Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
Prepublished online as a Blood First Edition Paper on November 21, 2002; DOI 10.1182/blood-2002-07-2215.

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2002-07-2215v1
101/7/2756    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Copie-Bergman, C.
Right arrow Articles by Leroy, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Copie-Bergman, C.
Right arrow Articles by Leroy, K.
Related Collections
Right arrow Neoplasia
Right arrow Signal Transduction
Right arrow Gene Expression
Right arrow Genomics
Right arrow Clinical Trials and Observations
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, 1 April 2003, Vol. 101, No. 7, pp. 2756-2761

NEOPLASIA

Interleukin 4-induced gene 1 is activated in primary mediastinal large B-cell lymphoma

Christiane Copie-Bergman, Marie-Laure Boulland, Catherine Dehoulle, Peter Möller, Jean-Pierre Farcet, Martin J. S. Dyer, Corinne Haioun, Paul-Henri Roméo, Philippe Gaulard, and Karen Leroy

From the Département de Pathologie, the Service d'Immunologie Biologique, and the Service d'Hématologie Clinique, EA2348, AP-HP, Hôpital Henri Mondor, Créteil, France; the Institute of Pathology, University of Ulm, Germany; the Department of Pathology, University of Leicester, United Kingdom; and the Département d'Hématologie of Institut Cochin, Maternité Port-Royal, Paris, France.


    Abstract
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

The molecular markers that distinguish primary mediastinal large B-cell lymphoma (PMBL) from nonmediastinal diffuse large B-cell lymphomas (NM-DLBLs) remain to be identified. Using cDNA representational difference analysis to compare PMBL and NM-DLBL transcripts, we isolated a cDNA fragment homologous to the mouse B-cell interleukin 4 (IL-4)-inducible gene FIG1 (interleukin 4-induced gene 1) transcript. The human FIG1 mRNA encodes a 567 amino acid protein that comprises a signal peptide and a large flavin-binding amino oxidase domain, and shares significant homology with secreted apoptosis-inducing L-amino acid oxidases. Northern blot studies showed that FIG1 mRNA expression is mainly restricted to lymphoid tissues. It is expressed at low levels in thymus, spleen, tonsils, and reactive lymph nodes, and is highly up-regulated in IL-4+CD40-activated tonsillar B cells. Interestingly, in human B-cell lines, FIG1 mRNA expression appeared restricted to the PMBL-derived MedB-1 and Karpas 1106 cell lines. Using real-time reverse transcriptase-polymerase chain reaction (RT-PCR), we demonstrated that all but one PMBL (16/17) displayed high FIG1 mRNA levels, whereas most NM-DLBLs (12/18) and all low-grade B-cell lymphomas tested (8/8) exhibited low FIG1 mRNA levels. The difference between PMBLs and NM-DLBLs was statistically significant (Fisher test; P = .0003). Southern blot studies did not show rearrangement of the FIG1 gene. FIG1 gene expression might be due to a constitutive activation of a cytokine signaling pathway in PMBL. (Blood. 2003;101:2756-2761)

© 2003 by The American Society of Hematology.

    Introduction
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

In the past 10 years, there has been increasing evidence that primary mediastinal large B-cell lymphoma (PMBL) harbors unique clinical, pathologic, and immunohistochemical features. This disease is now recognized as a specific lymphoma subtype among diffuse large B-cell lymphomas (DLBLs) in the World Health Organization (WHO) classification.1 PMBL accounts for about 5% of aggressive lymphomas, tends to affect a relatively young population (average age 37 years), and presents a 50% to 60% 5-year failure-free survival rate despite intensive chemotherapy.2 It is characterized by a rapidly growing mass, developing in the anterior upper mediastinum, consisting of large B cells that usually express little if any surface or cytoplasmic immunoglobulin and often lack major histocompatibility complex (MHC) class I and/or class II molecules.3-5 It is now assumed that PMBL derives from a peculiar population of thymic medullary B cells.6,7 Attempts to assign PMBL precursor B cells to a specific developmental stage have led to controversial views.8,9 However, recent data based on immunoglobulin gene analysis suggest that PMBL is of post-germinal center origin.10

Although the clinical and pathologic characteristics of PMBL are now well recognized, a tumor-specific gene expression profile and specific chromosomal translocations have not yet been reported. This may be explained by the rarity of the disease and the difficulty to obtain fresh material for molecular studies. BCL2 and BCL6 rearrangements usually observed in DLBL appear to be rare in PMBL.11,12 Comparative genomic hybridization studies have reported frequent overrepresentations of genomic segments of chromosome 9p, Xq, 12q, and 2p.13,14 Several candidate genes have been proposed, among which are the proto-oncogene c-REL and the Janus kinase 2 (JAK2) gene,15 but still, none of them has been specifically assigned to PMBL lymphomagenesis.

Hence, more accurate PMBL gene expression profiling appears necessary not only to improve diagnosis and treatment, but also to understand the molecular alterations involved in the pathogenesis of this particular lymphoma subtype. In a recent study, we used differential display reverse transcription to compare the mRNAs expressed in PMBL with those expressed in nonmediastinal DLBLs (NM-DLBLs).16 We identified the MAL gene as a distinct molecular marker of PMBL. The MAL gene is normally expressed in lymphoid T cells, polarized epithelial cells, and myelin-forming cells.17-19 It encodes a proteolipid believed to participate in membrane microdomains stabilization, intracellular transport, and signaling.20,21 Its expression in PMBL may modify raft dynamics and contribute to neoplastic transformation.

