Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
Prepublished online as a Blood First Edition Paper on November 27, 2002; DOI 10.1182/blood-2002-09-2800.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2002-09-2800v1
101/7/2563    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Muul, L. M.
Right arrow Articles by Candotti, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Muul, L. M.
Right arrow Articles by Candotti, F.
Related Collections
Right arrow Gene Therapy
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, 1 April 2003, Vol. 101, No. 7, pp. 2563-2569

GENE THERAPY

Persistence and expression of the adenosine deaminase gene for 12 years and immune reaction to gene transfer components: long-term results of the first clinical gene therapy trial

Linda Mesler Muul, Laura M. Tuschong, Sherry Lau Soenen, G. Jayashree Jagadeesh, W. Jay Ramsey, Zhifeng Long, Charles S. Carter, Elizabeth K. Garabedian, Melinna Alleyne, Margaret Brown, Wendy Bernstein, Shepherd H. Schurman, Thomas A. Fleisher, Susan F. Leitman, Cynthia E. Dunbar, R. Michael Blaese, and Fabio Candotti

From the Clinical Gene Therapy Branch, Genetics and Molecular Biology Branch, Medical Genetics Branch, National Human Genome Research Institute, National Institutes of Health, Bethesda, MD; Genetic Therapy, Gaithersburg MD; Department of Transfusion Medicine, Clinical Center, National Institutes of Health, Bethesda, MD; Department of Laboratory Medicine, Clinical Center, National Institutes of Health, Bethesda, MD; Walter Reed Army Medical Center, Washington, DC; Hematology Branch, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD; and Fund for Inherited Disease Research, Newtown, PA.


    Abstract
Top
Abstract
Introduction
Patients and methods
Results
Discussion
References

The first human gene therapy experiment begun in September 1990 used a retroviral vector containing the human adenosine deaminase (ADA) cDNA to transduce mature peripheral blood lymphocytes from patients with ADA deficiency, an inherited disorder of immunity. Two patients who had been treated with intramuscular injections of pegylated bovine ADA (PEG-ADA) for 2 to 4 years were enrolled in this trial and each received a total of approximately 1011 cells in 11 or 12 infusions over a period of about 2 years. No adverse events were observed. During and after treatment, the patients continued to receive PEG-ADA, although at a reduced dose. Ten years after the last cell infusion, approximately 20% of the first patient's lymphocytes still carry and express the retroviral gene, indicating that the effects of gene transfer can be remarkably long lasting. On the contrary, the persistence of gene-marked cells is very low (< 0.1%), and no expression of the transgene is detectable in lymphocytes from the second patient who developed persisting antibodies to components of the gene transfer system. Data collected from these original patients have provided novel information about the longevity of T lymphocytes in humans and persistence of gene expression in vivo from vectors driven by the Moloney murine leukemia virus long-terminal repeat (LTR) promoter. This long-term follow-up has also provided unique evidence supporting the safety of retroviral-mediated gene transfer and illustrates clear examples of both the potential and the pitfalls of gene therapy in humans. (Blood. 2003;101:2563-2569)

© 2003 by The American Society of Hematology.

    Introduction
Top
Abstract
Introduction
Patients and methods
Results
Discussion
References

Adenosine deaminase (ADA, EC3.5.4.4) is an enzyme in the purine salvage pathway that catalyzes the deamination of adenosine and deoxyadenosine to inosine and deoxyinosine, respectively. Mutations of the ADA gene can result in profound enzyme deficiency and severe combined immunodeficiency (SCID) with virtual lack of T- and B-cell function.1,2 HLA-identical bone marrow transplantation (BMT) is the therapy of choice; however only a minority of patients has access to a fully matched donor. Alternative options are haploidentical BMT3,4 and enzyme replacement with polyethylene glycol-conjugated bovine ADA (PEG-ADA).5

In the mid 1980s gene transfer was proposed as a therapy for ADA deficiency. The simple regulation of the ADA gene6 and the expected selective advantage of gene-corrected cells suggested ADA deficiency as an ideal initial candidate disease to test gene therapy. Because of the difficulty of transducing hematopoietic stem cells, and the observation that BMT patients with only donor T-lymphocyte engraftment had good immunologic reconstitution, it was postulated that genetic correction of autologous T cells could be clinically beneficial.7 Testing of the hypothesis was feasible because patients on PEG-ADA therapy had developed circulating peripheral T lymphocytes that could be targeted with gene transfer.

The first phase 1 gene therapy trial began September 14, 1990, with infusion of a 4-year-old girl with ADA deficiency with autologous T cells transduced ex vivo with the retroviral vector LASN containing the cDNA for human ADA.8 In January 1991, identical treatment was begun for a 9-year-old girl. Patient histories, ADA mutations, and details of the protocol have been described previously.9,10 Between 1990 and 1992, approximately 1011 total lymphocytes were administered over 11 or 12 infusions to each patient. Twenty percent of the circulating T cells from patient 1 contain the ADA vector 10 years after treatment began, whereas less than 0.1% of T cells from patient 2 have detectable vector. Both patients continue to receive weekly injections of PEG-ADA although at a reduced dose (7-13 U/kg per week). We present the results of immunologic and molecular studies carried out over a decade documenting the safety of retroviral gene transfer and long-term persistence of vector-containing, polyclonal T cells. In addition we offer an hypothesis to explain the disparity in the ultimate responses of these 2 patients.


