|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Prepublished online as a Blood First Edition Paper on November 21, 2002; DOI 10.1182/blood-2002-08-2438.
IMMUNOBIOLOGY
From the Department of Biological and Clinical
Hematology, Centre Hospitalier-Universitaire/Assistance
Publique-Hopitaux de Paris (CHU/AP-HP) Necker-Enfants Malades and
Université Paris V; Hôpital Bretonneau, Tours;
Hôpital La Pitié-Salpêtrière and Hôpital
Trousseau, Paris, France.
T-acute lymphoblastic leukemias (T-ALLs) derive from human
T-lymphoid precursors arrested at various early stages of development. Correlation of phenotype and T-cell receptor (TCR) status with RAG-1
and pT T lymphocytes are derived from pluripotent
hemopoietic progenitors that migrate from the fetal liver or bone
marrow to the thymus, where most T-cell development takes place. This
process is associated with progressive restriction of developmental
potential, with the earliest recognizable thymic precursor retaining T,
natural killer (NK), and dendritic cell (DC) Patients and cell lines
Immunophenotype
TCR rearrangements DNA and RNA were extracted from fresh or cryopreserved cells, as previously described.22 TCR rearrangements
were assessed by fluorescence multiplex polymerase chain reaction (PCR)
amplification.26 The TCR and TCR multiplex PCRs were
developed within the Biomed-2 BMH4-CT98-3936 Concerted
Action.27 Briefly, 100 ng DNA was amplified for 35 cycles
in the presence of 0.2 µM each primer, 2 mM MgCl, and 1 U Taq Gold
(Perkin Elmer). TCR gene configuration was assessed with a 3-tube
multiplex PCR, 2 of which contained 27 V family-specific upstream
primers with either 9 (PCR A) or 4 (PCR B) downstream J primers. The
third (PCR C) contained all 13 J primers and D1 and D2
upstream primers (Figure 1). TCR and
TCR PCR products were analyzed by heteroduplex
analysis.27 T-ALLs were classified as TCR germline if
all PCRs were negative, immature if only DJ rearrangements were
observed, and mature if a clonal V(D)J rearrangement was identified on
at least one allele. TCR rearrangements were assessed by Southern
blot analysis, multiplex PCR analysis, or both. DNA was digested with
EcoRI, HindIII, or BglII and were hybridized sequentially with 32P-labeled J1, Rec,
and  J probes.28 The single-tube TCR multiplex PCR
was performed using V1-6 and D2-specific upstream primers and
D3 and J1-4-specific downstream primers. The sensitivity of
detection of clonality using these techniques is approximately 1% to
10%. Identification of V and J segment usage was based on the
size of the Southern blot-rearranged bands with J1 and/or the size
of the multiplex PCR heteroduplex products, confirmed by specific
monoplex PCR and/or multiplex multifluorescence PCR. TCR
multifluorescence typing was performed with unlabeled J D primers
and V V2, and D2 labeled primers, using Biomed-2 conditions.
Assessment of TCR deletion was based on loss of J1, Rec, and
J signals. Unidentified rearrangements were those clearly
detected by Southern blot analysis but with no apparent clonal PCR
product. Complete TCR and TCR rearrangements are referred to as
V(D)J, because no attempt was made to identify the presence of delta
segments within clonal PCR products unless stated. TCR status was
assessed by Southern blot and PCR in 85 cases and by PCR alone in 28 cases. Twenty of these were classified as rearranged because at least
one clear clonal band was seen. Eight (4 pre-, 3 TCR SP,
and 1 TCR) were negative by multiplex heteroduplex PCR analysis
and as such could either have a germline TCR configuration, a
biallelic deletion, or TCR rearrangements that could not be detected
by the primers used. Evaluation of the frequency of these
configurations is therefore likely to be slightly underestimated in
Table 1.
Quantification of pT
was amplified using exon 1 and 2 primers, and, as such, only
full-length, pTa transcripts were
detected.29 Primers and probes used were as follows:
Abl sense, TggAgATAACACTCTAAgCATAACTAAAggT; antisense, gATgTAgTTgCTTgggACCCA; probe,
Fam-CCATTTTTggTTTgggCTTCACACCATT-Tamra; RAG1 sense,
AGCCTGCTGAGCAAGGTACC; antisense, GAACTGAGTCCCAAGGTGGG; probe,
Fam-AGCCAGCATGGCAGCCTCTTTCC-Tamra; pT sense,
TTGGGTGTCCAGCCCTACC; antisense, GCCATAGGTGAAGGCATCCA; probe,
Fam-CAGCCGGCAATGGCAGTGCA-Tamra.
TCR classification of T-ALL All 114 T-ALLs expressed CD7 and cytoplasmic (cCD3) or surface CD3 (sCD3). All were myeloperoxidase (MPO) negative by cytochemistry, immunophenotype, or both. All sCD3 cases
and 39 of 54 sCD3+ cases were assessed for cytoplasmic
TCR (cTCR) expression by flow cytometry, using the F1 antibody
(Figure 2). Fifty-three were also
analyzed by immunocytochemistry, with no significant discrepancies.