To extend PMBL gene expression profile analysis, we used representational difference analysis (RDA) to isolate genes that are differentially expressed in PMBL versus NM-DLBL. In this report, we describe the identification of a gene that is frequently activated in PMBL and is the human homologue of the mouse immediate-early interleukin 4 (IL-4)-inducible gene FIG1 (interleukin 4-induced gene 1).22


    Materials and methods
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Tissue specimens and cell lines

We retrieved 45 cases of lymphoid malignancies from the files of the department of Pathology, Hôpital Henri Mondor, Créteil, France. This series included: PMBLs (n = 17), NM-DLBLs (n = 18), B-cell chronic lymphocytic leukemia (n = 2), mantle cell lymphomas (n = 2), Burkitt lymphomas (n = 2), follicular lymphomas (n = 2), and nodal marginal zone B-cell lymphomas (n = 2). All patients with PMBL presented with an initial prominent bulky mediastinal mass. For each case, material consisted of Bouin-, formalin-, or alcohol, formalin, acetic acid (AFA)-fixed pathologic specimens, and frozen specimens were available. The morphologic features were assessed on hematoxylin-eosin-stained sections of paraffin-embedded tissue. All cases were evaluated for B- and T-cell differentiation antigens using the Ventana automated immunostainer (Ventana Medical Systems, Tucson, AZ) and their diaminobenzidine detection kit, according to the manufacturer's recommendations. Where appropriate, antigen retrieval was performed by microwave heating in citrate or EDTA (ethylenediaminetetraacetic acid) buffer. Diagnosis of each case was established by combined histologic and immunohistochemical criteria and the lymphomas were classified according to the WHO classification.1 All cases of PMBL had a CD20+ CD3- immunophenotype.

Normal and reactive lymphoid tissues were used as a control. These included one tonsil from a child with follicular hyperplasia; 3 lymph node biopsies showing benign follicular hyperplasia; one spleen obtained from a patient with autoimmune disorder; and one thymus removed at necropsy from a 40-week-gestation fetus. All specimens were received fresh, and samples were snap frozen or processed immediately.

Highly purified B cells were obtained from tonsillar cell suspensions by positive selection using CD19 magnetic microbeads (Miltenyi Biotec, Bergisch Gladbach, Germany). B cells were activated for 6 days in 25 cm2 culture flasks with irradiated (70 Gy) transfected murine L cells expressing human CD40 ligand and 10 ng/mL IL-4 (Sanofi, Labège, France). Activated B cells were more than 98% CD19+, CD80+, and CD86+.

B-cell lines used in this study included the B-cell precursor acute lymphoblastic leukemia (ALL) cell lines RS 4:11, Nalm6, Nalm16, and 697; the Burkitt lymphoma cell line Ramos; the RL lymphoma cell line bearing a t(14;18) translocation; and 2 cell lines derived from patients with PMBL in relapse, Karpas 1106 and MedB-1.23,24 Other hematopoietic (Jurkat, SUDHL1, Peer and DU528 T-cell lines, HEL erythro-megakaryocytic cell line) and nonhematopoietic (HepG2 hepatoma cell line, MZ2 melanoma cell line, and Hela epithelial cell line) cell lines were also studied.

Representational difference analysis subtraction and screening

Total RNA was extracted from frozen tumor samples using the TRIzol reagent (Life Technologies, Cergy-Pontoise, France). Total RNA (2 µg) from 5 PMBLs and 5 NM-DLBLs was pooled to prepare PMBL and NM-DLBL polyA+ RNAs using the Dynabeads mRNA purification kit (Dynal, Oslo, Norway). cDNA was synthesized by the Superscript Choice system (Life Technologies) according to the manufacturer's instructions. PMBL cDNA was used as the tester and NM-DLBL cDNA as the driver to perform RDA according to the previously published procedure.25 We conducted 2 rounds of hybridization. The driver-to-tester ratio was 1:100 in the first round of hybridization and 1:800 in the second round of hybridization. The differential products were subcloned into pBluescript II KS plasmid and further analyzed for differential expression.

Northern blot analysis

Total RNA was isolated using TRIzol reagent. Total RNA (5 µg) was fractionated in a 1% agarose gel containing formaldehyde and transferred to Hybond-N+ membranes (Amersham Biosciences, Orsay, France). Hybridization was performed in Quick Express Hyb solution (Clontech Laboratories, Palo Alto, CA) with an alpha -32P-labeled human FIG1 RDA fragment or a beta -actin control probe (Clontech Laboratories) according to the manufacturer's protocol.

DNA sequencing

Plasmid DNA and PCR products were Taq cycle sequenced using the Applied Biosystems PRISM ready reaction Dye-dideoxy Terminator and Dye-Primer sequencing kits (Applied Biosystems, Courtaboeuf, France) and samples run on an ABI 377 DNA sequencer (Applied Biosystems).

Quantitative RT-PCR analysis

Total RNA (2 µg) was reverse transcribed with Superscript II (Life Technologies) in a final volume of 20 µL containing 300 ng random hexamers, according to the manufacturer's instructions. Following enzyme heat inactivation, cDNA was diluted 1:5 in water and stored at -20°C. FIG1 mRNA levels were measured by real-time quantitative reverse transcription-polymerase chain reaction (RT-PCR) using the Light Cycler (Roche Diagnostics, Meylan, France) technology and normalized to the ribosomal S14 mRNA values to control for RNA quality and reverse transcription efficiency. For each real-time PCR run, cDNA was run in duplicate in parallel with 8 standard dilution samples and Karpas 1106 cDNA. FIG1 and S14 standards were purified PCR products that were sequenced and quantitated using a Genequant spectrophotometer (Amersham Biosciences). Karpas 1106 cDNA was included in each PCR run to control for PCR reproducibility among runs and allow relative expression to be compared across all the tested samples. PCRs were performed in Light Cycler capillaries, in a 20 µL volume containing 2 µL Light Cycler-FastStart DNA Master SYBR Green I mix (Roche Diagnostics), 4 mM final MgCl2 concentration, 0.5 µM FIG1 sense and antisense primers (FIG1 sense: 5' TATGTGGTGGAGAAGGTG 3', FIG1 antisense: 5' ATGCGGCTGTACTGGAGTC 3', purchased from Eurogentec, Serain, Belgium), or 0.2 µM S14 sense and antisense primers (S14 sense: 5' GGCAGACCGAGATGAATCCTCA 3', S14 antisense: 5' CAGGTCCAGGGGTCTTGGTCC 3', purchased from Biotez GmbH, Berlin, Germany), and 2 µL cDNA diluted 1:3 (corresponding to 13 ng RNA). After preincubation and DNA denaturation at 95°C for 8 minutes, 40 cycles of amplification (95°C for 10 seconds, 62°C for 5 seconds for FIG1, or 65°C for 5 seconds for S14, 72°C for 15 seconds) were performed and PCR products were further denatured at 95°C, annealed at 70°C, and slowly heated to 95°C to perform a melting curve analysis. FIG1/S14 mRNA ratios were determined as mean FIG1 value / mean S14 value × 100.