    Patients and methods
Top
Abstract
Introduction
Patients and methods
Results
Discussion
References

Patients

The patients involved in this study have been described previously.9 The clinical research protocol and procedures involving human subjects were approved by the National Cancer Institute (NCI); National Heart, Lung, and Blood Institute (NHLBI); and National Human Genome Research Institute (NHGRI) Institutional Review Boards (IRBs). Informed consent was provided according to the Declaration of Helsinki. Patient blood samples were obtained before infusion of gene-corrected cells during the treatment phase and at various time points after treatment.

ADA enzyme assay

ADA assays were performed as described11 with some modifications. Briefly, peripheral blood mononuclear cells (PBMCs) were obtained by Ficoll separation and counted, and 5 × 105 cells were lysed in 100 µL M-Per (Pierce, Rockford, IL) at room temperature or by repeated freezing/thawing in 100 mM Tris (tris(hydroxymethyl)aminomethane), pH 7.4. After centrifugation, 10 µL 1 mM 14C-adenosine (Amersham, Piscataway, NJ) was added to 10 µL cell lysate, either neat or at a 1:5 dilution and incubated for 3 to 20 minutes at 37°C. The reaction was stopped at 95°C for 5 minutes, and samples were transferred to ice. The reaction mixture (4-10 µL) was spotted onto thin-layer chromatography (TLC) plates (Kodak, Newark, NJ) previously loaded with 3 µL 0.1 M standards of unlabeled adenosine, hypoxanthine, and inosine (all from Sigma, St Louis, MO) and dried. Separation was obtained by placing TLC plates in a solution of 0.1 M sodium biphosphate, pH 6.8 (10 parts), 6 parts saturated ammonium sulfate, and 0.2 parts n-propyl alcohol for 60 to 120 minutes. Plates were dried and exposed to a phosphoimager screen for 18 to 36 hours. Pixels were counted with a FujiFilm BAS 1500 phosphoimager (Stamford, CT). ADA units were determined as nanomolar adenosine deaminated per minute per 108 cells.

Real-time PCR analysis

DNA was isolated using the PureGene kit (Gentra, Minneapolis, MN). A total of 500 ng of each DNA sample was added to a mixture of 10 µM neomycin (neo) primers (forward primer, TTGTCAAGACCGACCTGTCC; reverse primer, TTCGCTTGGTGGTCGAATG) and 5 µM LASN probe (CAGCTGTGCTCGACGTTGTCACTGAA) with Taqman 2× polymerase chain reaction (PCR) Master Mix. Samples were run in triplicate. Serial dilutions of DNA obtained from a cell line containing a single copy of the LASN vector were used to establish a standard curve. Reactions were run in an ABI Prism 7700,12 and analysis of the percentage of LASN+ cells was performed with Sequence Detection Systems 1.6.3 (PE Applied Biosystems, Foster City, CA).

Proliferation assay

PBMCs (2 × 105/well) were stimulated in triplicate with phytohemagglutinin (PHA; 10 µg/mL; Wellcome Diagnostics, Research Triangle, NC) for 3 days, tetanus toxoid (3 LF/mL; Connaught Laboratories, Toronto, ON, Canada), and diphtheria toxoid (25 LF/mL; Commonwealth of Massachusetts, Boston) for 7 days. Plates were then pulsed for 4 to 5 hours with 0.037 MBq (1 µCi)/well of 3H-thymidine (New England Nuclear, Boston, MA), harvested with a Tomtec plate washer, and counted on a Betaplate counter (Wallac, Gaithersburg, MD). Stimulation index was calculated as net counts per minute of the stimulated samples/counts per minute of media control.

Fluorescence-activated cell sorter (FACS) analysis

PBMCs (5 × 105) were stained with Vbeta monoclonal antibodies (Immunotech/Coulter, Miami, FL), followed by fluorescein isothiocyanate (FITC)-labeled goat antimouse (BioSource, Vacaville, CA), blocked with mouse immunoglobulin G1 (IgG1) kappa (Sigma, St Louis, MO), stained with phycoerythrin (PE)-labeled CD3 antibody (Immunotech/Coulter) and either PECy5-labeled CD4 or CD8 antibody (BD Biosciences, San Jose, CA). Cells were collected (105/tube) on a FACSCalibur (Becton Dickinson, Franklin Lakes, NJ), analyzed using CellQuest software (BD Biosciences), and compared with normal range values provided by Immunotech/Coulter.

Complementarity-determining region-3 (CDR3) size distribution analysis of T-cell receptor (TcR) Vbeta 14

Total RNA was isolated from PBMCs of patient 1 and a healthy control subject using the PureScript Isolation kit (Gentra, Minneapolis, MN). RNA (5 µg) was used to generate the first cDNA strand that was amplified using a Vbeta 14-specific primer in conjunction with a 6-fluoroscein phosphoramidite-labeled Cbeta primer and analyzed as described.13

Single cell clones

PHA (5 µg/mL) or OKT3 (100 ng/mL) activated patient lymphocytes were cloned by limiting dilution and transformed with human T-cell leukemia virus type I (HTLV-I)-producing cells irradiated at 12 500 rad as described.14

Southern blot analysis

DNA was isolated using the PureGene kit. A total of 10 µg of each DNA sample was digested with EcoRI, BglII, HindIII, or SstI (Life Technologies, Rockville, MD). DNA digests were electrophoresed in 1% agarose gels and transferred to Hybond-N+ membranes (Amersham). Hybridization was performed with 32P-neo probe,10 and bands were visualized by autoradiography.