Absence of staining of nonpermeabilized T lymphocytes confirmed that
only intracytoplasmic TCR was recognized.25 cTCR was
seen in 50% of cases overall, including all TCR T-ALLs tested,
45% of sCD3 cases, 13% of TCR cases, and 56% of
sCD3+ TCR cases (Table 1). T-ALLs were
subdivided on the basis of sCD3, TCR, TCR, and cTCR
expression. sCD3+ cases included TCR (20% overall),
TCR (20%) or TCR (8%). Because the classification
of sCD3+, TCR cases requires an understanding
of the CD3-associated receptor, these cases will not be described in
detail here. sCD3 cases (53%) were divided into
cTCR+ (pre-) (24%) and cTCR
(immature [IM]) (29%). To identify progressive T-lymphoid lineage restriction, we classified the 33 IM T-ALLs on the basis of their TCR
profiles into 4 IM0 with germline TCR, TCR, and TCR, 8 IM
with only TCR rearrangement, 13 IM with TCR and TCR but absent or incomplete TCR rearrangement, and 8 IM with complete TCR rearrangement (Table 2).
IM T-ALLs resemble multipotent thymic precursors IM T-ALLs demonstrated a distinctive immunophenotype (Tables 2 and 3). Expression of the CD13 and CD33 (myeloid) antigens or the CD56 (NK lineage) marker were frequent and relatively specific to this category, as was CD5 negativity. CD34 expression was more frequent in IM T-ALLs, though, surprisingly, it was maintained on 25% to 50% of TCR, but not pre-TCR, expressing T-ALLs. CD2 negativity was found in more than 50% but was rare in all other categories other than TCR.30,31 Most were CD4/CD8 DN
and CD1a, although a proportion were CD4/CD8 SP. They
included the only T-ALLs to have a germline configuration of TCR or
TCR loci. Those rearrangements that did occur were frequently
incomplete, involved pseudogenes such as V10 or V11, or
corresponded to non-T-restricted TCR VD or DD rearrangements, often
classified as illegitimate. Absence of cTCR expression therefore
identifies an immature category of T-ALLs that could include expansions
of nonlineage-restricted thymic precursors. IM0 T-ALLs expressed CD34/117, CD2, CD5, and TdT but not CD10. Two expressed CD1a and both
CD13 and CD33 one in conjunction with pT. The 8 IM
differed immunophenotypically by frequent CD56 positivity, CD2
negativity, and absence of CD1a expression. The predominant TCR
rearrangement was D2-D3. TCR rearrangements were rare and
incomplete. All 12 TCR T-ALLs were IM and included the
4 TCR germline cases, reflecting the fact that TCR rearrangement
precedes TCR. Most immature T-ALLs belonged to the IM category.
They demonstrated predominantly ongoing TCR rearrangements, with
only one showing biallelic Vf1-J1/2. TCR rearrangements were
mainly D2-J1 or V2-D3, and complete V(D)J was rare. TCR
rearrangements were more frequent than in IM but, by definition,
remained incomplete. In keeping with a later stage of maturation
arrest, half were CD34/117 or CD13/33 negative, and fewer than half
expressed CD1a or CD10. As with IM, CD2 negativity and CD56
positivity were frequent. Absence of TCR rearrangement was virtually
restricted to IM0, IM, and IM cases. IM T-ALLs, which had
undergone complete TCR rearrangement (IM) on at least one allele,
were phenotypically and genotypically similar to pre- T-ALLs.
Half the TCR rearrangements were complete, and one case had
undergone biallelic TCR deletion. TCR rearrangements were
predominantly biallelic Vf1-J1/2 and 80% of TCR rearranged alleles were complete. Most expressed CD4/CD8, and CD1a/CD10 expression was frequent. These cases presumably correspond either to out-of-frame TCR rearrangements or to maturation arrest just after the completion of rearrangement before detectable protein expression. Most IM0, IM,
and IM T-ALLs were pT and RAG-1 negative (Figure
3), with only 1 IM expressing both
weakly. The level of pT and RAG-1 expression increased markedly in
IM.
Taken together, these data suggest that the classification of
cTCR Pre- T-ALL correlated with a
cortical thymic precursor, insofar as most were CD4/8 DP and expressed
CD1a. Expression of nonlineage-restricted markers such as CD34, CD13, CD33, and CD56 became rare or absent, whereas CD2 and CD5 were virtually universal, in keeping with a T-restricted stage of maturation arrest. In contrast to IM T-ALLs, no pre- T-ALL was germline for
, , or TCR. Identified TCR rearrangements were V(D)J, and
end-stage TCR Vf1-J1/2 were frequent. Virtually all TCR expressed CD5 and CD2, but CD1a expression was less frequent. All had
deleted at least one TCR allele, and two thirds deleted both
alleles. Biallelic TCR deletion was rare in all other categories. All pre- cases were strongly positive for both RAG-1 and pT transcripts (Figure 3). Both transcripts decreased in TCR T-ALLs, particularly in SP/DN cases, where the only negative cases were observed.
Human pT pT cases expressed
pT at levels only slightly lower than those observed in TCR
T-ALLs (Figure 3). High-level RAG-1 expression was
observed in all pT+ cases, compared with none of the
pT cases (Table 2). cTCR expression was detected in
2 of 5 pT+ cases but 0 of 6 pT cases
and was restricted to the 2 cases with the highest levels of pT.
pT+ cases were predominantly CD4/CD8 DP,
CD1a+, CD10+, and TdT+, whereas
pT cases were less frequently positive for these
markers. CD34 and CD13/33 were also commoner in pT+
cases. pT TCR T-ALLs therefore resemble IM and
pre- cases.
