| |
|
|
|
|
|
|
|||
|
Prepublished online as a Blood First Edition Paper on November 21, 2002; DOI 10.1182/blood-2002-07-2215.
NEOPLASIA
From the Département de Pathologie, the Service
d'Immunologie Biologique, and the Service d'Hématologie
Clinique, EA2348, AP-HP, Hôpital Henri Mondor, Créteil,
France; the Institute of Pathology, University of Ulm,
Germany; the Department of Pathology, University of
Leicester, United Kingdom; and the Département
d'Hématologie of Institut Cochin, Maternité Port-Royal,
Paris, France.
The molecular markers that distinguish primary mediastinal large
B-cell lymphoma (PMBL) from nonmediastinal diffuse large B-cell
lymphomas (NM-DLBLs) remain to be identified. Using cDNA representational difference analysis to compare PMBL and NM-DLBL transcripts, we isolated a cDNA fragment homologous to the
mouse B-cell interleukin 4 (IL-4)-inducible gene FIG1
(interleukin 4-induced gene 1) transcript. The human FIG1
mRNA encodes a 567 amino acid protein that comprises a signal peptide
and a large flavin-binding amino oxidase domain, and shares significant
homology with secreted apoptosis-inducing L-amino acid oxidases.
Northern blot studies showed that FIG1 mRNA expression is
mainly restricted to lymphoid tissues. It is expressed at low levels in
thymus, spleen, tonsils, and reactive lymph nodes, and is
highly up-regulated in IL-4+CD40-activated tonsillar B cells.
Interestingly, in human B-cell lines, FIG1 mRNA expression
appeared restricted to the PMBL-derived MedB-1 and Karpas 1106 cell
lines. Using real-time reverse transcriptase-polymerase chain reaction (RT-PCR), we demonstrated that all but one PMBL (16/17)
displayed high FIG1 mRNA levels, whereas most
NM-DLBLs (12/18) and all low-grade B-cell lymphomas tested (8/8)
exhibited low FIG1 mRNA levels. The difference between
PMBLs and NM-DLBLs was statistically significant (Fisher test;
P = .0003). Southern blot studies did not show
rearrangement of the FIG1 gene. FIG1 gene
expression might be due to a constitutive activation of a cytokine
signaling pathway in PMBL.
(Blood. 2003;101:2756-2761) In the past 10 years, there has been increasing
evidence that primary mediastinal large B-cell lymphoma (PMBL) harbors
unique clinical, pathologic, and immunohistochemical features. This
disease is now recognized as a specific lymphoma subtype among diffuse large B-cell lymphomas (DLBLs) in the World Health Organization (WHO)
classification.1 PMBL accounts for about 5% of aggressive lymphomas, tends to affect a relatively young population (average age
37 years), and presents a 50% to 60% 5-year failure-free survival rate despite intensive chemotherapy.2 It is characterized
by a rapidly growing mass, developing in the anterior upper
mediastinum, consisting of large B cells that usually express little if
any surface or cytoplasmic immunoglobulin and often lack major
histocompatibility complex (MHC) class I and/or class II
molecules.3-5 It is now assumed that PMBL derives from a
peculiar population of thymic medullary B cells.6,7
Attempts to assign PMBL precursor B cells to a specific developmental
stage have led to controversial views.8,9 However, recent
data based on immunoglobulin gene analysis suggest that PMBL is of
post-germinal center origin.10
Although the clinical and pathologic characteristics of PMBL are now
well recognized, a tumor-specific gene expression profile and specific
chromosomal translocations have not yet been reported. This may be
explained by the rarity of the disease and the difficulty to obtain
fresh material for molecular studies. BCL2 and
BCL6 rearrangements usually observed in DLBL appear to be
rare in PMBL.11,12 Comparative genomic hybridization
studies have reported frequent overrepresentations of genomic segments
of chromosome 9p, Xq, 12q, and 2p.13,14 Several candidate
genes have been proposed, among which are the proto-oncogene
c-REL and the Janus kinase 2 (JAK2)
gene,15 but still, none of them has been specifically assigned to PMBL lymphomagenesis.
Hence, more accurate PMBL gene expression profiling appears necessary
not only to improve diagnosis and treatment, but also to understand the
molecular alterations involved in the pathogenesis of this particular
lymphoma subtype. In a recent study, we used differential display
reverse transcription to compare the mRNAs expressed in PMBL with those
expressed in nonmediastinal DLBLs (NM-DLBLs).16 We
identified the MAL gene as a distinct molecular marker of
PMBL. The MAL gene is normally expressed in lymphoid T
cells, polarized epithelial cells, and myelin-forming
cells.17-19 It encodes a proteolipid believed to
participate in membrane microdomains stabilization, intracellular
transport, and signaling.20,21 Its expression in PMBL may
modify raft dynamics and contribute to neoplastic transformation.
To extend PMBL gene expression profile analysis, we used
representational difference analysis (RDA) to isolate genes that are
differentially expressed in PMBL versus NM-DLBL. In this report, we
describe the identification of a gene that is frequently activated in
PMBL and is the human homologue of the mouse immediate-early interleukin 4 (IL-4)-inducible gene FIG1 (interleukin
4-induced gene 1).22
Tissue specimens and cell lines
Normal and reactive lymphoid tissues were used as a control. These
included one tonsil from a child with follicular hyperplasia; 3 lymph
node biopsies showing benign follicular hyperplasia; one spleen
obtained from a patient with autoimmune disorder; and one thymus
removed at necropsy from a 40-week-gestation fetus. All specimens were
received fresh, and samples were snap frozen or processed immediately.