Immunoprecipitation assay

Ouchterlony plates were poured with a 0.6% agarose layer (SeaKem; FMC Bioproducts, Rockland, ME) in barbitol buffer (Sigma). Antigens (neat or diluted as indicated) were placed in the outer wells, and whole patient serum (10 µL) was placed in the center well. After radial diffusion, antigen/antibody complex precipitin bands were visualized using reflected light.

Western blot

Analysis of patients' sera for the presence of anti-Moloney murine leukemia virus (MMLV) p30 was performed as described.15 Briefly, concentrated stock of murine retrovirus was denatured and separated on a sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel followed by blotting to a nitrocellulose membrane and staining with patient serum. Monkey sera of known reactivity were used as positive and negative controls. Each serum sample was run with a molecular weight marker lane to the left.


    Results
Top
Abstract
Introduction
Patients and methods
Results
Discussion
References

ADA levels in PBMCs reflect the percentage of gene-corrected cells

Using real-time PCR technology, we performed a series of retrospective studies on archived cryopreserved PBMCs and quantitated the levels of gene transfer achieved in the cell infusions and patients' circulating lymphocytes. The difference in numbers of gene-corrected cells received by the 2 patients was remarkable: infusions given to patient 1 ranged from 18.2% to 53.3% LASN positive (LASN+), whereas infusions given to patient 2 ranged from 0.9% to 3.1% LASN+ cells (Table 1).

                              
View this table:
[in this window]
[in a new window]
 
Table 1. ADA enzyme activity and percentage of cells containing LASN in patient infusions

Accordingly, patient 1 received more gene-marked cells in the 7th infusion (2.2 × 109) than patient 2 received in toto from the 11 (of 12 total) infusions that were tested (1.76 × 109). Thus, patient 1 received more than 2 logs more vector-marked T cells during the course of the entire protocol than did patient 2.

ADA enzyme activity (negligible to undetectable before treatment) was analyzed to assess transgene expression. ADA activity in the infusions received by patient 1 ranged from 2.7 to 20.8 units (1 unit = 1 nmol/min/108 cells), whereas infusions given to patient 2 had ADA levels from 2.1 to 4.9 units (Table 1).

This finding suggests that the higher ADA values and percentage of gene-marked cells found in the circulation of patient 1 over time reflect in part the larger numbers of gene-marked cells received (Figure 1A). Three and a half years after the last infusion, the gene-marked cells constituted more than 40% of her circulating lymphocytes. Sixteen months after treatment began, ADA levels had risen to a level approximately one fifth of normal and have fluctuated between one third to one fifth of normal over the past 5 years.


View larger version (32K):
[in this window]
[in a new window]
 
Figure 1. ADA enzyme activity and vector detection in PBMCs of gene therapy patients. (A-B) Units of cytoplasmic ADA enzyme activity (black-square) and percentage of LASN vector-positive cells (open circle ) detectable in patient circulating lymphocytes obtained prior to infusion during the treatment phase and at various time points after cell infusions ended. T-cell infusions for each patient are indicated by the inverted blue triangles. The infusion of CD34+ cells to patient 2 is indicated as an upright triangle.

The lower numbers of gene-corrected cells received by patient 2 are reflected in the lower numbers of gene-marked cells in the blood and lower ADA values achieved (Figure 1B). Patient 2's ADA levels did increase during the time of cell infusions. On protocol day 90, after the 3rd infusion, and on protocol day 291, after the 7th infusion, approximately 2.5% of patient 2's circulating lymphocytes contained vector sequences; however, this dropped to less than 1% by protocol day 333 before the 9th infusion. An attempt at stem cell gene therapy with 7.4 × 107 autologous granulocyte colony-stimulating factor (G-CSF)-mobilized peripheral CD34+ cells transduced with the G1NaSvAd.24 vector16 was unsuccessful. This treatment produced a transient rise in the ADA levels of circulating PBMCs, but ADA levels subsequently fell and have remained below 2 units for the past 9 years (Figure 1B), whereas the percentage of detectable gene-corrected cells has been less than 0.1%. No G1NaSvAd.24 vector sequences were detectable in patient 2's PBMCs at any of the time points tested.

T-cell numbers and function after gene therapy

Following initiation of gene therapy, the total number of CD3+ T cells circulating in both patients increased to normal values. After cell infusions stopped, T-cell numbers remained within the normal range for approximately 5 years even as the dose of PEG-ADA was decreasing by approximately 30% in patient 1 and approximately 40% in patient 2. During the past 4 years, both patients' T-cell counts have declined below the normal range. Patient 1 has approximately 610 × 106 circulating CD3+ T cells/L, whereas patient 2 has approximately 420 × 106 CD3+ T cells/L (normal range, 832-2028 × 106/L) (Figure 2A). Over the 12 years of the protocol, proliferative responses of patient lymphocytes to PHA have fluctuated above or below the range for healthy control subjects for both patients (Figure 2B). Response to the recall antigens tetanus (Figure 2C) and diphtheria (Figure 2D) were vigorous for several years following cell infusions and have diminished over the past 3 years, although they remain within the lower range for healthy control subjects. Isohemagglutinin titers that had increased to a high of 1:256 in both patients 3 to 4 months after cell infusions began9 are now at titers of 1:32 in both subjects. Delayed type hypersensitivity skin tests that had become vigorously positive soon after treatment9 have been very weak or absent for the past 4 years.