All 8 pT TCR
In this manuscript we have used TCR, pT
Half of TCR lineage were
equally divided into those expressing TCR and those expressing
pre-, which expressed cTCR in the absence of a
classical TCR. Both demonstrated a CD2+, CD5+,
CD1a+, CD4/8 DP > SP > DN phenotype, complete
TCR and end-stage TCR rearrangements, and high-level expression
of full-length pT and RAG-1 transcripts in all but a proportion of
TCR SP/DN-negative cases. As such they correspond to the early
ISP, DP, and SP stages of thymic development,32 when
differentiation potential is restricted to the T lymphoid, and probably
only the TCR lineage. Several features of pre- T-ALLs
suggest that they correspond to cases that express the pre-TCR and are
undergoing selection. Surface pre-TCR expression is seen at the
CD25+, CD44, DN3 stage of murine development
and at the CD4 ISP-to-DP transition during human development, when
maximal levels of pT transcripts are found. Flow cytometric
detection of pre-TCR-associated sCD3 is, however, difficult because of
the limited number of complexes expressed at the cell surface.
Pre-TCR-expressing T-ALLs should therefore express high-level pT,
cTCR, and CD4 and/or CD8 but low- level or undetectable
sCD3. They should have undergone TCR, TCR, and TCR but not
TCR rearrangement. Pre- T-ALLs correspond exactly to this
phenotype. Their main distinguishing feature from TCR T-ALLs was
a switch from TCR rearrangement to TCR deletion, reflecting
TCR rearrangement. One fourth of the TCR rearrangements detected
by Southern blot analysis in pre- T-ALLs were negative by TCR
PCR (Table 2) and may thus include V-J rearrangements. Rec
rearrangements were also virtually restricted to this category (data
not shown). Formal demonstration that pre- T-ALLs express the pre-TCR will require analysis with pT-specific antibodies. The frequency of pre-TCR-expressing T-ALLs is consistent with a
population undergoing massive expansion. It is also possible that these
precursors are particularly prone to leukemic transformation. In
keeping with this, pT expression is necessary for
Notch-3-mediated33 and potentially also
Notch-1-meditated34 leukemic transformation. Our data
demonstrate that this is likely to result from the physiologic proliferative signal mediated by the pre-TCR in combination with a
differentiation block related to Notch deregulation rather than from a
specific oncogenic effect of pT. T-ALLs that expressed sCD3 and
cTCR but no detectable TCR could also potentially correspond to
pre-TCR-expressing cases. Alternatively, they may express a TCR35 or an unusual CD3-TCR complex, thus
preventing presentation of the CD3 epitope detected by BMA031. Full
details of these cases will be published elsewhere.
Unlike murine development, in which cTCR TCR lymphocytes are not thought to
express a pre-TCR or to undergo selection, expression of pT
transcripts is not necessary for their maturation.38 We
demonstrate that TCR T-ALLs can be divided into 2 distinct
categories based on their pT expression; 60% are
pT and resemble classical TCR lymphocytes,
whereas 40% are pT+ and are likely to correspond to
precursors that retain TCR and TCR potential. TCR
pT T-ALLs express few T-restricted markers apart from
TCR and CD5 (Table 2). TCR profiles show relatively frequent use
of immature 3' V segments and 5' J segments. This may represent a form
of allelic exclusion, whereby recombinase competence is shut down at an
early stage, following the expression of functional TCR. Hence,
these T-ALLs are RAG-1 and often TdT negative, and they include the
only TCR T-ALLs with monoallelic TCR and incomplete TCR
rearrangements. TCR rearrangements are restricted to predominantly monoallelic DJ, and none express cTCR protein. As such, they resemble healthy TCR lymphocytes.13 Their
denomination as immature acute leukemias is based on their clinical
presentation and the paucity of recognized mature T-cell markers. In
contrast, pT+ TCR T-ALLs are predominantly DP or
CD4 ISP, CD1a+, and CD10+, and all express
RAG-1 and TdT. In keeping with an active recombinase, all TCR are
biallelic and predominantly end-stage, and all TCR rearrangements
are complete, with relatively frequent use of downstream J segments.
TCR rearrangements are complete, biallelic, and unusually extensive.
Maturation of murine DN precursors to the DP stage requires the
expression of a pre-TCR. In the absence of either pT or TCR,
some, albeit inefficient, maturation to the DP stage is possible by
replacement of the pre-TCR by TCR15 It is possible
that the pT+ TCR T-ALLs described here correspond
to these cells, demonstrating for the first time that this pathway is
also operational in at least leukemic human T-lymphoid
development. The frequency of this category suggests either
that these precursors are particularly susceptible to leukemic
transformation or that they represent a relatively common developmental
pathway. Genotypic comparison of pT+ and pT-
TCR T-ALL will help determine whether the former result from
leukemic deregulation. Until recently, analysis of various TCR- and
pT-deficient mice suggested that the maturation of lineage
cells by TCR expression was only operational in the absence of a
pre-TCR.18,19 If this is also true for human T-ALLs, it is
likely that it is the absence of TCR that prevents pre-TCR expression in pT+ TCR ALLs. Because all our cases
expressed pT+ transcripts at levels similar to DP
TCR-lineage cases, it is not the level of transcription that is
the limiting factor. We cannot exclude abnormalities in pT protein
expression without further analysis, particularly the use of
pT-specific antibodies. In contrast, most did not express detectable
cTCR protein, despite extensive ongoing TCR rearrangements.