Statistical analysis

To test the differences between PMBL and NM-DLBL, we compared the FIG1/S14 mRNA ratios between these 2 categories of lymphomas using a Fisher exact test and a Mann-Whitney U test (Statview software; Abacus Concepts, Berkeley, CA).

DNA extraction and Southern blot analysis

DNA was extracted from MedB-1 and Ramos cells, from 5 PMBL and 5 NM-DLBL tumor samples, by proteinase K digestion, phenol/chloroform extraction, and ethanol precipitation.26 After digestion with EcoRI, DNA fragments were electrophoresed in a 0.8% agarose gel in TAE buffer (40 mM Tris-acetate,1 mM EDTA, pH 8.3) and transferred onto a nylon N+ membrane (Amersham Biosciences). Hybridization was performed in Quick Express Hyb Solution (Clontech) with an alpha -32P-labeled FIG1 probe, spanning nucleotide 444 to 852 of FIG1 cDNA (according to AF 293462).


    Results
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

RDA identification of differential cDNA fragments

RNA isolated from 5 PMBL and 5 NM-DLBL cases was pooled to generate the tester (PMBL) and driver (NM-DLBL) cDNA representations. After 2 rounds of subtractive hybridization and selective PCR amplification, the second difference product, DP2, showed several distinct bands that were resolved in an acrylamide gel (data not shown). Each of these bands was eluted from the gel and cloned into a pBluescript II KS plasmid. Inserts from these clones were used as probes to hybridize Southern blots of initial tester and driver representations, and sequenced when differentially expressed. We found that 14 DpnII fragments originating from 9 different genes were differentially expressed in PMBL versus NM-DLBL cDNA representations (Table 1).

                              
View this table:
[in this window]
[in a new window]
 
Table 1. RDA fragments showing differential expression in PMBL versus N-DLBL cDNA representations

Some of these genes, such as elongation factor 2 on chromosome 19pter-q12, and both complement C1r and CD163 on 12p13, were located in chromosomal regions showing frequent gains in PMBL.27,28

One of these fragments was homologous to the mouse interleukin 4-induced gene 1, identified as an IL-4 immediate-early response gene in splenocytes.22 Specific and recurrent expression of the human FIG1 mRNA in PMBL was studied by Northern blot analysis. The FIG1 RDA fragment hybridized with 1.9-kb transcripts, which were highly expressed in the 5 original PMBLs but low or undetectable in the 5 original NM-DLBLs (Figure 1).


View larger version (112K):
[in this window]
[in a new window]
 
Figure 1. Northern blot analysis of FIG1 expression in PMBL versus NM-DLBL. Total RNA (5 µg) extracted from the 5 original PMBLs and the 5 original NM-DLBLs used to generate RDA representations was loaded on each lane. Ethidium bromide-stained 28S and 18S rRNA bands are shown for comparison (top). Hybond N+ membrane was hybridized with the alpha -32P-labeled human FIG1 RDA fragment.

Structural features of human FIG1 cDNA and protein

Human FIG1 cDNA sequence was determined by sequencing overlapping RT-PCR, 5'RACE, and 3'RACE fragments, and alignment of these sequences with the RDA fragment and human expressed sequence tags of the Unigene cluster Hs.380 444. The consensus sequence obtained comprised 1781 nucleotides (nt) and was identical to the sequence recently submitted to GenBank by Chu et al, except for a shorter 5' end (-16 nt).29 This sequence exhibited an open reading frame (ORF) of 1701 nt, with an ATG start codon lying in a strong Kozak context (RnnatgG).30 The 3' untranslated region of FIG1 was very short, the stop codon being located within the variant polyadenylation signal ATTAAA (data not shown).31 Alignment of the human cDNA sequences on the human genome revealed that the human gene is located within a small region (7 kilobase [kb]) of chromosome 19q13.33, and is composed of 8 exons, showing an exon/intron organization identical to the mouse gene.

Human FIG1 cDNA encodes a 567 amino acid (aa) protein that contains 4 potential N-glycosylation sites, several potential protein kinase C, casein kinase II, tyrosine kinase, and cyclic adenosine monophosphate/cyclic guanosine monophosphate (cAMP/cGMP) protein kinase phosphorylation sites, and 5 N-myristoylation sites. This protein presents a putative signal peptide (aa 1-22) and a large flavin binding amino-oxidase domain (aa 78-505; Figure 2). Human FIG1 protein is 80% homologous to the mouse FIG1 protein in its 505 aa N-terminal part and completely divergent in its 62 aa C-terminal part. Interestingly, human and mouse FIG1 proteins show significant homology with the fish endoplasmic reticulum lumenal L-amino acid oxidase (ERL-LAO, also named AIP for apoptosis-inducing protein) and the snake venom Apoxin 1 (41% and 33% identity, respectively; Figure 2), which both possess an L-amino acid oxidase enzymatic activity and induce apoptosis through H2O2 production.32-34


View larger version (73K):
[in this window]
[in a new window]
 
Figure 2. Sequence comparison of human and mouse FIG1 proteins with ERL-LAO and Apoxin 1 L-amino oxidases. Sequences were aligned and compared with a clustal program.47 The flavin-containing amino oxidase domain is boxed (CD pfam 01593). (*) indicates positions that have a single, fully conserved residue; (:) indicates strong residue conservation, and (.) indicates weak residue conservation.