View larger version (45K):
[in this window]
[in a new window]
 
Figure 2. Circulating T-cell numbers and patient proliferation responses to mitogen and antigen over time. (A) CD3+ T cells in the circulation of patient 1 () and patient 2 (open circle ). (B-D) Stimulation index (SI) defined as counts per minute in wells treated with mitogen or antigen divided by counts per minute of media alone. SI of patient 1 () and patient 2 (open circle ) to PHA (B), tetanus (C), and diphtheria (D). The shaded area marked by × symbols indicates the normal range of CD3+ T cells, mitogen, and antigens along the y-axis.

Expansion of T lymphocytes expressing the T-cell receptor (TcR) Vbeta 14 family in patient 1

To assess the diversity of the T-cell repertoire following treatment, we tested peripheral blood lymphocytes from both patients using monoclonal antibodies to human TcR Vbeta families. Five years after the last cell infusion, patient 1 had cells expressing most of the TcR Vbeta families, with an expansion in the percentage of CD3+ T cells that stained positive for TcR Vbeta 14 (Figure 3). Subset analysis revealed that 35% of CD8 T cells and 2% of CD4 T cells expressed Vbeta 14. A pretreatment sample contained 8% Vbeta 14+ T cells, suggesting that this population had expanded over time. Oligoclonal expansion of CD8+ T cells has been reported in the elderly17 and in normal individuals.18,19 However, because monoclonal cell expansion could also be the result of insertional mutagenesis, or a growth advantage because of genetic correction, further studies were initiated.


View larger version (25K):
[in this window]
[in a new window]
 
Figure 3. Studies of patient T-cell receptor (TcR) Vbeta repertoire. Percentage of T cells in each TcR Vbeta family at various times during the study. The top panel shows patient 1 at protocol days 1795 (black bars), 2295 (white bars), 2733 (orange bars), 3063 (yellow bars), and 3559 (green bars). The second panel shows patient 1's cells divided into CD4 and CD8 cells on protocol day 2973; TcR Vbeta 14 was found predominantly in the CD8+ T-cell subset. The third panel shows patient 2's T cells tested on protocol days 2049 (black boxes), 2070 (white bars), 2718 (orange lined bars), and 3149 (yellow lined bars). No single TcR Vbeta family was predominant at any of these time points. The bottom panel shows T cells from healthy control subjects showing range of TcR Vbeta families detectable by FACS. Normal 1 (orange dotted bars), Normal 2 (green dotted bars), Immunotech normal low (white bars), and Immunotech normal high (black bars).

Cells were separated into TcR Vbeta 14+ and Vbeta 14- populations and analyzed by Southern blot after digestion with EcoRI that cuts only once within the LASN vector. The results showed diffuse positivity ("smear"), indicating that both cell fractions contained multiple LASN integrants (Figure 4A). Digestion with SstI that excises the full-length vector confirmed that there were no gross vector rearrangements (Figure 4A).


View larger version (78K):
[in this window]
[in a new window]
 
Figure 4. Molecular analysis of patient 1's T-lymphocyte complexity. (A) Patient 1's PBLs were separated into TcR Vbeta 14-positive and -negative fractions, cut with restriction enzymes SstI (double cutter) and EcoRI (single cutter). SstI digests demonstrate that the vector DNA has not been rearranged. The smear in the lanes cut with EcoRI indicates that there have been multiple LASN integrations. The first lane of panels A, C, and D contains molecular weight markers. (B) Spectratyping of TcR CDR3 of Vbeta 14 in PBMCs from a healthy control subject and patient 1. (C) Southern blot analysis of single cell clones. SstI and EcoRI digests. (D) BglII (single cutter) digests.

Spectratyping20 of the TcR beta  chain complementarity-determining region 3 (CDR3) of the Vbeta 14+ cells from a healthy control subject revealed the expected Gaussian curve with 6 peaks or more (Figure 4B). Similar analysis of the Vbeta 14+ population of patient 1 showed a skewed distribution of CDR3 sizes with one prominent peak at 277 nt and a smaller peak of 271 nt, indicating that the patient's Vbeta 14+ T cells consisted of an oligoclonal population (Figure 4B).

Single T-cell clones were obtained by limiting dilution from HTLV-1-immortalized peripheral blood lymphocytes (PBLs) at various time points (approximately 3.5, 4, 5, and 6.4 years after the last cell infusion). Of the clones shown in Figure 4, 5 were CD4+, TcR Vbeta 14- and 12 were CD8+, TcR Vbeta 14+. Digestion of the clones' DNA with SstI, followed by Southern blot analysis, demonstrated the presence of full-length vector in all clones (Figure 4C). DNA from the clones was also digested with EcoRI (Figure 4C), BglII (Figure 4D), and HindIII followed by Southern blot. Multiple clones appeared to share similar integration sites using EcoRI (Figure 4C); however, digestion with BglII (Figure 4D) and HindIII (data not shown) confirmed that there were multiple and different LASN integration sites among different Vbeta 14+ clones. The presence of multiple integrants was also confirmed by inverse PCR21 on clones obtained 3.5 and 4 years after the last cell infusion (data not shown). Together, these results indicated that patient 1's Vbeta 14+ T cells were multiclonal with multiple LASN integrants. The TcR Vbeta 14+ population has remained stable and multiclonal for vector insertion over the past 6 years.

Patient 2 had a normal TcR repertoire distribution, with occasional absence of TcR Vbeta 6.1 and 23, a finding also observed in PBMCs from some healthy control subjects (Figure 3).