Absence of TCR is not, however, the limiting step in all cases,
because the 2 TCR T-ALLs with the highest level of pT
transcripts expressed cTCR protein on 56% and 77% of blasts.
Gounari et al39 have recently demonstrated the expression
of a pT-driven reporter in TCR thymocytes. They interpreted
this as evidence of early TCR cells that have recently derived
from a pT+ common / precursor.
pT+ TCR T-ALLs were more frequently CD34, CD13/33,
TdT, and RAG-1 positive. However, they demonstrated more frequent
CD4/CD8, CD1a, and CD10 expression and more extensive TCR
rearrangement. Our data suggest that pT+ TCR cells
are intermediate between TCR- and TCR-lineage precursors
and lead us to postulate that pT+ TCR precursors
can differentiate into TCR or TCR mature lymphocytes
(Figure 4). TCR expression could precede or replace pre-TCR
expression, even in the absence of any abnormalities of pT or
TCR. TCR and TCR analysis of pT+ murine
TCR cells will clarify whether these cells are also closer to
TCR lineage precursors. The pT+ TCR T-ALLs
described here will facilitate analysis of human TCR versus
TCR lineage commitment, including analysis of their transcriptional profiles. Determination of their physiological relevance will require analysis of their healthy human counterparts.
Immature T-ALLs We used the expression of CD7 and cCD3 in the absence of cTCR
to identify approximately 30% of T-ALLs as immature. These are likely
to include cases arrested at a non-T-restricted stage, because most
were DN, pT, and RAG-1 negative and expressed immature markers such
as CD34, CD13, and CD33. The earliest human thymic precursor has an
identical phenotype.40,41 CD117/c-kit expression is an
important marker in murine DN42 and has been described in
11% of T-ALLs, particularly in immature cases that express myeloid
antigens or isolated CD7.43 We found a lower level of CD117 expression, possibly because of differences in the evaluation of
cCD3 expression, suggesting that CD117 plays a different role in the
early stages of human and murine T lymphopoiesis.
Analysis of IM T-ALL TCR configurations allowed identification of
progressively more T-restricted leukemic precursors. The order of TCR
rearrangement was clearly (1) TCR Two IM0 T-ALLs (UPN 281 and UPN 2586) were potentially DC precursors,
based on a unique CD34+, CD13/33 DP, CD1a+,
CD4/8 DN profile, as described for myeloid DC1
precursors.47 This population had recently been identified
in the human postnatal thymus.48 Interestingly, one
expressed pT CD56 is often used to indicate NK potential, as may be a
CD5 Progressive restriction of a human multipotent (T/DC/NK)
precursor with a CD5 A human common lymphoid precursor (CLP) has been identified in
adult bone marrow by its CD34+, CD45RA+,
CD10+, Lin Twenty-three immature T-ALLs were RAG-1lo/neg, including
all but one IM Conversely, immature rearrangements, predominantly of TCR We have therefore shown that cCD3+ T-ALLs reflect all
stages of human T-lymphoid development and can provide useful
homogeneous populations arrested at different stages of development.
Not all features of T-ALL can be explained on this basis
We thank C. Bayle (Institut Gustave-Roussy, Villejuif), F-X.
Mahon and C. Bilhou-Nabera (Bordeaux), X. Troussard (Caen), M. Dupont
(Montpellier), R. Garand (Nantes), E. Kuhlein and N. Dastugue (Toulouse) and their clinical colleagues for providing T-ALL samples, Jean-Pierre de Villartay and Orly Azogui for constructive criticism, and Dorothée Menage for secretarial assistance. We also thank all
members of the Biomed-2 Concerted Action who contributed to the design
of the TCR
Submitted August 9, 2002; accepted November 3, 2002.
Prepublished online as Blood First Edition Paper, November 21, 2002; DOI 10.1182/blood-2002-08-2438.
Supported by the Fondation Contre la Leucémie de la Fondation de France, l'Association de la Recherche sur le Cancer (ARC), the Direction de Recherche Clinique de l'Assistance Publique-Hôpitaux de Paris (PHRC 97-106), and the Biomed-2 BMH4-CT98-3936 Concerted Action.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Elizabeth Macintyre, Laboratoire d'Hématologie, Tour Pasteur, Hôpital Necker, 149-161, rue de Sèvres, 75743 Paris cedex 15, France; e-mail: elizabeth.macintyre{at}nck.ap-hop-paris.fr.
1.
Res P, Martinez-Caceres E, Cristina Jaleco A, et al.
CD34+CD38dim cells in the human thymus can differentiate into T, natural killer, and dendritic cells but are distinct from pluripotent stem cells.
Blood.
1996;87:5196-5206 2. Godfrey DI, Zlotnik A. Control points in early T-cell development. Immunol Today. 1993;14:547-553[CrossRef][Medline] [Order article via Infotrieve]. 3. Kang J, Raulet DH. Events that regulate differentiation of alpha beta TCR+ and gamma delta TCR+ T cells from a common precursor. Semin Immunol. 1997;9:171-179[CrossRef][Medline] [Order article via Infotrieve].
4.
Capone M, Hockett RD Jr, Zlotnik A.
