to receive
PEG-ADA, although at a reduced dose. Ten years after the last cell
infusion, approximately 20% of the first patient's lymphocytes still
carry and express the retroviral gene, indicating that the effects of
gene transfer can be remarkably long lasting. On the contrary, the
persistence of gene-marked cells is very low (< 0.1%), and no
expression of the transgene is detectable in lymphocytes from the
second patient who developed persisting antibodies to components of the
gene transfer system. Data collected from these original patients have
provided novel information about the longevity of T lymphocytes in
humans and persistence of gene expression in vivo from vectors driven
by the Moloney murine leukemia virus long-terminal repeat (LTR)
promoter. This long-term follow-up has also provided unique evidence
supporting the safety of retroviral-mediated gene transfer and
illustrates clear examples of both the potential and the pitfalls of
gene therapy in humans.
(Blood. 2003;101:2563-2569) Adenosine deaminase (ADA, EC3.5.4.4) is an enzyme
in the purine salvage pathway that catalyzes the deamination of
adenosine and deoxyadenosine to inosine and deoxyinosine, respectively. Mutations of the ADA gene can result in profound
enzyme deficiency and severe combined immunodeficiency (SCID) with
virtual lack of T- and B-cell function.1,2 HLA-identical
bone marrow transplantation (BMT) is the therapy of choice;
however only a minority of patients has access to a fully matched
donor. Alternative options are haploidentical BMT3,4 and
enzyme replacement with polyethylene glycol-conjugated bovine ADA
(PEG-ADA).5
In the mid 1980s gene transfer was proposed as a therapy for ADA
deficiency. The simple regulation of the ADA
gene6 and the expected selective advantage of
gene-corrected cells suggested ADA deficiency as an ideal initial
candidate disease to test gene therapy. Because of the difficulty of
transducing hematopoietic stem cells, and the observation that BMT
patients with only donor T-lymphocyte engraftment had good immunologic
reconstitution, it was postulated that genetic correction of autologous
T cells could be clinically beneficial.7 Testing of the
hypothesis was feasible because patients on PEG-ADA therapy had
developed circulating peripheral T lymphocytes that could be targeted
with gene transfer.
The first phase 1 gene therapy trial began September 14, 1990, with
infusion of a 4-year-old girl with ADA deficiency with autologous T
cells transduced ex vivo with the retroviral vector LASN containing the
cDNA for human ADA.8 In January 1991, identical treatment was begun for a 9-year-old girl. Patient histories, ADA mutations, and details of the protocol have been
described previously.9,10 Between 1990 and 1992, approximately 1011 total lymphocytes were administered over
11 or 12 infusions to each patient. Twenty percent of the circulating T
cells from patient 1 contain the ADA vector 10 years after treatment
began, whereas less than 0.1% of T cells from patient 2 have
detectable vector. Both patients continue to receive weekly
injections of PEG-ADA although at a reduced dose (7-13 U/kg per week).
We present the results of immunologic and molecular studies carried out
over a decade documenting the safety of retroviral gene transfer and long-term persistence of vector-containing, polyclonal T cells. In
addition we offer an hypothesis to explain the disparity in the
ultimate responses of these 2 patients.