Immune response to fetal calf serum (FCS)

The rapid disappearance of LASN+ cells after each infusion observed in patient 2 (Figure 1B) raised suspicions of an immune-mediated elimination. Therefore, stored serial serum samples from both patients were analyzed for the presence of precipitating antibodies to components of the gene transfer system using the double diffusion Ouchterlony technique.22 No antibodies against FCS were detectable in the sera obtained from patient 1, nor in the sera of 50 healthy blood donors. Similarly, no precipitating antibodies to FCS were detectable in sera collected prior to gene therapy from patient 2, nor after the first and second cell infusion. However, serum collected from patient 2 about 1 month after the third infusion demonstrated clear precipitating antibodies to FCS (Figure 5A). By that time, patient 2 had received a total of 31.6 × 109 cultured lymphocytes, of which approximately 6.4 × 108 contained the LASN vector. The level of antibodies increased with subsequent cell infusions. Precipitating antibodies to FCS remained present in patient 2's serum 8 years after the last cell infusion (Figure 5A).


View larger version (60K):
[in this window]
[in a new window]
 
Figure 5. Immune response to bovine protein and retroviral envelope. (A) Ouchterlony gel of sera from patient 2 at various protocol days. Patient sera (center well); FCS, neat (well no. 1), diluted 1:4 (well no. 2), and 1:8 (well no. 3); bovine serum albumin neat (well no. 4), diluted 1:4 (well no. 5), and 1:8 (well no. 6). (B) Ouchterlony gel of sera from patient 2 (center well), bovine lipoprotein (well no. 1), FCS (well no. 2), lipoprotein-deficient bovine sera (well no. 3), bovine alpha -2 macroglobulin (well no. 4), bovine ceruloplasmin (well no. 5), Cohn fractions II/III containing primarily beta  and gamma  globulins (well no. 6). (C) Western blot assay of patients' sera obtained at various time points to detect antiretroviral antibodies. Each blot begins with a positive monkey serum control (+), followed by molecular weight markers (M) and then a control negative monkey serum (-).

The primary bovine component in FCS recognized by precipitating antibodies from patient 2 was lipoprotein (Figure 5B). Other bovine serum components tested (Cohn fractions II and III, lipoprotein-deficient bovine serum, ceruplasmin, alpha 2-macroglobulin, siderophilin, transferrin, apo-lipoprotein, fetuin, bovine ADA, PEG-ADA, bovine IgM, and bovine IgG) were not recognized by the precipitating antibodies (data not shown).

A third ADA patient treated in Japan using the same transduction protocol23 also developed precipitating antibodies against FCS after the fifth infusion of in vitro-cultured cells (L.M.M. and Y. Sakyiama, unpublished observations, 1998).

Immune response to retroviral vector

In light of the immune response to FCS, we used Western blot analysis15,24 to study patient serum samples for the presence of antibodies to the Moloney murine leukemia virus p30 antigen contained in the envelope of the LASN vector. A study of 53 healthy human sera demonstrated no immune reactivity to MMLV p30. Neither patient exhibited immune reactivity to MMLV p30 prior to treatment. However, antibodies to MMLV p30 were detected in samples obtained from both patients following the cell infusions (Figure 5C). One year after the last cell infusion, patient 1 had lost reactivity to MMLV p30. In contrast, antibodies reactive with MMLV p30 persist in patient 2's serum 8 years after the final infusion of transduced cells. The presence of replication competent retrovirus was excluded by PCR and coculture assays.25


    Discussion
Top
Abstract
Introduction
Patients and methods
Results
Discussion
References

Our results demonstrate that autologous T cells from ADA-deficient patients, stimulated in vitro with OKT3 and IL-2, and transduced with first-generation retroviral vectors, can be safely infused into patients and that the transduced cells survive and express ADA enzyme activity in vivo for more than 10 years. Although the number of circulating T cells has declined over the past 3 years, both patients have remained healthy and free from serious infections on reduced doses of PEG-ADA. In a retrospective analysis of archived cells, we found that the average ADA enzyme activity per cell infused to patient 1 was 3 times that of patient 2, and the percentage of lymphocytes containing the LASN vector given to patient 1 was more than 15 times that given to patient 2. PBMCs obtained from patient 1 have maintained 16 to 22 units of ADA activity over the past 5 years (approximately one fourth the enzyme activity of healthy individuals), which is significantly higher than before gene therapy, whereas PBMCs from patient 2 now have less than 2 units of ADA activity, similar to pre-gene therapy levels. These differences of transduction efficiency and gene expression have been consistent throughout this trial.

LASN vector-positive cells have persisted in both ADA-deficient patients for more than 10 years since their last cell infusion. Patient 1 has shown levels of LASN+ cells ranging from 20% to 40% of her circulating lymphocytes, whereas the highest level of circulating transduced cells detectable in patient 2 was approximately 2.5% on protocol day 90, about a week after her third cell infusion, and protocol day 291, 2 weeks after the seventh infusion. Subsequently, the level of circulating vector-containing cells in this patient fell and remained at less than 1%, despite 5 additional T-cell infusions.

This striking difference between patients appears to be the result of several factors, including differential transduction efficiency and cell expansion capability in vitro, as well as the immune response that developed in patient 2 against the retroviral envelope and the lipoprotein components of the FCS used in culturing the cells. Although both patients produced antibodies to MMLV p30 during the period of cell infusions, only patient 2 demonstrated persistence of these antibodies after the cell infusions were completed. The original immune defect in patient 2 was milder,26 and this could explain the generation and persistence of antibodies to FCS and p30. The immune response to foreign proteins observed in both these ADA-deficient patents fits with previous reports of immune responses directed at genetically modified cells, including the generation of antibodies25,27 and specific T-cell cytotoxicity in immunocompromised subjects,28,29 and stresses the importance of rendering gene-modified cells less immunogenic for successful future gene therapy in ADA-deficiency and for treatment in other disorders involving immunocompetent patients.