Kinetics of T cell receptor beta, gamma, and delta rearrangements during adult thymic development: T cell receptor rearrangements are present in CD44(+)CD25(+) Pro-T thymocytes.
Proc Natl Acad Sci U S A.
1998;95:12522-12527 5. von Boehmer H, Aifantis I, Azogui O, et al. Crucial function of the pre-T-cell receptor (TCR) in TCR beta selection, TCR beta allelic exclusion and alpha beta versus gamma delta lineage commitment. Immunol Rev. 1998;165:111-119[CrossRef][Medline] [Order article via Infotrieve]. 6. Spits H, Blom B, Jaleco AC, et al. Early stages in the development of human T, natural killer and thymic dendritic cells. Immunol Rev. 1998;165:75-86[CrossRef][Medline] [Order article via Infotrieve].
7.
Blom B, Verschuren MC, Heemskerk MH, et al.
TCR gene rearrangements and expression of the pre-T cell receptor complex during human T-cell differentiation.
Blood.
1999;93:3033-3043 8. Krangel MS, Hernandez-Munain C, Lauzurica P, McMurry M, Roberts JL, Zhong XP. Developmental regulation of V(D)J recombination at the TCR alpha/delta locus. Immunol Rev. 1998;165:131-147[CrossRef][Medline] [Order article via Infotrieve].
9.
Khor B, Sleckman BP.
Allelic exclusion at the TCR
10.
Krangel MS, Yssel H, Brocklehurst C, Spits H.
A distinct wave of human T cell receptor gamma/delta lymphocytes in the early fetal thymus: evidence for controlled gene rearrangement and cytokine production.
J Exp Med.
1990;172:847-859 11. Zhang XM, Tonnelle C, Lefranc MP, Huck S. T cell receptor gamma cDNA in human fetal liver and thymus: variable regions of gamma chains are restricted to V gamma I or V9, due to the absence of splicing of the V10 and V11 leader intron. Eur J Immunol. 1994;24:571-578[Medline] [Order article via Infotrieve].
12.
Roberts JL, Lauzurica P, Krangel MS.
Developmental regulation of VDJ recombination by the core fragment of the T cell receptor alpha enhancer.
J Exp Med.
1997;185:131-140
13.
Hayday AC.
14. Hayday AC, Barber DF, Douglas N, Hoffman ES. Signals involved in gamma/delta T cell versus alpha/beta T cell lineage commitment. Semin Immunol. 1999;11:239-249[CrossRef][Medline] [Order article via Infotrieve].
15.
MacDonald HR, Radtke F, Wilson A.
T cell fate specification and 16. Kruisbeek AM, Haks MC, Carleton M, Michie AM, Zuniga-Pflucker JC, Wiest DL. Branching out to gain control: how the pre-TCR is linked to multiple functions. Immunol Today. 2000;21:637-644[CrossRef][Medline] [Order article via Infotrieve]. 17. von Boehmer H, Aifantis I, Feinberg J, et al. Pleiotropic changes controlled by the pre-T-cell receptor. Curr Opin Immunol. 1999;11:135-142[CrossRef][Medline] [Order article via Infotrieve].
18.
Leduc I, Hempel WM, Mathieu N, et al.
T cell development in TCR beta enhancer-deleted mice: implications for alpha beta T cell lineage commitment and differentiation.
J Immunol.
2000;165:1364-1373 19. Livak F, Wilson A, MacDonald HR, Schatz DG. Alpha beta lineage-committed thymocytes can be rescued by the gamma delta T cell receptor (TCR) in the absence of TCR beta chain. Eur J Immunol. 1997;27:2948-2958[Medline] [Order article via Infotrieve]. 20. Breit TM, Wolvers-Tettero IL, van Dongen JJ. Phenotypic and genotypic characteristics of human early T-cell differentiation: the T-cell acute lymphoblastic leukaemia model. Res Immunol. 1994;145:139-143[CrossRef][Medline] [Order article via Infotrieve]discussion 155-138. 21. Bene MC, Castoldi G, Knapp W, et al. Proposals for the immunological classification of acute leukemias: European Group for the Immunological Characterization of Leukemias (EGIL). Leukemia. 1995;9:1783-1786[Medline] [Order article via Infotrieve].
22.
Brumpt C, Delabesse E, Beldjord K, et al.
The incidence of clonal T-cell receptor rearrangements in B-cell precursor acute lymphoblastic leukemia varies with age and genotype.
Blood.
2000;96:2254-2261 23. Borst J, van Dongen JJ, de Vries E, et al. BMA031, a monoclonal antibody suited to identify the T-cell receptor alpha beta/CD3 complex on viable human T lymphocytes in normal and disease states. Hum Immunol. 1990;29:175-188[CrossRef][Medline] [Order article via Infotrieve].
24.
Davodeau F, Houde I, Boulot G, et al.
Secretion of disulfide-linked human T-cell receptor gamma delta heterodimers.
J Biol Chem.
1993;268:15455-15460 25. Brenner MB, McLean J, Scheft H, Warnke RA, Jones N, Strominger JL. Characterization and expression of the human alpha beta T cell receptor by using a framework monoclonal antibody. J Immunol. 1987;138:1502-1509[Abstract].
26.
Delabesse E, Burtin ML, Millien C, et al.