Patients
ADA enzyme assay
Real-time PCR analysis DNA was isolated using the PureGene kit (Gentra, Minneapolis, MN). A total of 500 ng of each DNA sample was added to a mixture of 10 µM neomycin (neo) primers (forward primer, TTGTCAAGACCGACCTGTCC; reverse primer, TTCGCTTGGTGGTCGAATG) and 5 µM LASN probe (CAGCTGTGCTCGACGTTGTCACTGAA) with Taqman 2× polymerase chain reaction (PCR) Master Mix. Samples were run in triplicate. Serial dilutions of DNA obtained from a cell line containing a single copy of the LASN vector were used to establish a standard curve. Reactions were run in an ABI Prism 7700,12 and analysis of the percentage of LASN+ cells was performed with Sequence Detection Systems 1.6.3 (PE Applied Biosystems, Foster City, CA).Proliferation assay PBMCs (2 × 105/well) were stimulated in triplicate with phytohemagglutinin (PHA; 10 µg/mL; Wellcome Diagnostics, Research Triangle, NC) for 3 days, tetanus toxoid (3 LF/mL; Connaught Laboratories, Toronto, ON, Canada), and diphtheria toxoid (25 LF/mL; Commonwealth of Massachusetts, Boston) for 7 days. Plates were then pulsed for 4 to 5 hours with 0.037 MBq (1 µCi)/well of 3H-thymidine (New England Nuclear, Boston, MA), harvested with a Tomtec plate washer, and counted on a Betaplate counter (Wallac, Gaithersburg, MD). Stimulation index was calculated as net counts per minute of the stimulated samples/counts per minute of media control.Fluorescence-activated cell sorter (FACS) analysis PBMCs (5 × 105) were stained with V monoclonal
antibodies (Immunotech/Coulter, Miami, FL), followed by fluorescein
isothiocyanate (FITC)-labeled goat antimouse (BioSource,
Vacaville, CA), blocked with mouse immunoglobulin G1 (IgG1) kappa
(Sigma, St Louis, MO), stained with phycoerythrin (PE)-labeled CD3
antibody (Immunotech/Coulter) and either PECy5-labeled CD4 or CD8
antibody (BD Biosciences, San Jose, CA). Cells were collected
(105/tube) on a FACSCalibur (Becton Dickinson, Franklin
Lakes, NJ), analyzed using CellQuest software (BD Biosciences), and
compared with normal range values provided by Immunotech/Coulter.
Complementarity-determining region-3 (CDR3) size distribution
analysis of T-cell receptor (TcR) V 14-specific primer in conjunction
with a 6-fluoroscein phosphoramidite-labeled C primer and analyzed as described.13
Single cell clones PHA (5 µg/mL) or OKT3 (100 ng/mL) activated patient lymphocytes were cloned by limiting dilution and transformed with human T-cell leukemia virus type I (HTLV-I)-producing cells irradiated at 12 500 rad as described.14Southern blot analysis DNA was isolated using the PureGene kit. A total of 10 µg of each DNA sample was digested with EcoRI, BglII, HindIII, or SstI (Life Technologies, Rockville, MD). DNA digests were electrophoresed in 1% agarose gels and transferred to Hybond-N+ membranes (Amersham). Hybridization was performed with 32P-neo probe,10 and bands were visualized by autoradiography.Immunoprecipitation assay Ouchterlony plates were poured with a 0.6% agarose layer (SeaKem; FMC Bioproducts, Rockland, ME) in barbitol buffer (Sigma). Antigens (neat or diluted as indicated) were placed in the outer wells, and whole patient serum (10 µL) was placed in the center well. After radial diffusion, antigen/antibody complex precipitin bands were visualized using reflected light.Western blot Analysis of patients' sera for the presence of anti-Moloney murine leukemia virus (MMLV) p30 was performed as described.15 Briefly, concentrated stock of murine retrovirus was denatured and separated on a sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel followed by blotting to a nitrocellulose membrane and staining with patient serum. Monkey sera of known reactivity were used as positive and negative controls. Each serum sample was run with a molecular weight marker lane to the left.
ADA levels in PBMCs reflect the percentage of gene-corrected cells Using real-time PCR technology, we performed a series of retrospective studies on archived cryopreserved PBMCs and quantitated the levels of gene transfer achieved in the cell infusions and patients' circulating lymphocytes. The difference in numbers of gene-corrected cells received by the 2 patients was remarkable: infusions given to patient 1 ranged from 18.2% to 53.3% LASN positive (LASN+), whereas infusions given to patient 2 ranged from 0.9% to 3.1% LASN+ cells (Table 1).
Accordingly, patient 1 received more gene-marked cells in the 7th infusion (2.2 × 109) than patient 2 received in toto from the 11 (of 12 total) infusions that were tested (1.76 × 109). Thus, patient 1 received more than 2 logs more vector-marked T cells during the course of the entire protocol than did patient 2. ADA enzyme activity (negligible to undetectable before treatment) was analyzed to assess transgene expression. ADA activity in the infusions received by patient 1 ranged from 2.7 to 20.8 units (1 unit = 1 nmol/min/108 cells), whereas infusions given to patient 2 had ADA levels from 2.1 to 4.9 units (Table 1). This finding suggests that the higher ADA values and percentage of
gene-marked cells found in the circulation of patient 1 over time
reflect in part the larger numbers of gene-marked cells received
(Figure 1A). Three and a half years after
the last infusion, the gene-marked cells constituted more than 40% of
her circulating lymphocytes. Sixteen months after treatment began, ADA
levels had risen to a level approximately one fifth of normal and have fluctuated between one third to one fifth of normal over the past 5 years.