Five years after gene therapy ended, approximately 30% of the circulating T lymphocytes from patient 1 were CD8+ and Vbeta 14+. Although spectratyping of the TcR Vbeta 14 family demonstrated a predominant CDR3 fragment, Vbeta 14+ T-cell clones contained different and multiple vector integration sites. These findings are not consistent with selective expansion of a single T-cell clone mediated by a particular integration event or a particularly high expression of the ADA transgene. Because the TcR repertoire is oligoclonal in ADA-deficient patients30 and because the original transduction conditions favored the expansion of CD8+ cells in vitro,9 it is reasonable to theorize that a population of CD8+/Vbeta 14+ T cells was prominently present among patient 1's cells before gene therapy. These cells may have been repeatedly sampled, further expanded, and transduced during the periodic in vitro culture and gene transfer procedures.

The long-term clinical benefit of this first gene therapy trial is difficult to evaluate. Although clearly helped by at least 2 years of PEG-ADA treatment, both patients had persistent immunodeficiency at the time that the trial was initiated. Significant improvement of a series of immunologic parameters was demonstrated following treatment,9 although it is less clear how much of that improvement to attribute to each component of the treatment that they were receiving (infusion of in vitro-expanded and activated T cells, gene correction, and continued PEG-ADA treatment). Objective measures of immune function have gradually diminished in vigor over the past few years in both patients, which fits with the prediction that genetic correction of mature lymphocytes will have a finite effect if not administered periodically.

Nevertheless, several unique conclusions can be drawn from this study. First and foremost, our clinical experience demonstrates the safety of administering genetically modified autologous T cells after in vitro culture and transduction with first-generation retroviral vectors. A second important finding is the previously unanticipated demonstration that human T cells have a life span in the peripheral circulation that can be more than 12 years. In addition, it is clear that transgenes driven by the Moloney retroviral promoter can continue to be expressed in T cells for more than a decade, thus demonstrating resistance to gene silencing in vivo. Finally, we learned that immune responses, even in immunodeficient patients, can confound the outcome of gene therapy experiments in unpredictable ways.

It was our original intention to stop PEG-ADA treatment of these patients after observing the quality and duration of their response to the ADA gene treatment for 2 to 3 years. PEG-ADA was continued at the original dose the children were taking at the start of the protocol but without any adjustment for growth. Concurrent studies in ADA-deficient patients treated with allogeneic BMT without myeloablation had shown that engraftment of donor T cells resulted in adequate immune reconstitution but did not provide enough ADA activity to eliminate the excessive body burden of toxic adenosine metabolites.2 Therefore, we assumed that in the absence of PEG-ADA the gene-corrected cells would not have produced enough ADA to allow recruitment and survival of the ADA-deficient T lymphocytes.

Because our gene therapy treatment depended on the culture expansion of already differentiated and presumably antigen-committed peripheral T cells, the immune repertoire of corrected cells could only reflect the repertoire found in the circulation at the time the blood was taken for culture expansion. Therefore, if PEG-ADA were withdrawn, the patient's residual immune repertoire would be fixed to that already present, with little chance to develop new specificities to new environmental pathogens. For these reasons, we elected to follow a conservative approach and continue to administer low doses of PEG-ADA. It had always been our opinion that the ultimate treatment for this disease would be hematopoietic stem cell gene therapy and that we could retreat the initial patients when that treatment became available. Although the immune response mounted by patient 2 to some of the gene therapy components could be of some concern, elimination of FCS from the culture system and the use of vectors packaged in different envelopes should reduce the likelihood of immune reactions against future treatments. Recent results reported by Aiuti et al31 have shown that gene therapy in the absence of concomitant PEG-ADA treatment, with the addition of mild myeloablation prior to infusion of gene-corrected cells, can successfully treat ADA deficiency and pose the basis for future applications of gene transfer into the hematopoietic stem cells as therapy for this disease.


    Acknowledgments

We thank B. Martin, M. Warner, T. Li, F. May, C. Everett, V. Fellowes, K. Snitzer, A. Telchin, L. Top, D. Gladden, B. Sink, the staff of the Dowling Clinic and the Cell Processing Section, Department of Transfusion Medicine, Clinical Center, NIH for superb nursing care and technical assistance. Dr M. S. Hershfield monitored the plasma levels and metabolites of ADA for which we are grateful. We also thank our earlier collaborators, Drs K. W. Culver, A. D. Miller, M. Clerici, G. Shearer, L. Chang, Y. Chiang, P. Tolstoshev, J. J. Greenblatt, H. Klein, M. Berger, C. A. Mullen, R. A. Morgan, and W. F. Anderson for their contributions that led the way to these studies. An additional special thank you to the patients and their families.


    Footnotes

Submitted September 13, 2002; accepted November 11, 2002.

Prepublished online as Blood First Edition Paper, November 27, 2002; DOI 10.1182/blood-2002-09-2800.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: Linda Mesler Muul, NIAMS, NIH, Bldg 10, Rm 9N252, Bethesda, MD 20892; e-mail: muul1{at}mail.nih.gov.


    References
Top
Abstract
Introduction
Patients and methods
Results
Discussion
References

1. Hirschhorn R. Immunodeficiency disease due to deficiency of adenosine deaminase. In: Ochs HD,Smith CIE,Puck JM, eds. Primary Immunodeficiency Diseases: A Molecular and Genetic Approach. New York, NY: Oxford University Press; 1999:121-139.