FIG1 mRNA expression pattern in normal human tissues and transformed cell lines

In nonhematopoietic tissues, FIG1 transcripts were not detected in prostate, ovary, small intestine, and colon, but the FIG1 RDA probe hybridized with abundant 2.4-kb transcripts in the testis (Figure 3A). In normal lymphoid tissues, FIG1 transcripts were detected at very low levels in the thymus, spleen, tonsil, reactive lymph nodes, and resting tonsillar B cells (Figure 3B). As originally described in mice and recently in humans,22,29 RT-PCR experiments showed that FIG1 RNA is induced by IL-4 alone in tonsillar B cells (data not shown). Its expression was highly up-regulated when tonsillar B cells were activated with both IL-4 and CD40 ligand (Figure 3B).


View larger version (37K):
[in this window]
[in a new window]
 
Figure 3. Northern blot analysis of FIG1 expression in human tissues and B-cell lines. (A) Premade Nylon membrane (Clontech) loaded with 2µg poly A+ RNA per lane from spleen, thymus, prostate, testis, ovary, small intestine, colon, and peripheral blood leukocytes. (B) Total RNA (5 µg) from thymus, spleen, tonsil, reactive lymph nodes (LN1, LN2, LN3), resting tonsillar B cells (B cells NA), and IL-4+CD40L-activated tonsillar B cells (B cells A) was loaded on each lane. Ethidium bromide-stained 28S and 18S rRNA bands are shown for comparison (top). (C) Total RNA (5 µg) from human B-cell lines was loaded on each lane. Ethidium bromide-stained 28S and 18S rRNA bands are shown for comparison (top). Membranes were hybridized with the alpha -32P-labeled human FIG1 RDA fragment and the Clontech membrane (A) was also hybridized with a beta -actin probe as control.

We then studied FIG1 mRNA expression in a panel of human cell lines (Figure 3C). In B-cell lines, FIG1 transcripts were exclusively seen in the PMBL-derived B-cell lines Karpas 1106 and MedB-1, the latter showing a very high level of FIG1 mRNA expression. FIG1 mRNA expression was not detected in pro-B- (RS 4:11, Nalm16), pre-B- (697, Nalm6), Burkitt (Ramos), and the t(14;18) positive RL cell lines. Other hematopoietic (Jurkat, SUDHL1, Peer, DU528, HEL) and nonhematopoietic (HepG2, MZ2, Hela) cell lines were negative for FIG1 expression (data not shown).

FIG1 mRNA expression in lymphoid malignancies

FIG1 mRNA expression was first analyzed by Northern blot in a limited series of different low- and high-grade B-cell lymphoma entities. We selected for this analysis representative cases of lymphomas ranging from naïve B-cell-derived lymphomas to post-germinal center B-cell-derived lymphomas for which frozen material was available. This series included 2 chronic lymphocytic leukemias (CLLs), 2 mantle cell lymphomas (MCL), 2 Burkitt lymphomas (Bkt), 2 follicular lymphomas (FL), 2 marginal zone lymphomas (MZLs), 2 PMBLs, 4 NM-DLBLs including 2 NM-DLBLs used in the initial RDA experiments, and 2 plasmablastic lymphomas (PL-DLBLs). As shown in Figure 4A, FIG1 mRNA was highly expressed in PMBL and weakly expressed in the other B-cell lymphomas tested.


View larger version (38K):
[in this window]
[in a new window]
 
Figure 4. Analysis of FIG1 expression in normal lymphoid tissues and B-cell lymphomas by Northern blot and quantitative RT-PCR. (A) Northern blot analysis of FIG1 expression in naive B-cell to post-germinal center B-cell-derived lymphomas. Total RNA (5 µg) from chronic lymphocytic leukemias (CLLs), mantle cell lymphomas (MCLs), Burkitt lymphomas (Bkt), follicular lymphomas (FLs), NM-DLBLs, PMBLs, marginal zone lymphomas (MZLs), and plasmablastic DLBLs (PL-DLBLs), was loaded on each lane. Ethidium bromide-stained 28S and 18S rRNA bands are shown for comparison (top). Hybond N+ membrane was hybridized with the alpha -32P-labeled human FIG1 RDA fragment. (B) Quantitative RT-PCR analysis of FIG1 expression in normal and tumoral lymphoid tissue samples. FIG1/S14 mRNA ratios were determined as indicated in "Materials and methods." The FIG1/S14 mRNA ratios of normal lymphoid tissues (1 spleen, 1 thymus, 3 lymph nodes; ×), 18 cases of NM-DLBL (open circle ), 17 cases of PMBL (), and other B-cell lymphomas (2 CLLs, 2 MCLs, 2 Bkt, 2 FLs, 2 MZLs; ) are represented in a scatter plot. The dashed line represents the cutoff ratio used to distinguish high and low levels FIG1 gene expression.