The lower numbers of gene-corrected cells received by patient 2 are reflected in the lower numbers of gene-marked cells in the blood and lower ADA values achieved (Figure 1B). Patient 2's ADA levels did increase during the time of cell infusions. On protocol day 90, after the 3rd infusion, and on protocol day 291, after the 7th infusion, approximately 2.5% of patient 2's circulating lymphocytes contained vector sequences; however, this dropped to less than 1% by protocol day 333 before the 9th infusion. An attempt at stem cell gene therapy with 7.4 × 107 autologous granulocyte colony-stimulating factor (G-CSF)-mobilized peripheral CD34+ cells transduced with the G1NaSvAd.24 vector16 was unsuccessful. This treatment produced a transient rise in the ADA levels of circulating PBMCs, but ADA levels subsequently fell and have remained below 2 units for the past 9 years (Figure 1B), whereas the percentage of detectable gene-corrected cells has been less than 0.1%. No G1NaSvAd.24 vector sequences were detectable in patient 2's PBMCs at any of the time points tested. T-cell numbers and function after gene therapy Following initiation of gene therapy, the total number of CD3+ T cells circulating in both patients increased to normal values. After cell infusions stopped, T-cell numbers remained within the normal range for approximately 5 years even as the dose of PEG-ADA was decreasing by approximately 30% in patient 1 and approximately 40% in patient 2. During the past 4 years, both patients' T-cell counts have declined below the normal range. Patient 1 has approximately 610 × 106 circulating CD3+ T cells/L, whereas patient 2 has approximately 420 × 106 CD3+ T cells/L (normal range, 832-2028 × 106/L) (Figure 2A). Over the 12 years of the protocol, proliferative responses of patient lymphocytes to PHA have fluctuated above or below the range for healthy control subjects for both patients (Figure 2B). Response to the recall antigens tetanus (Figure 2C) and diphtheria (Figure 2D) were vigorous for several years following cell infusions and have diminished over the past 3 years, although they remain within the lower range for healthy control subjects. Isohemagglutinin titers that had increased to a high of 1:256 in both patients 3 to 4 months after cell infusions began9 are now at titers of 1:32 in both subjects. Delayed type hypersensitivity skin tests that had become vigorously positive soon after treatment9 have been very weak or absent for the past 4 years.
Expansion of T lymphocytes expressing the T-cell receptor (TcR)
V families. Five years after the last cell infusion, patient 1 had cells expressing most of
the TcR V families, with an expansion in the percentage of CD3+ T cells that stained positive for TcR V14 (Figure
3). Subset analysis revealed that 35% of
CD8 T cells and 2% of CD4 T cells expressed V14. A pretreatment
sample contained 8% V14+ T cells, suggesting that this
population had expanded over time. Oligoclonal expansion of
CD8+ T cells has been reported in the
elderly17 and in normal individuals.18,19 However, because monoclonal cell expansion could also be the result of
insertional mutagenesis, or a growth advantage because of genetic correction, further studies were initiated.
Cells were separated into TcR V
Spectratyping20 of the TcR Single T-cell clones were obtained by limiting dilution from
HTLV-1-immortalized peripheral blood lymphocytes (PBLs) at various time points (approximately 3.5, 4, 5, and 6.4 years after the last cell infusion). Of the clones shown in Figure 4, 5 were
CD4+, TcR V Patient 2 had a normal TcR repertoire distribution, with occasional
absence of TcR V Immune response to fetal calf serum (FCS) The rapid disappearance of LASN+ cells after each infusion observed in patient 2 (Figure 1B) raised suspicions of an immune-mediated elimination. Therefore, stored serial serum samples from both patients were analyzed for the presence of precipitating antibodies to components of the gene transfer system using the double diffusion Ouchterlony technique.22 No antibodies against FCS were detectable in the sera obtained from patient 1, nor in the sera of 50 healthy blood donors. Similarly, no precipitating antibodies to FCS were detectable in sera collected prior to gene therapy from patient 2, nor after the first and second cell infusion. However, serum collected from patient 2 about 1 month after the third infusion demonstrated clear precipitating antibodies to FCS (Figure 5A). By that time, patient 2 had received a total of 31.6 × 109 cultured lymphocytes, of which approximately 6.4 × 108 contained the LASN vector. The level of antibodies increased with subsequent cell infusions. Precipitating antibodies to FCS remained present in patient 2's serum 8 years after the last cell infusion (Figure 5A).