2. Hershfield MS, Mitchell BS. Immunodeficiency diseases caused by adenosine deaminase deficiency and purine nucleoside phosphorylase deficiency. In: Scriver CR,Beaudet AL,Sly WS,Valle D, eds. The Metabolic and Molecular Bases of Inherited Disease. New York, NY: McGraw-Hill; 2001:2585-2625.

3. Haddad E, Landais P, Friedrich W, et al. Long-term immune reconstitution and outcome after HLA-nonidentical T-cell-depleted bone marrow transplantation for severe combined immunodeficiency: a European retrospective study of 116 patients. Blood. 1998;91:3646-3653[Abstract/Free Full Text].

4. Buckley RH, Schiff SE, Schiff RI, et al. Hematopoietic stem-cell transplantation for the treatment of severe combined immunodeficiency. N Engl J Med. 1999;340:508-516[Abstract/Free Full Text].

5. Hershfield MS, Buckley RH, Greenberg ML, et al. Treatment of adenosine deaminase deficiency with polyethylene glycol-modified adenosine deaminase. N Engl J Med. 1987;316:589-596[Abstract].

6. Valentine WN, Paglia DE. Erythrocyte disorders of purine and pyrimidine metabolism. Hemoglobin. 1980;4:669-681[Medline] [Order article via Infotrieve].

7. Culver KW, Anderson WF, Blaese RM. Lymphocyte gene therapy. Hum Gene Ther. 1991;2:107-109[Medline] [Order article via Infotrieve].

8. Hock RA, Miller AD, Osborne WR. Expression of human adenosine deaminase from various strong promoters after gene transfer into human hematopoietic cell lines. Blood. 1989;74:876-881[Abstract/Free Full Text].

9. Blaese RM, Culver KW, Miller AD, et al. T lymphocyte-directed gene therapy for ADA-SCID: initial trial results after 4 years. Science. 1995;270:475-480[Abstract/Free Full Text].

10. Mullen CA, Snitzer K, Culver KW, Morgan RA, Anderson WF, Blaese RM. Molecular analysis of T lymphocyte-directed gene therapy for adenosine deaminase deficiency: long-term expression in vivo of genes introduced with a retroviral vector. Hum Gene Ther. 1996;7:1123-1129[Medline] [Order article via Infotrieve].

11. Kohn DB, Kantoff PW, Eglitis MA, et al. Retroviral-mediated gene transfer into mammalian cells. Blood Cells. 1987;13:285-298[Medline] [Order article via Infotrieve].

12. Livak KJ, Flood SJ, Marmaro J, Giusti W, Deetz K. Oligonucleotides with fluorescent dyes at opposite ends provide a quenched probe system useful for detecting PCR product and nucleic acid hybridization. PCR Methods Appl. 1995;4:357-362[Medline] [Order article via Infotrieve].

13. Wada T, Schurman SH, Otsu M, et al. Somatic mosaicism in Wiskott-Aldrich syndrome suggests in vivo reversion by a DNA slippage mechanism. Proc Natl Acad Sci U S A. 2001;98:8697-8702[Abstract/Free Full Text].

14. Kohn DB, Mitsuya H, Ballow M, et al. Establishment and characterization of adenosine deaminase-deficient human T cell lines. J Immunol. 1989;142:3971-3977[Abstract].

15. Cornetta K, Moen RC, Culver K, et al. Amphotropic murine leukemia retrovirus is not an acute pathogen for primates. Hum Gene Ther. 1990;1:15-30[Medline] [Order article via Infotrieve].

16. Blaese RM, Culver KW, Chang L, et al. Treatment of severe combined immunodeficiency disease (SCID) due to adenosine deaminase deficiency with CD34+ selected autologous peripheral blood cells transduced with a human ADA gene. Amendment to clinical research project, Project 90-C-195, January 10, 1992. Hum Gene Ther. 1993;4:521-527[Medline] [Order article via Infotrieve].

17. Posnett DN, Sinha R, Kabak S, Russo C. Clonal populations of T cells in normal elderly humans: the T cell equivalent to "benign monoclonal gammapathy." J Exp Med. 1994;179:609-618[Abstract/Free Full Text].

18. Monteiro J, Hingorani R, Choi IH, Silver J, Pergolizzi R, Gregersen PK. Oligoclonality in the human CD8+ T cell repertoire in normal subjects and monozygotic twins: implications for studies of infectious and autoimmune diseases. Mol Med. 1995;1:614-624[Medline] [Order article via Infotrieve].

19. Fitzgerald JE, Ricalton NS, Meyer AC, et al. Analysis of clonal CD8+ T cell expansions in normal individuals and patients with rheumatoid arthritis. J Immunol. 1995;154:3538-3547[Abstract].

20. Gorski J, Yassai M, Zhu X, et al. Circulating T cell repertoire complexity in normal individuals and bone marrow recipients analyzed by CDR3 size spectratyping: correlation with immune status. J Immunol. 1994;152:5109-5119[Abstract].

21. Nolta JA, Dao MA, Wells S, Smogorzewska EM, Kohn DB. Transduction of pluripotent human hematopoietic stem cells demonstrated by clonal analysis after engraftment in immune-deficient mice. Proc Natl Acad Sci U S A. 1996;93:2414-2419[Abstract/Free Full Text].

22. Szatalowicz FT, Blenden DC, Parker CL. Micromodification of the Ouchterlony gel diffusion precipitin technique. Am J Vet Res. 1969;30:149-150[Medline] [Order article via Infotrieve].