We then performed real-time quantitative RT-PCR analysis of FIG1 gene expression in the normal and neoplastic samples used in Northern blot experiments. We found that the FIG1/S14 mRNA ratios evaluated with this technique were parallel to the level of expression observed in Northern blot analysis. Normal lymphoid tissues (spleen, thymus, lymph nodes) displayed FIG1/S14 mRNA ratios inferior or equal to 10. The FIG1/S14 mRNA ratio was equal to 1 in purified tonsillar B cells and increased to 40 after IL-4+CD40L stimulation. FIG1/S14 mRNA ratios varied from 12 to 101 in the 5 original PMBLs and were less than 10 in the 5 original NM-DLBLs. All other B-cell lymphomas tested displayed FIG1/S14 mRNA ratios less than 10. We therefore decided to use a FIG1/S14 mRNA cutoff ratio of 10 to distinguish 2 categories of samples: those with high FIG1 gene expression (FIG1/S14 mRNA ratio > 10) and those with low FIG1 mRNA levels (FIG1/S14 mRNA ratio <=  10).

We then extended our analysis to a larger series of 17 cases of PMBL and 18 cases of NM-DLBL, including the 5 PMBLs and 5 NM-DLBLs used in the RDA experiment. All but one PMBL (16/17) displayed high FIG1 gene expression, whereas most NM-DLBLs (12/18) exhibited low FIG1 mRNA levels (Figure 4B). Among the NM-DLBLs with high FIG1 mRNA levels, 5 were peculiar, because of extranodal origin (one spleen, one skin), suspected origin from the transformation of a follicular and marginal zone lymphoma, respectively (2 cases), or Epstein-Barr virus (EBV) association (one case). The difference between the PMBL and NM-DLBL groups proved significant (Fisher exact test based on the 2 category grading; P = .0003). Moreover, comparison of FIG1/S14 mRNA ratio as a continuous variable in PMBL versus NM-DLBL also demonstrated a significant difference (Mann-Whitney U test, P = .014).

Southern blot analysis of FIG1 gene

To study whether genomic rearrangements might account for FIG1 gene expression in PMBL, DNAs were extracted from PMBL and NM-DLBL tumor samples, subjected to EcoRI digestion, and analyzed by Southern blot. The blot was hybridized with a FIG1 PCR-generated probe spanning exons 5, 6, and 7. This probe hybridized with the expected 10-kb and 4.5-kb DNA fragments in all PMBL and NM-DLBL tumor samples, as well as in the MedB-1 and the Ramos B-cell lines (Figure 5). Hence, the increased expression of FIG1 mRNA in PMBL did not result from major genetic alterations. Furthermore, the signals correlated with the amount of DNA loaded in each lane, thereby ruling out overexpression related to gain of chromosomal material.


View larger version (56K):
[in this window]
[in a new window]
 
Figure 5. Southern blot analysis. Genomic DNA extracted from 5 PMBLs, 5 NM-DLBLs, and the MedB-1 and Ramos B-cell lines were subjected to EcoRI digestion, agarose gel electrophoresis, nylon N+ membrane transfer, and hybridization with an alpha -32P-labeled PCR-derived FIG1 cDNA probe. A schematic map of the FIG1 gene is represented at the top of the figure (not drawn to scale). The probe used (bold line) spans FIG1 exons 5, 6, and 7, and hybridized with 10-kb and 4.5-kb DNA fragments in all samples.


    Discussion
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Using cDNA representational difference analysis, we identified the FIG1 mRNA as being regularly expressed in PMBL but rarely in NM-DLBL. FIG1 was initially identified in the mouse as an immediate-early IL-4-inducible gene in B splenocytes.22 This B-cell-specific gene was shown to be induced in resting cells within 2 hours in response to IL-4 alone, but not to IL-2, IL-5, or IL-6. This induction was recently demonstrated to be STAT6 dependent.35 We have shown by Northern blot and quantitative RT-PCR the high expression of FIG1 in IL-4-activated human B-cells, in the PMBL-derived B-cell lines MedB-1 and Karpas 1106, and in PMBL as compared with other types of B-cell lymphomas. Since genomic amplification of the FIG1 gene in PMBL was ruled out by Southern blot analysis, these results point to a possible role of the IL-4 signaling pathway in PMBL lymphomagenesis. It was recently reported that IL-4 activation of the MedB-1 B-cell line induced down-regulation of IgG/kappa protein expression in a small subset of tumor cells, suggesting that the lack of immunoglobulin expression very frequently observed in PMBL could be due to extrinsic signals, one of which might be IL-4.10 We studied IL-4 expression in our PMBL tissues samples by quantitative RT-PCR, but failed to detect a significant expression of this cytokine (data not shown). IL-4 and IL-13 receptors share the IL-4Ralpha chain and induce similar cellular responses.36 Whether FIG1 is also an IL-13 target gene remains to be determined.

Another explanation for high FIG1 expression in PMBL could be an activation of the IL-4 signaling pathway through oncogenic events. Oncogenic activation of cytokine signaling pathways in hematopoietic malignancies has already been reported. For example, IL-13 was shown to be secreted by Hodgkin lymphoma (HL) cell lines and to be expressed in Hodgkin and Reed-Sternberg cells in HL.37 IL-13 is thus believed to promote autocrine growth of the neoplastic population in classical Hodgkin lymphoma. Interestingly, JAK2 tyrosine kinase gene is amplified in MedB-1 and was found as part of an amplicon in one case of PMBL.15 As Jak-2 has been shown to be involved in the IL-4 and IL-13 signaling pathway in some nonhematopoietic cell lines,38 one may hypothesize that FIG1 up-regulation is related to abnormal JAK2 activity in PMBL.