The primary bovine component in FCS recognized by precipitating
antibodies from patient 2 was lipoprotein (Figure 5B). Other bovine
serum components tested (Cohn fractions II and III,
lipoprotein-deficient bovine serum, ceruplasmin,
A third ADA patient treated in Japan using the same transduction protocol23 also developed precipitating antibodies against FCS after the fifth infusion of in vitro-cultured cells (L.M.M. and Y. Sakyiama, unpublished observations, 1998). Immune response to retroviral vector In light of the immune response to FCS, we used Western blot analysis15,24 to study patient serum samples for the presence of antibodies to the Moloney murine leukemia virus p30 antigen contained in the envelope of the LASN vector. A study of 53 healthy human sera demonstrated no immune reactivity to MMLV p30. Neither patient exhibited immune reactivity to MMLV p30 prior to treatment. However, antibodies to MMLV p30 were detected in samples obtained from both patients following the cell infusions (Figure 5C). One year after the last cell infusion, patient 1 had lost reactivity to MMLV p30. In contrast, antibodies reactive with MMLV p30 persist in patient 2's serum 8 years after the final infusion of transduced cells. The presence of replication competent retrovirus was excluded by PCR and coculture assays.25
Our results demonstrate that autologous T cells from ADA-deficient patients, stimulated in vitro with OKT3 and IL-2, and transduced with first-generation retroviral vectors, can be safely infused into patients and that the transduced cells survive and express ADA enzyme activity in vivo for more than 10 years. Although the number of circulating T cells has declined over the past 3 years, both patients have remained healthy and free from serious infections on reduced doses of PEG-ADA. In a retrospective analysis of archived cells, we found that the average ADA enzyme activity per cell infused to patient 1 was 3 times that of patient 2, and the percentage of lymphocytes containing the LASN vector given to patient 1 was more than 15 times that given to patient 2. PBMCs obtained from patient 1 have maintained 16 to 22 units of ADA activity over the past 5 years (approximately one fourth the enzyme activity of healthy individuals), which is significantly higher than before gene therapy, whereas PBMCs from patient 2 now have less than 2 units of ADA activity, similar to pre-gene therapy levels. These differences of transduction efficiency and gene expression have been consistent throughout this trial. LASN vector-positive cells have persisted in both ADA-deficient patients for more than 10 years since their last cell infusion. Patient 1 has shown levels of LASN+ cells ranging from 20% to 40% of her circulating lymphocytes, whereas the highest level of circulating transduced cells detectable in patient 2 was approximately 2.5% on protocol day 90, about a week after her third cell infusion, and protocol day 291, 2 weeks after the seventh infusion. Subsequently, the level of circulating vector-containing cells in this patient fell and remained at less than 1%, despite 5 additional T-cell infusions. This striking difference between patients appears to be the result of several factors, including differential transduction efficiency and cell expansion capability in vitro, as well as the immune response that developed in patient 2 against the retroviral envelope and the lipoprotein components of the FCS used in culturing the cells. Although both patients produced antibodies to MMLV p30 during the period of cell infusions, only patient 2 demonstrated persistence of these antibodies after the cell infusions were completed. The original immune defect in patient 2 was milder,26 and this could explain the generation and persistence of antibodies to FCS and p30. The immune response to foreign proteins observed in both these ADA-deficient patents fits with previous reports of immune responses directed at genetically modified cells, including the generation of antibodies25,27 and specific T-cell cytotoxicity in immunocompromised subjects,28,29 and stresses the importance of rendering gene-modified cells less immunogenic for successful future gene therapy in ADA-deficiency and for treatment in other disorders involving immunocompetent patients. Five years after gene therapy ended, approximately 30% of the
circulating T lymphocytes from patient 1 were CD8+ and