23. Onodera M, Ariga T, Kawamura N, et al. Successful peripheral T-lymphocyte-directed gene transfer for a patient with severe combined immune deficiency caused by adenosine deaminase deficiency. Blood. 1998;91:30-36[Abstract/Free Full Text].

24. Cornetta K, Morgan RA, Gillio A, et al. No retroviremia or pathology in long-term follow-up of monkeys exposed to a murine amphotropic retrovirus. Hum Gene Ther. 1991;2:215-219[Medline] [Order article via Infotrieve].

25. Long Z, Li LP, Grooms T, et al. Biosafety monitoring of patients receiving intracerebral injections of murine retroviral vector producer cells. Hum Gene Ther. 1998;9:1165-1172[Medline] [Order article via Infotrieve].

26. Levy Y, Hershfield MS, Fernandez-Mejia C, et al. Adenosine deaminase deficiency with late onset of recurrent infections: response to treatment with polyethylene glycol-modified adenosine deaminase. J Pediatr. 1988;113:312-317[CrossRef][Medline] [Order article via Infotrieve].

27. Selvaggi TA, Walker RE, Fleisher TA. Development of antibodies to fetal calf serum with arthus-like reactions in human immunodeficiency virus-infected patients given syngeneic lymphocyte infusions. Blood. 1997;89:776-779[Abstract/Free Full Text].

28. Riddell SR, Elliott M, Lewinsohn DA, et al. T-cell mediated rejection of gene-modified HIV-specific cytotoxic T lymphocytes in HIV-infected patients. Nat Med. 1996;2:216-223[CrossRef][Medline] [Order article via Infotrieve].

29. Bonini C, Ferrari G, Verzeletti S, et al. HSV-TK gene transfer into donor lymphocytes for control of allogeneic graft-versus-leukemia. Science. 1997;276:1719-1724[Abstract/Free Full Text].

30. Bordignon C, Notarangelo LD, Nobili N, et al. Gene therapy in peripheral blood lymphocytes and bone marrow for ADA-immunodeficient patients. Science. 1995;270:470-475[Abstract/Free Full Text].

31. Aiuti A, Slavin S, Aker M, et al. Correction of ADA-SCID by stem cell gene therapy combined with non-myeloablative conditioning. Science. 2002;296:2410-2413[Abstract/Free Full Text].

© 2003 by The American Society of Hematology.
 

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
NEJMHome page
A. Aiuti, F. Cattaneo, S. Galimberti, U. Benninghoff, B. Cassani, L. Callegaro, S. Scaramuzza, G. Andolfi, M. Mirolo, I. Brigida, et al.
Gene Therapy for Immunodeficiency Due to Adenosine Deaminase Deficiency
N. Engl. J. Med., January 29, 2009; 360(5): 447 - 458.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. W. Nienhuis
Development of gene therapy for blood disorders
Blood, May 1, 2008; 111(9): 4431 - 4444.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Wilkie, G. Picco, J. Foster, D. M. Davies, S. Julien, L. Cooper, S. Arif, S. J. Mather, J. Taylor-Papadimitriou, J. M. Burchell, et al.
Retargeting of Human T Cells to Tumor-Associated MUC1: The Evolution of a Chimeric Antigen Receptor
J. Immunol., April 1, 2008; 180(7): 4901 - 4909.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Deschamps, P. Mercier-Lethondal, J. M. Certoux, C. Henry, B. Lioure, C. Pagneux, J. Y. Cahn, E. Deconinck, E. Robinet, P. Tiberghien, et al.
Deletions within the HSV-tk transgene in long-lasting circulating gene-modified T cells infused with a hematopoietic graft
Blood, December 1, 2007; 110(12): 3842 - 3852.
[Abstract] [Full Text] [PDF]


Home page
Arch. Dis. Child.Home page
W. Qasim, H Bobby Gaspar, and A. J Thrasher
Update on clinical gene therapy in childhood
Arch. Dis. Child., November 1, 2007; 92(11): 1028 - 1031.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
N. Sakamoto, K. Tsuji, L. M. Muul, A. M. Lawler, E. F. Petricoin, F. Candotti, J. A. Metcalf, J. A. Tavel, H. C. Lane, W. J. Urba, et al.
Bovine apolipoprotein B-100 is a dominant immunogen in therapeutic cell populations cultured in fetal calf serum in mice and humans
Blood, July 15, 2007; 110(2): 501 - 508.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. Traversari, S. Marktel, Z. Magnani, P. Mangia, V. Russo, F. Ciceri, C. Bonini, and C. Bordignon
The potential immunogenicity of the TK suicide gene does not prevent full clinical benefit associated with the use of TK-transduced donor lymphocytes in HSCT for hematologic malignancies
Blood, June 1, 2007; 109(11): 4708 - 4715.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
O. Adjali, R. R. Vicente, C. Ferrand, C. Jacquet, C. Mongellaz, P. Tiberghien, K. Chebli, V. S. Zimmermann, and N. Taylor
Intrathymic administration of hematopoietic progenitor cells enhances T cell reconstitution in ZAP-70 severe combined immunodeficiency
PNAS, September 20, 2005; 102(38): 13586 - 13591.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2002-09-2800v1
101/7/2563    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Muul, L. M.
Right arrow Articles by Candotti, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Muul, L. M.
Right arrow Articles by Candotti, F.
Related Collections
Right arrow Gene Therapy
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2003 by American Society of Hematology         Online ISSN: 1528-0020