Rapid, multifluorescent TCRG V 27. van Dongen J, Langerak A, San Miguel J, et al. PCR-based clonality studies for early diagnosis of lymphoproliferative disorders: report of the Biomed-2 Concerted Action [abstract]. Blood. 2001;98:129a.
28.
Macintyre EA, Smit L, Ritz J, Kirsch IR, Strominger JL.
Disruption of the SCL locus in T-lymphoid malignancies correlates with commitment to the T-cell receptor alpha beta lineage.
Blood.
1992;80:1511-1520
29.
Barber DF, Passoni L, Wen L, Geng L, Hayday AC.
The expression in vivo of a second isoform of pT alpha: implications for the mechanism of pT alpha action.
J Immunol.
1998;161:11-16
30.
Macintyre EA, Salloum E, Sigaux F.
Comparison of
31.
Langerak AW, Wolvers-Tettero IL, van den Beemd MW, et al.
Immunophenotypic and immunogenotypic characteristics of TCR 32. Res P, Spits H. Developmental stages in the human thymus. Semin Immunol. 1999;11:39-46[CrossRef][Medline] [Order article via Infotrieve].
33.
Bellavia D, Campese AF, Checquolo S, et al.
Combined expression of pT
34.
Allman D, Karnell FG, Punt JA, et al.
Separation of Notch1 promoted lineage commitment and expansion/transformation in developing T cells.
J Exp Med.
2001;194:99-106 35. Hochstenbach F, Brenner MB. T-cell receptor delta-chain can substitute for alpha to form a beta delta heterodimer. Nature. 1989;340:562-565[CrossRef][Medline] [Order article via Infotrieve].
36.
Wilson A, Capone M, MacDonald HR.
Unexpectedly late expression of intracellular CD3
37.
Ramiro AR, Trigueros C, Marquez C, San Millan JL, Toribio ML.
Regulation of pre-T cell receptor (pT alpha-TCR beta) gene expression during human thymic development.
J Exp Med.
1996;184:519-530 38. Fehling HJ, Krotkova A, Saint-Ruf C, von Boehmer H. Crucial role of the pre-T-cell receptor alpha gene in development of alpha beta but not gamma delta T cells. Nature. 1995;375:795-798[CrossRef][Medline] [Order article via Infotrieve].
39.
Gounari F, Aifantis I, Martin C, et al.
Tracing lymphopoiesis with the aid of a pT
40.
Galy A, Verma S, Barcena A, Spits H.
Precursors of CD3+CD4+CD8+ cells in the human thymus are defined by expression of CD34: delineation of early events in human thymic development.
J Exp Med.
1993;178:391-401
41.
Terstappen LW, Huang S, Picker LJ.
Flow cytometric assessment of human T-cell differentiation in thymus and bone marrow.
Blood.
1992;79:666-677 42. Shortman K, Wu L. Early T lymphocyte progenitors. Annu Rev Immunol. 1996;14:29-47[CrossRef][Medline] [Order article via Infotrieve].
43.
Bene MC, Bernier M, Casasnovas RO, et al.
The reliability and specificity of c-kit for the diagnosis of acute myeloid leukemias and undifferentiated leukemias: the European Group for the Immunological Classification of Leukemias (EGIL).
Blood.
1998;92:596-599 44. Blom B, Res PC, Spits H. T cell precursors in man and mice. Crit Rev Immunol. 1998;18:371-388[Medline] [Order article via Infotrieve].
45.
Spits H, Lanier LL, Phillips JH.
Development of human T and natural killer cells.
Blood.
1995;85:2654-2670 46. Lanier LL, Chang C, Spits H, Phillips JH. Expression of cytoplasmic CD3 epsilon proteins in activated human adult natural killer (NK) cells and CD3 gamma, delta, epsilon complexes in fetal NK cells: implications for the relationship of NK and T lymphocytes. J Immunol. 1992;149:1876-1880[Abstract]. 47. Banchereau J, Steinman RM. Dendritic cells and the control of immunity. Nature. 1998;392:245-252[CrossRef][Medline] [Order article via Infotrieve].
48.
de Yebenes VG, Carrasco YR, Ramiro AR, Toribio ML.
Identification of a myeloid intrathymic pathway of dendritic cell development marked by expression of the granulocyte macrophagecolony-stimulating factor receptor.
Blood.
2002;99:2948-2956
49.
Res PC, Couwenberg F, Vyth-Dreese FA, Spits H.
Expression of pT
50.
Chaperot L, Bendriss N, Manches O, et al.
Identification of a leukemic counterpart of the plasmacytoid dendritic cells.
Blood.
2001;97:3210-3217
51.
Calatayud S, Vivier E, Bernaud J, Merieux Y, Rigal D.
Expression of a NK cell-restricted epitope on decidual large granular lymphocytes.
Int Immunol.
1996;8:1637-1642 52. Vivier E, Morin PM, O'Brien C, Schlossman SF, Anderson P. CD2 is functionally linked to the zeta-natural killer receptor complex. Eur J Immunol. 1991;21:1077-1080[Medline] [Order article via Infotrieve].
53.
Sanchez MJ, Muench MO, Roncarolo MG, Lanier LL, Phillips JH.
Identification of a common T/natural killer cell progenitor in human fetal thymus.
J Exp Med.
1994;180:569-576
54.
Sanchez MJ, Spits H, Lanier LL, Phillips JH.
Human natural killer cell committed thymocytes and their relation to the T cell lineage.
J Exp Med.