It is also possible that FIG1 expression in PMBL merely reflects the B-lymphocyte developmental stage at which malignant transformation occurred. FIG1 gene expression is induced in activated B cells. Thus, FIG1 gene expression in PMBL would favor the hypothesis that these lymphomas belong to the activated B-cell-like DLBL group,39 as already suggested by the presence of heavily mutated immunoglobulin genes without evidence of continuing mutational activity in both lymphoma groups.40,41

The protein encoded by the FIG1 gene shares significant homology with secreted apoptosis-inducing L-amino acid oxidases such as Apoxin 1 and ERL-LAO,32-34 suggesting that FIG1 protein might be an ectoenzyme. LAOs catalyze the oxidative deamination of various L-amino acids and produce ammonium and hydrogen peroxide (H2O2). In addition to its ability to induce apoptosis, H2O2 is becoming increasingly recognized as a signal-transducing molecule and appears to be involved in a broad spectrum of signaling pathways.42-44 Furthermore, recent studies have shown that some ectoenzymes are also involved in cellular adhesion.45,46 Thus, although the functions of the protein encoded by the FIG1 gene remain to be characterized, it is tempting to speculate that FIG1 activity might somehow be involved in PMBL lymphomagenesis.

In conclusion, we demonstrate in this study the high expression of the IL-4-inducible gene FIG1 in PMBL. Our data suggest that the IL-4/IL-13 pathway may be of significant importance in PMBL lymphomagenesis. Exploration of FIG1 functional properties could give more insight into the oncogenic events involved in this distinct subtype of DLBLs.


    Acknowledgments

We gratefully acknowledge the following pathologists who provided pathologic material: J. Brière, I. Abd Alsamad, A. M. Roucayrol. We thank N. Nio for expert assistance in statistical analysis. We also thank J. Marquet for providing resting and activated tonsillar B cells and S. Legouvello for help in real-time PCR experiments.


    Footnotes

Submitted July 23, 2002; accepted November 6, 2002.

Prepublished online as Blood First Edition Paper, November 21, 2002; DOI 10.1182/blood-2002-07-2215.

Supported by a grant from the Association pour la Recherche contre le Cancer (no. 5530) and by the Association pour la Recherche Thérapeutique, Génétique et Immunologique dans les Lymphomes (cofinanced by Roche and Amgen).

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: Karen Leroy, Département de Pathologie, Hôpital Henri Mondor, 51 avenue du Maréchal de Lattre de Tassigny, 94010 Créteil, France; e-mail: karen.leroy{at}hmn.ap-hop-paris.fr.


    References
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

1. Jaffe ES, Harris NL, Stein H, Vardiman JW. World Health Organization Classification of Tumours. Pathology and genetics of tumours of haematopoietic and lymphoid tissues. Lyon, France: IARC Press; 2001.

2. Cazals-Hatem D, Lepage E, Brice P, et al. Primary mediastinal large B-cell lymphoma. A clinicopathologic study of 141 cases compared to 916 nonmediastinal large B-cell lymphomas, a GELA study. Am J Surg Pathol. 1996;20:877-888[CrossRef][Medline] [Order article via Infotrieve].

3. Van Besien K, Kelta M, Bahaguna P. Primary mediastinal B-cell lymphoma: a review of pathology and management. J Clin Oncol. 2001;19:1855-1864[Abstract/Free Full Text].

4. Kanavaros P, Gaulard P, Charlotte F, et al. Discordant expression of immunoglobulin and its associated molecule mb-1/CD79a is frequently found in mediastinal large B-cell lymphomas. Am J Pathol. 1995;146:735-741[Abstract].

5. Möller P, Lammler B, Hermann B, Otto HF, Moldenhauer G, Momburg F. The primary mediastinal clear cell lymphoma of B-cell type has variable defects in MHC antigen expression. Immunology. 1986;59:411-417[Medline] [Order article via Infotrieve].

6. Isaacson PG, Norton AJ, Addis BJ. the human thymus contains a novel population of B lymphocytes. Lancet. 1987;2:1488-1491[Medline] [Order article via Infotrieve].

7. Hofmann WJ, Momburg F, Möller P. Thymic medullary cells expressing B cell antigens. Hum Pathol. 1988;19:1280-1287[Medline] [Order article via Infotrieve].

8. Möller P, Moldenhauer G, Momburg F, et al. Mediastinal lymphoma of clear cell type is a tumor corresponding to terminal steps of B cell differentiation. Blood. 1987;69:1087-1095[Abstract/Free Full Text].

9. De Leval L, Ferry JA, Falini B, Shipp M, Harris NL. Expression of bcl-6 and CD10 in primary mediastinal large B-cell lymphoma. Evidence for derivation from germinal center B cells? Am J Surg Pathol. 2001;25:1277-1282[CrossRef][Medline] [Order article via Infotrieve].

10. Leithäuser F, Bäuerle M, Quang Huynh M, Möller P. Isotype-switched immunoglobulin genes with a high load of somatic hypermutation and lack of ongoing mutational activity are prevalent in mediastinal B-cell lymphoma. Blood. 2001;98:2762-2770[Abstract/Free Full Text].

11. Tsang P, Cesarman E, Chadburn A, Liu YF, Knowles DM. Molecular characterization of primary mediastinal B cell lymphoma. Am J Pathol. 1996;148:2017-2025[Abstract].

12. Capello D, Vitolo U, Pasqualucci L, et al. Distribution and pattern of BCL-6 mutations throughout the spectrum of B-cell neoplasia. Blood. 2000;95:651-659[Abstract/Free Full Text].

13. Joos S, Otano-Joos MI, Ziegler S, et al. Primary mediastinal (thymic) B-cell lymphoma is characterized by gains of chromosomal material including 9p and amplification of the REL gene. Blood. 1996;87:1571-1578[Abstract/Free Full Text].

14. Scarpa A, Taruscio D, Scardoni M, et al. Nonrandom chromosomal imbalances in primary mediastinal B-cell lymphoma detected by arbitrarily primed PCR fingerprinting. Genes Chromosomes Cancer. 1999;26:203-209[CrossRef][Medline] [Order article via Infotrieve].

15. Joos S, Küpper M, Ohl S, et al. Genomic imbalances including amplification of the tyrosine kinase gene JAK2 in CD30+ Hodgkin cells. Cancer Res. 2000;60:549-552[Abstract/Free Full Text].