V The long-term clinical benefit of this first gene therapy trial is difficult to evaluate. Although clearly helped by at least 2 years of PEG-ADA treatment, both patients had persistent immunodeficiency at the time that the trial was initiated. Significant improvement of a series of immunologic parameters was demonstrated following treatment,9 although it is less clear how much of that improvement to attribute to each component of the treatment that they were receiving (infusion of in vitro-expanded and activated T cells, gene correction, and continued PEG-ADA treatment). Objective measures of immune function have gradually diminished in vigor over the past few years in both patients, which fits with the prediction that genetic correction of mature lymphocytes will have a finite effect if not administered periodically. Nevertheless, several unique conclusions can be drawn from this study. First and foremost, our clinical experience demonstrates the safety of administering genetically modified autologous T cells after in vitro culture and transduction with first-generation retroviral vectors. A second important finding is the previously unanticipated demonstration that human T cells have a life span in the peripheral circulation that can be more than 12 years. In addition, it is clear that transgenes driven by the Moloney retroviral promoter can continue to be expressed in T cells for more than a decade, thus demonstrating resistance to gene silencing in vivo. Finally, we learned that immune responses, even in immunodeficient patients, can confound the outcome of gene therapy experiments in unpredictable ways. It was our original intention to stop PEG-ADA treatment of these patients after observing the quality and duration of their response to the ADA gene treatment for 2 to 3 years. PEG-ADA was continued at the original dose the children were taking at the start of the protocol but without any adjustment for growth. Concurrent studies in ADA-deficient patients treated with allogeneic BMT without myeloablation had shown that engraftment of donor T cells resulted in adequate immune reconstitution but did not provide enough ADA activity to eliminate the excessive body burden of toxic adenosine metabolites.2 Therefore, we assumed that in the absence of PEG-ADA the gene-corrected cells would not have produced enough ADA to allow recruitment and survival of the ADA-deficient T lymphocytes. Because our gene therapy treatment depended on the culture expansion of already differentiated and presumably antigen-committed peripheral T cells, the immune repertoire of corrected cells could only reflect the repertoire found in the circulation at the time the blood was taken for culture expansion. Therefore, if PEG-ADA were withdrawn, the patient's residual immune repertoire would be fixed to that already present, with little chance to develop new specificities to new environmental pathogens. For these reasons, we elected to follow a conservative approach and continue to administer low doses of PEG-ADA. It had always been our opinion that the ultimate treatment for this disease would be hematopoietic stem cell gene therapy and that we could retreat the initial patients when that treatment became available. Although the immune response mounted by patient 2 to some of the gene therapy components could be of some concern, elimination of FCS from the culture system and the use of vectors packaged in different envelopes should reduce the likelihood of immune reactions against future treatments. Recent results reported by Aiuti et al31 have shown that gene therapy in the absence of concomitant PEG-ADA treatment, with the addition of mild myeloablation prior to infusion of gene-corrected cells, can successfully treat ADA deficiency and pose the basis for future applications of gene transfer into the hematopoietic stem cells as therapy for this disease.
We thank B. Martin, M. Warner, T. Li, F. May, C. Everett, V. Fellowes, K. Snitzer, A. Telchin, L. Top, D. Gladden, B. Sink, the staff of the Dowling Clinic and the Cell Processing Section, Department of Transfusion Medicine, Clinical Center, NIH for superb nursing care and technical assistance. Dr M. S. Hershfield monitored the plasma levels and metabolites of ADA for which we are grateful. We also thank our earlier collaborators, Drs K. W. Culver, A. D. Miller, M. Clerici, G. Shearer, L. Chang, Y. Chiang, P. Tolstoshev, J. J. Greenblatt, H. Klein, M. Berger, C. A. Mullen, R. A. Morgan, and W. F. Anderson for their contributions that led the way to these studies. An additional special thank you to the patients and their families.
Submitted September 13, 2002; accepted November 11, 2002.
Prepublished online as Blood First Edition Paper, November 27, 2002; DOI 10.1182/blood-2002-09-2800.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Linda Mesler Muul, NIAMS, NIH, Bldg 10, Rm 9N252, Bethesda, MD 20892; e-mail: muul1{at}mail.nih.gov.