1993;178:1857-1866
55.
Lee PT, Benlagha K, Teyton L, Bendelac A.
Distinct functional lineages of human V(alpha)24 natural killer T cells.
J Exp Med.
2002;195:637-641 56. Galy A, Travis M, Cen D, Chen B. Human T, B, natural killer, and dendritic cells arise from a common bone marrow progenitor cell subset. Immunity. 1995;3:459-473[CrossRef][Medline] [Order article via Infotrieve]. 57. Katsura Y. Redefinition of lymphoid progenitors. Nat Rev Immunol. 2002;2:127-132[CrossRef][Medline] [Order article via Infotrieve].
58.
Langerak AW, Wolvers-Tettero IL, van Gastel-Mol EJ, Oud ME, van Dongen JJ.
Basic helix-loop-helix proteins E2A and HEB induce immature T-cell receptor rearrangements in nonlymphoid cells.
Blood.
2001;98:2456-2465
59.
Lauzurica P, Krangel MS.
Enhancer-dependent and -independent steps in the rearrangement of a human T cell receptor delta transgene.
J Exp Med.
1994;179:43-55
60.
Yoneda N, Tatsumi E, Kawano S, Matsuo Y, Minowada J, Yamaguchi N.
Human recombination activating gene-1 in leukemia/lymphoma cells: expression depends on stage of lymphoid differentiation defined by phenotype and genotype.
Blood.
1993;82:207-216 61. Boeckx N, Willemse MJ, Szczepanski T, et al. Fusion gene transcripts and Ig/TCR gene rearrangements are complementary but infrequent targets for PCR-based detection of minimal residual disease in acute myeloid leukemia. Leukemia. 2002;16:368-375[CrossRef][Medline] [Order article via Infotrieve].
62.
Wilson A, Held W, MacDonald HR.
Two waves of recombinase gene expression in developing thymocytes.
J Exp Med.
1994;179:1355-1360 63. Herblot S, Steff AM, Hugo P, Aplan PD, Hoang T. SCL and LMO1 alter thymocyte differentiation: inhibition of E2A-HEB function and pre-T alpha chain expression. Nat Immunol. 2000;1:138-144[CrossRef][Medline] [Order article via Infotrieve].
64.
Breit TM, Mol EJ, Wolvers-Tettero IL, Ludwig WD, van Wering ER, van Dongen JJ.
Site-specific deletions involving the tal-1 and sil genes are restricted to cells of the T-cell receptor 65. Ferrando AA, Neuberg DS, Staunton J, et al. Gene expression signatures define novel oncogenic pathways in T cell acute lymphoblastic leukemia. Cancer Cell. 2002;1:75-87[CrossRef][Medline] [Order article via Infotrieve].
66.
Lefranc MP.
IMGT, the international ImMunoGeneTics database.
Nucleic Acids Res.
2001;29:207-209
© 2003 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  L. Terriou, R. Ben Abdelali, C. Roumier, L. Lhermitte, J. de Vos, P. Cornillet, O. Nibourel, K. Beldjord, H. Dombret, G. Leverger, et al. C/EBPA methylation is common in T-ALL but not in M0 AML Blood, February 19, 2009; 113(8): 1864 - 1866. [Full Text] [PDF]
|
|
|
|
|
|
F. Armstrong, P. B. de la Grange, B. Gerby, M.-C. Rouyez, J. Calvo, M. Fontenay, N. Boissel, H. Dombret, A. Baruchel, J. Landman-Parker, et al. NOTCH is a key regulator of human T-cell acute leukemia initiating cell activity Blood, February 19, 2009; 113(8): 1730 - 1740. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. J.T. Staal and A. W. Langerak Signaling pathways involved in the development of T-cell acute lymphoblastic leukemia Haematologica, April 1, 2008; 93(4): 493 - 497. [Full Text] [PDF]
|
|
|
|
 |
|
 F. Baleydier, A.-V. Decouvelaere, J. Bergeron, P. Gaulard, D. Canioni, Y. Bertrand, S. Lepretre, B. Petit, H. Dombret, K. Beldjord, et al. T Cell Receptor Genotyping and HOXA/TLX1 Expression Define Three T Lymphoblastic Lymphoma Subsets which Might Affect Clinical Outcome Clin. Cancer Res., February 1, 2008; 14(3): 692 - 700. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Bessette, M. L. Lang, R. A. Fava, M. Grundy, J. Heinen, L. Horne, R. Spolski, A. Al-Shami, H. C. Morse III, W. J. Leonard, et al. A Stat5b transgene is capable of inducing CD8+ lymphoblastic lymphoma in the absence of normal TCR/MHC signaling Blood, January 1, 2008; 111(1): 344 - 350. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Bergeron, E. Clappier, I. Radford, A. Buzyn, C. Millien, G. Soler, P. Ballerini, X. Thomas, J. Soulier, H. Dombret, et al. Prognostic and oncogenic relevance of TLX1/HOX11 expression level in T-ALLs Blood, October 1, 2007; 110(7): 2324 - 2330. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Clappier, W. Cuccuini, A. Kalota, A. Crinquette, J.-M. Cayuela, W. A. Dik, A. W. Langerak, B. Montpellier, B. Nadel, P. Walrafen, et al. The C-MYB locus is involved in chromosomal translocation and genomic duplications in human T-cell acute leukemia (T-ALL), the translocation defining a new T-ALL subtype in very young children Blood, August 15, 2007; 110(4): 1251 - 1261. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. A. Dik, B. Nadel, G. K. Przybylski, V. Asnafi, P. Grabarczyk, J. M. Navarro, B. Verhaaf, C. A. Schmidt, E. A. Macintyre, J. J. M. van Dongen, et al. Different chromosomal breakpoints impact the level of LMO2 expression in T-ALL Blood, July 1, 2007; 110(1): 388 - 392. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Tanaka, T. Era, S.-i. Nishikawa, and S. Kawamata Forced expression of Nanog in hematopoietic stem cells results in a {gamma}{delta}T-cell disorder Blood, July 1, 2007; 110(1): 107 - 115. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. V. Cox, H. M. Martin, P. R. Kearns, P. Virgo, R. S. Evely, and A. Blair Characterization of a progenitor cell population in childhood T-cell acute lymphoblastic leukemia Blood, January 15, 2007; 109(2): 674 - 682. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Chapiro, E. Delabesse, V. Asnafi, C. Millien, F. Davi, E. Nugent, K. Beldjord, T. Haferlach, D. Grimwade, and E. A. Macintyre Expression of T-lineage-affiliated transcripts and TCR rearrangements in acute promyelocytic leukemia: implications for the cellular target of t(15;17) Blood, November 15, 2006; 108(10): 3484 - 3493. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Van Vlierberghe, M. van Grotel, H. B. Beverloo, C. Lee, T. Helgason, J. Buijs-Gladdines, M. Passier, E. R. van Wering, A. J. P. Veerman, W. A. Kamps, et al. The cryptic chromosomal deletion del(11)(p12p13) as a new activation mechanism of LMO2 in pediatric T-cell acute lymphoblastic leukemia Blood, November 15, 2006; 108(10): 3520 - 3529. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. P. Weng, J. M. Millholland, Y. Yashiro-Ohtani, M. L. Arcangeli, A. Lau, C. Wai, C. del Bianco, C. G. Rodriguez, H. Sai, J. Tobias, et al. c-Myc is an important direct target of Notch1 in T-cell acute lymphoblastic leukemia/lymphoma Genes & Dev., August 1, 2006; 20(15): 2096 - 2109. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. L. Joachims, J. L. Chain, S. W. Hooker, C. J. Knott-Craig, and L. F. Thompson Human {alpha}beta and {gamma}{delta} Thymocyte Development: TCR Gene Rearrangements, Intracellular TCRbeta Expression, and {gamma}{delta} Developmental Potential--Differences between Men and Mice J. Immunol., February 1, 2006; 176(3): 1543 - 1552. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Burkhardt, W. Woessmann, M. Zimmermann, U. Kontny, J. Vormoor, W. Doerffel, G. Mann, G. Henze, F. Niggli, W.-D. Ludwig, et al. Impact of Cranial Radiotherapy on Central Nervous System Prophylaxis in Children and Adolescents With Central Nervous System-Negative Stage III or IV Lymphoblastic Lymphoma J. Clin. Oncol., January 20, 2006; 24(3): 491 - 499. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. K. Hoyer, M. Herling, K. Bagrintseva, D. W. Dawson, S. W. French, M. Renard, J. G. Weinger, D. Jones, and M. A. Teitell T Cell Leukemia-1 Modulates TCR Signal Strength and IFN-{gamma} Levels through Phosphatidylinositol 3-Kinase and Protein Kinase C Pathway Activation J. Immunol., July 15, 2005; 175(2): 864 - 873. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. A. Dik, K. Pike-Overzet, F. Weerkamp, D. de Ridder, E. F.E. de Haas, M. R.M. Baert, P. van der Spek, E. E.L. Koster, M. J.T. Reinders, J. J.M. van Dongen, et al. New insights on human T cell development by quantitative T cell receptor gene rearrangement studies and gene expression profiling J. Exp. Med., June 6, 2005; 201(11): 1715 - 1723. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Asnafi, A. Buzyn, X. Thomas, F. Huguet, N. Vey, J.-M. Boiron, O. Reman, J.-M. Cayuela, V. Lheritier, J.-P. Vernant, et al. Impact of TCR status and genotype on outcome in adult T-cell acute lymphoblastic leukemia: a LALA-94 study Blood, April 15, 2005; 105(8): 3072 - 3078. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Paietta, A. A. Ferrando, D. Neuberg, J. M. Bennett, J. Racevskis, H. Lazarus, G. Dewald, J. M. Rowe, P. H. Wiernik, M. S. Tallman, et al. Activating FLT3 mutations in CD117/KIT+ T-cell acute lymphoblastic leukemias Blood, July 15, 2004; 104(2): 558 - 560. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Chiaretti, X. Li, R. Gentleman, A. Vitale, M. Vignetti, F. Mandelli, J. Ritz, and R. Foa Gene expression profile of adult T-cell acute lymphocytic leukemia identifies distinct subsets of patients with different response to therapy and survival Blood, April 1, 2004; 103(7): 2771 - 2778. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2003 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
, and RAG-1 in T-acute lymphoblastic
leukemias improves understanding of early human T-lymphoid lineage
commitment
Top
Abstract
Introduction
expression. Despite their immaturity, IM0 T-ALLs were TdT
positive, demonstrating that TdT expression precedes TCR rearrangement,
RAG-1, and pT