16. Copie-Bergman C, Gaulard P, Maouche-Chrétien L, et al. The MAL gene is expressed in primary mediastinal large B-cell lymphoma. Blood. 1999;94:3567-3575[Abstract/Free Full Text].

17. Alonso MA, Weissman SM. cDNA cloning and sequence of MAL, a hydrophobic protein associated with human T-cell differentiation. Proc Natl Acad Sci U S A. 1987;84:1997-2001[Abstract/Free Full Text].

18. Schaeren-Wiemers N, Valenzuela DM, Frank M, Schwab ME. Characterization of a rat gene, rMAL, encoding a protein with four hydrophobic domains in central and peripheral myelin. J Neurosci. 1995;15:5753-5764[Abstract].

19. Martin-Belmonte F, Kremer L, Albar JP, Marazuela M, Alonso MA. Expression of the MAL gene in the thyroid: the MAL proteolipid, a component of glycolipid-enriched membranes, is apically distributed in thyroid follicles. Endocrinology. 1998;139:2077-2084[Abstract/Free Full Text].

20. Millán J, Alonso MA. MAL, a novel integral membrane protein of human T lymphocytes, associates with glycosylphosphatidylinositol-anchored proteins and Src-like tyrosine kinases. Eur J Immunol. 1998;28:3675-3684[CrossRef][Medline] [Order article via Infotrieve].

21. Alonso MA, Millán J. The role of lipid rafts in signalling and membrane trafficking in T lymphocytes. J Cell Sci. 2001;114:3957-3965[Medline] [Order article via Infotrieve].

22. Chu CC, Paul WE. FIG1, an interleukin 4-induced mouse B-cell gene isolated by cDNA representational difference analysis. Proc Natl Acad Sci U S A. 1997;94:2507-2512[Abstract/Free Full Text].

23. Möller P, Bruderlein S, Strater J, et al. MedB-1, a human tumor cell line derived from a primary mediastinal large B-cell lymphoma. Int J Cancer. 2001;92:348-353[CrossRef][Medline] [Order article via Infotrieve].

24. Nacheva E, Dyer MJ, Metivier C, et al. B-cell non-Hodgkin's lymphoma cell line (Karpas 1106) with complex translocation involving 18q21.3 but lacking BCL2 rearrangement and expression. Blood. 1994;84:3422-3428[Abstract/Free Full Text].

25. Hubank M, Schatz DG. Identifying differences in mRNA expression by representational difference analysis of cDNA. Nucleic Acids Res. 1994;22:5640-5648[Abstract/Free Full Text].

26. Sambrook J, Fritsh EF, Maniatis F. Isolation of high molecular weight DNA from mammalian cells Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory; 1989:9-14.

27. Bentz M, Barth TFE, Brüderlein S, et al. Gain of chromosome arm 9p is characteristic of primary mediastinal B-cell lymphoma (MBL): comprehensive molecular cytogenetic analysis and presentation of a novel MBL cell line. Genes Chromosomes Cancer. 2001;30:393-401[CrossRef][Medline] [Order article via Infotrieve].

28. Palanisamy N, Abou-Elella AA, Chaganti SR, et al. Similar patterns of genomic alterations characterize primary mediastinal large-B-cell lymphoma and diffuse large-B-cell lymphoma. Genes Chromosomes Cancer. 2002;33:114-122[CrossRef][Medline] [Order article via Infotrieve].

29. Chavan SS, Tian W, Hsueh K, et al. Characterization of the human homolog of the IL-4 induced gene-1 (Fig1). Biochim Biophys Acta. 2002;1576:70-80[Medline] [Order article via Infotrieve].

30. Kozak M. Interpreting cDNA sequences: some insights from studies on translation. Mammalian Genome. 1996;7:563-574[CrossRef][Medline] [Order article via Infotrieve].

31. Beaudoing E, Freier S, Wyatt JR, Claverie JM, Gautheret D. Patterns of variant polyadenylation signal usage in human genes. Genome Res. 2000;10:1001-1010[Abstract/Free Full Text].

32. Jung SK, Mai A, Iwamoto M, Fujimoto D, Sakamaki K, Yonehara S. Purification and cloning of an apoptosis-inducing protein derived from fish infected with Anisakis simplex, a causative nematode of human Anisiakis. J Immunol. 2000;165:1491-1497[Abstract/Free Full Text].

33. Raibekas AA, Massey V. Primary structure of the snake venom L-amino acid oxidase shows high homology with the mouse B cell interleukin 4-induced Fig1 protein. Biochem Biophys Res Commun. 1996;224:134-139[CrossRef][Medline] [Order article via Infotrieve].

34. Torii S, Yamane K, Mashima T, et al. Molecular cloning and functional analysis of Apoxin I, a snake venom-derived apoptosis-inducing factor with L-amino acid oxidase activity. Biochemistry. 2000;39:3197-3205[CrossRef][Medline] [Order article via Infotrieve].

35. Schroder AJ, Pavlidis P, Arimura A, Capece D, Rothman PB. Cutting edge: STAT6 serves as positive and negative regulator of gene expression in IL-4 stimulated B lymphocytes. J Immunol. 2002;168:996-1000[Abstract/Free Full Text].

36. Nelms K, Keegan AD, Zamorano J, Ryan JJ, Paul WE. The IL-4 receptor: signaling mechanisms and biologic functions. Annu Rev Immunol. 1999;17:701-738[CrossRef][Medline] [Order article via Infotrieve].

37. Skinnider BF, Elia AJ, Gascoyne RD, et al. Interleukin 13 and interleukin 13 receptor are frequently expressed by Hodgkin and Reed-Sternberg cells of Hodgkin lymphoma. Blood. 2001;97:250-255[Abstract/Free Full Text].