1. Hirschhorn R. Immunodeficiency disease due to deficiency of adenosine deaminase. In: Ochs HD,Smith CIE,Puck JM, eds. Primary Immunodeficiency Diseases: A Molecular and Genetic Approach. New York, NY: Oxford University Press; 1999:121-139. 2. Hershfield MS, Mitchell BS. Immunodeficiency diseases caused by adenosine deaminase deficiency and purine nucleoside phosphorylase deficiency. In: Scriver CR,Beaudet AL,Sly WS,Valle D, eds. The Metabolic and Molecular Bases of Inherited Disease. New York, NY: McGraw-Hill; 2001:2585-2625.
3.
Haddad E, Landais P, Friedrich W, et al.
Long-term immune reconstitution and outcome after HLA-nonidentical T-cell-depleted bone marrow transplantation for severe combined immunodeficiency: a European retrospective study of 116 patients.
Blood.
1998;91:3646-3653
4.
Buckley RH, Schiff SE, Schiff RI, et al.
Hematopoietic stem-cell transplantation for the treatment of severe combined immunodeficiency.
N Engl J Med.
1999;340:508-516 5. Hershfield MS, Buckley RH, Greenberg ML, et al. Treatment of adenosine deaminase deficiency with polyethylene glycol-modified adenosine deaminase. N Engl J Med. 1987;316:589-596[Abstract]. 6. Valentine WN, Paglia DE. Erythrocyte disorders of purine and pyrimidine metabolism. Hemoglobin. 1980;4:669-681[Medline] [Order article via Infotrieve]. 7. Culver KW, Anderson WF, Blaese RM. Lymphocyte gene therapy. Hum Gene Ther. 1991;2:107-109[Medline] [Order article via Infotrieve].
8.
Hock RA, Miller AD, Osborne WR.
Expression of human adenosine deaminase from various strong promoters after gene transfer into human hematopoietic cell lines.
Blood.
1989;74:876-881
9.
Blaese RM, Culver KW, Miller AD, et al.
T lymphocyte-directed gene therapy for ADA-SCID: initial trial results after 4 years.
Science.
1995;270:475-480 10. Mullen CA, Snitzer K, Culver KW, Morgan RA, Anderson WF, Blaese RM. Molecular analysis of T lymphocyte-directed gene therapy for adenosine deaminase deficiency: long-term expression in vivo of genes introduced with a retroviral vector. Hum Gene Ther. 1996;7:1123-1129[Medline] [Order article via Infotrieve]. 11. Kohn DB, Kantoff PW, Eglitis MA, et al. Retroviral-mediated gene transfer into mammalian cells. Blood Cells. 1987;13:285-298[Medline] [Order article via Infotrieve]. 12. Livak KJ, Flood SJ, Marmaro J, Giusti W, Deetz K. Oligonucleotides with fluorescent dyes at opposite ends provide a quenched probe system useful for detecting PCR product and nucleic acid hybridization. PCR Methods Appl. 1995;4:357-362[Medline] [Order article via Infotrieve].
13.
Wada T, Schurman SH, Otsu M, et al.
Somatic mosaicism in Wiskott-Aldrich syndrome suggests in vivo reversion by a DNA slippage mechanism.
Proc Natl Acad Sci U S A.
2001;98:8697-8702 14. Kohn DB, Mitsuya H, Ballow M, et al. Establishment and characterization of adenosine deaminase-deficient human T cell lines. J Immunol. 1989;142:3971-3977[Abstract]. 15. Cornetta K, Moen RC, Culver K, et al. Amphotropic murine leukemia retrovirus is not an acute pathogen for primates. Hum Gene Ther. 1990;1:15-30[Medline] [Order article via Infotrieve]. 16. Blaese RM, Culver KW, Chang L, et al. Treatment of severe combined immunodeficiency disease (SCID) due to adenosine deaminase deficiency with CD34+ selected autologous peripheral blood cells transduced with a human ADA gene. Amendment to clinical research project, Project 90-C-195, January 10, 1992. Hum Gene Ther. 1993;4:521-527[Medline] [Order article via Infotrieve].
17.
Posnett DN, Sinha R, Kabak S, Russo C.
Clonal populations of T cells in normal elderly humans: the T cell equivalent to "benign monoclonal gammapathy."
J Exp Med.
1994;179:609-618 18. Monteiro J, Hingorani R, Choi IH, Silver J, Pergolizzi R, Gregersen PK. Oligoclonality in the human CD8+ T cell repertoire in normal subjects and monozygotic twins: implications for studies of infectious and autoimmune diseases. Mol Med. 1995;1:614-624[Medline] [Order article via Infotrieve]. 19. Fitzgerald JE, Ricalton NS, Meyer AC, et al. Analysis of clonal CD8+ T cell expansions in normal individuals and patients with rheumatoid arthritis. J Immunol. 1995;154:3538-3547[Abstract]. 20. Gorski J, Yassai M, Zhu X, et al. Circulating T cell repertoire complexity in normal individuals and bone marrow recipients analyzed by CDR3 size spectratyping: correlation with immune status. J Immunol. 1994;152:5109-5119[Abstract].
21.
Nolta JA, Dao MA, Wells S, Smogorzewska EM, Kohn DB.
Transduction of pluripotent human hematopoietic stem cells demonstrated by clonal analysis after engraftment in immune-deficient mice.
Proc Natl Acad Sci U S A.
1996;93:2414-2419 22. Szatalowicz FT, Blenden DC, Parker CL. Micromodification of the Ouchterlony gel diffusion precipitin technique. Am J Vet Res. 1969;30:149-150[Medline] [Order article via Infotrieve].
23.
Onodera M, Ariga T, Kawamura N, et al.
Successful peripheral T-lymphocyte-directed gene transfer for a patient with severe combined immune deficiency caused by adenosine deaminase deficiency.
Blood.
1998;91:30-36 24. Cornetta K, Morgan RA, Gillio A, et al. No retroviremia or pathology in long-term follow-up of monkeys exposed to a murine amphotropic retrovirus. Hum Gene Ther. 1991;2:215-219[Medline] [Order article via Infotrieve]. 25. Long Z, Li LP, Grooms T, et al. Biosafety monitoring of patients receiving intracerebral injections of murine retroviral vector producer cells. Hum Gene Ther. 1998;9:1165-1172[Medline] [Order article via Infotrieve]. 26. Levy Y, Hershfield MS, Fernandez-Mejia C, et al. Adenosine deaminase deficiency with late onset of recurrent infections: response to treatment with polyethylene glycol-modified adenosine deaminase. J Pediatr. 1988;113:312-317[CrossRef][Medline] [Order article via Infotrieve].
27.
Selvaggi TA, Walker RE, Fleisher TA.
Development of antibodies to fetal calf serum with arthus-like reactions in human immunodeficiency virus-infected patients given syngeneic lymphocyte infusions.
Blood.
1997;89:776-779 28. Riddell SR, Elliott M, Lewinsohn DA, et al. T-cell mediated rejection of gene-modified HIV-specific cytotoxic T lymphocytes in HIV-infected patients. Nat Med. 1996;2:216-223[CrossRef][Medline] [Order article via Infotrieve].
29.
Bonini C, Ferrari G, Verzeletti S, et al.
HSV-TK gene transfer into donor lymphocytes for control of allogeneic graft-versus-leukemia.
Science.
1997;276:1719-1724
30.
Bordignon C, Notarangelo LD, Nobili N, et al.
Gene therapy in peripheral blood lymphocytes and bone marrow for ADA-immunodeficient patients.
Science.
1995;270:470-475
31.
Aiuti A, Slavin S, Aker M, et al.
Correction of ADA-SCID by stem cell gene therapy combined with non-myeloablative conditioning.
Science.
2002;296:2410-2413
© 2003 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Top
Abstract
Introduction
) and percentage of
LASN vector-positive cells (
) detectable in patient circulating
lymphocytes obtained prior to infusion during the treatment phase and
at various time points after cell infusions ended. T-cell infusions for
each patient are indicated by the inverted blue triangles. The infusion
of CD34+ cells to patient 2 is indicated as an upright
triangle.
) and
patient 2 (
populations and analyzed by Southern blot after
digestion with EcoRI that cuts only once within the LASN
vector. The results showed diffuse positivity ("smear"), indicating
that both cell fractions contained multiple LASN integrants (Figure
-2 macroglobulin (well no. 4),
bovine ceruloplasmin (well no. 5), Cohn fractions II/III containing
primarily 
globulins (well no. 6). (C) Western blot assay of
patients' sera obtained at various time points to detect
antiretroviral antibodies. Each blot begins with a positive monkey
serum control (+), followed by molecular weight markers (M) and then a
control negative monkey serum (
).