38. Murata T, Noguchi PD, Puri RK. IL-13 induces phosphorylation and activation of JAK2 Janus kinase in human colon carcinoma cell lines: similarities between IL-4 and IL-13 signaling. J Immunol. 1996;156:2972-2978[Abstract].

39. Alizadeh AA, Eisen MB, Davis RE, et al. Distinct types of diffuse large B-cell lymphoma identified by gene expression profiling. Nature. 2000;403:503-511[CrossRef][Medline] [Order article via Infotrieve].

40. Lossos IS, Alizadeh AA, Eisen MB, et al. Ongoing immunoglobulin somatic mutation in germinal center B cell-like but not in activated B cell-like diffuse large cell lymphomas. Proc Natl Acad Sci U S A. 2000;97:10209-10213[Abstract/Free Full Text].

41. Barth TFE, Leithäuser F, Joos S, Bentz M, Möller P. Mediastinal (thymic) large B-cell lymphoma: where do we stand? Lancet Oncol. 2002;3:229-234[CrossRef][Medline] [Order article via Infotrieve].

42. Bodgan C, Röllinghoff M, Diefenbach A. Reactive oxygen and reactive nitrogen intermediates in innate and specific immunity. Curr Opin Immunol. 2000;12:64-76[CrossRef][Medline] [Order article via Infotrieve].

43. Carballo M, Conde M, Bekay RE, et al. Oxidative stress triggers STAT3 tyrosine phosphorylation and nuclear translocation in human lymphocytes. J Biol Chem. 1999;25:17580-17586.

44. Abe J, Berk BC. Fyn and JAK2 mediate Ras activation by reactive oxygen species. J Biol Chem. 1999;30:21003-21010.

45. Jalkanen S, Salmi M. Cell surface monoamine oxidases: enzymes in search of a function. EMBO J. 2001;20:3893-3901[CrossRef][Medline] [Order article via Infotrieve].

46. Salmi M, Jalkanen S. VAP-1: an adhesin and an enzyme. Trends Immunol. 2001;22:211-216[CrossRef][Medline] [Order article via Infotrieve].

47. Thompson JD, Higgins DG, Gibson TJ, Clustal W. Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994;22:4673-4680[Abstract/Free Full Text].

© 2003 by The American Society of Hematology.
 

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
BloodHome page
S. H. Cho, S. Goenka, T. Henttinen, P. Gudapati, A. Reinikainen, C. M. Eischen, R. Lahesmaa, and M. Boothby
PARP-14, a member of the B aggressive lymphoma family, transduces survival signals in primary B cells
Blood, March 12, 2009; 113(11): 2416 - 2425.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M.-L. Boulland, J. Marquet, V. Molinier-Frenkel, P. Moller, C. Guiter, F. Lasoudris, C. Copie-Bergman, M. Baia, P. Gaulard, K. Leroy, et al.
Human IL4I1 is a secreted L-phenylalanine oxidase expressed by mature dendritic cells that inhibits T-lymphocyte proliferation
Blood, July 1, 2007; 110(1): 220 - 227.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
I. S. Lossos
Molecular Pathogenesis of Diffuse Large B-Cell Lymphoma
J. Clin. Oncol., September 10, 2005; 23(26): 6351 - 6357.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
F. Feuerhake, J. L. Kutok, S. Monti, W. Chen, A. S. LaCasce, G. Cattoretti, P. Kurtin, G. S. Pinkus, L. de Leval, N. L. Harris, et al.
NF{kappa}B activity, function, and target-gene signatures in primary mediastinal large B-cell lymphoma and diffuse large B-cell lymphoma subtypes
Blood, August 15, 2005; 106(4): 1392 - 1399.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H. Tagawa, S. Tsuzuki, R. Suzuki, S. Karnan, A. Ota, Y. Kameoka, M. Suguro, K. Matsuo, M. Yamaguchi, M. Okamoto, et al.
Genome-Wide Array-Based Comparative Genomic Hybridization of Diffuse Large B-Cell Lymphoma: Comparison between CD5-Positive and CD5-Negative Cases
Cancer Res., September 1, 2004; 64(17): 5948 - 5955.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. Guiter, I. Dusanter-Fourt, C. Copie-Bergman, M.-L. Boulland, S. le Gouvello, P. Gaulard, K. Leroy, and F. Castellano
Constitutive STAT6 activation in primary mediastinal large B-cell lymphoma
Blood, July 15, 2004; 104(2): 543 - 549.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. J. Savage, S. Monti, J. L. Kutok, G. Cattoretti, D. Neuberg, L. de Leval, P. Kurtin, P. D. Cin, C. Ladd, F. Feuerhake, et al.
The molecular signature of mediastinal large B-cell lymphoma differs from that of other diffuse large B-cell lymphomas and shares features with classical Hodgkin lymphoma
Blood, December 1, 2003; 102(12): 3871 - 3879.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
A. Rosenwald, G. Wright, K. Leroy, X. Yu, P. Gaulard, R. D. Gascoyne, W. C. Chan, T. Zhao, C. Haioun, T. C. Greiner, et al.
Molecular Diagnosis of Primary Mediastinal B Cell Lymphoma Identifies a Clinically Favorable Subgroup of Diffuse Large B Cell Lymphoma Related to Hodgkin Lymphoma
J. Exp. Med., September 15, 2003; 198(6): 851 - 862.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2002-07-2215v1
101/7/2756    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Copie-Bergman, C.
Right arrow Articles by Leroy, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Copie-Bergman, C.
Right arrow Articles by Leroy, K.
Related Collections
Right arrow Neoplasia
Right arrow Signal Transduction
Right arrow Gene Expression
Right arrow Genomics
Right arrow Clinical Trials and Observations
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2003 by American Society of Hematology         Online ISSN: 1528-0020