Highly purified B cells were obtained from tonsillar cell
suspensions by positive selection using CD19 magnetic microbeads (Miltenyi Biotec, Bergisch Gladbach, Germany). B cells were activated for 6 days in 25 cm2 culture flasks with irradiated (70 Gy)
transfected murine L cells expressing human CD40 ligand and 10 ng/mL
IL-4 (Sanofi, Labège, France). Activated B cells were more than
98% CD19+, CD80+, and CD86+.
B-cell lines used in this study included the B-cell precursor
acute lymphoblastic leukemia (ALL) cell lines RS 4:11, Nalm6, Nalm16, and 697; the Burkitt lymphoma cell line Ramos; the RL lymphoma
cell line bearing a t(14;18) translocation; and 2 cell lines derived
from patients with PMBL in relapse, Karpas 1106 and
MedB-1.23,24 Other hematopoietic (Jurkat, SUDHL1, Peer and
DU528 T-cell lines, HEL erythro-megakaryocytic cell line) and
nonhematopoietic (HepG2 hepatoma cell line, MZ2 melanoma cell line, and
Hela epithelial cell line) cell lines were also studied.
Representational difference analysis subtraction and screening
Northern blot analysis Total RNA was isolated using TRIzol reagent. Total RNA (5 µg) was fractionated in a 1% agarose gel containing formaldehyde and transferred to Hybond-N+ membranes (Amersham Biosciences, Orsay, France). Hybridization was performed in Quick Express Hyb solution (Clontech Laboratories, Palo Alto, CA) with an -32P-labeled human FIG1 RDA fragment or a
-actin control probe (Clontech Laboratories) according to
the manufacturer's protocol.
DNA sequencing Plasmid DNA and PCR products were Taq cycle sequenced using the Applied Biosystems PRISM ready reaction Dye-dideoxy Terminator and Dye-Primer sequencing kits (Applied Biosystems, Courtaboeuf, France) and samples run on an ABI 377 DNA sequencer (Applied Biosystems).Quantitative RT-PCR analysis Total RNA (2 µg) was reverse transcribed with Superscript II (Life Technologies) in a final volume of 20 µL containing 300 ng random hexamers, according to the manufacturer's instructions. Following enzyme heat inactivation, cDNA was diluted 1:5 in water and stored at 20°C. FIG1 mRNA levels were measured by
real-time quantitative reverse transcription-polymerase chain reaction
(RT-PCR) using the Light Cycler (Roche Diagnostics, Meylan, France)
technology and normalized to the ribosomal S14 mRNA values
to control for RNA quality and reverse transcription efficiency. For
each real-time PCR run, cDNA was run in duplicate in parallel with 8 standard dilution samples and Karpas 1106 cDNA. FIG1 and
S14 standards were purified PCR products that were sequenced
and quantitated using a Genequant spectrophotometer (Amersham
Biosciences). Karpas 1106 cDNA was included in each PCR run to control
for PCR reproducibility among runs and allow relative expression to be
compared across all the tested samples. PCRs were performed in Light
Cycler capillaries, in a 20 µL volume containing 2 µL Light
Cycler-FastStart DNA Master SYBR Green I mix (Roche Diagnostics), 4 mM
final MgCl2 concentration, 0.5 µM FIG1 sense and antisense
primers (FIG1 sense: 5' TATGTGGTGGAGAAGGTG 3',
FIG1 antisense: 5' ATGCGGCTGTACTGGAGTC 3', purchased from Eurogentec, Serain, Belgium), or 0.2 µM S14 sense and
antisense primers (S14 sense: 5' GGCAGACCGAGATGAATCCTCA 3',
S14 antisense: 5' CAGGTCCAGGGGTCTTGGTCC 3', purchased from
Biotez GmbH, Berlin, Germany), and 2 µL cDNA diluted 1:3
(corresponding to 13 ng RNA). After preincubation and DNA denaturation
at 95°C for 8 minutes, 40 cycles of amplification (95°C for
10 seconds, 62°C for 5 seconds for FIG1, or 65°C for 5 seconds for S14, 72°C for 15 seconds) were performed and
PCR products were further denatured at 95°C, annealed at 70°C, and
slowly heated to 95°C to perform a melting curve analysis.
FIG1/S14 mRNA ratios were determined as mean FIG1 value / mean S14 value × 100.
Statistical analysis To test the differences between PMBL and NM-DLBL, we compared the FIG1/S14 mRNA ratios between these 2 categories of lymphomas using a Fisher exact test and a Mann-Whitney U test (Statview software; Abacus Concepts, Berkeley, CA).DNA extraction and Southern blot analysis DNA was extracted from MedB-1 and Ramos cells, from 5 PMBL and 5 NM-DLBL tumor samples, by proteinase K digestion, phenol/chloroform extraction, and ethanol precipitation.26 After digestion with EcoRI, DNA fragments were electrophoresed in a 0.8% agarose gel in TAE buffer (40 mM Tris-acetate,1 mM EDTA, pH 8.3) and transferred onto a nylon N+ membrane (Amersham Biosciences). Hybridization was performed in Quick Express Hyb Solution (Clontech) with an -32P-labeled FIG1 probe, spanning
nucleotide 444 to 852 of FIG1 cDNA (according to AF 293462).
RDA identification of differential cDNA fragments RNA isolated from 5 PMBL and 5 NM-DLBL cases was pooled to generate the tester (PMBL) and driver (NM-DLBL) cDNA representations. After 2 rounds of subtractive hybridization and selective PCR amplification, the second difference product, DP2, showed several distinct bands that were resolved in an acrylamide gel (data not shown). Each of these bands was eluted from the gel and cloned into a pBluescript II KS plasmid. Inserts from these clones were used as probes to hybridize Southern blots of initial tester and driver representations, and sequenced when differentially expressed. We found that 14 DpnII fragments originating from 9 different genes were differentially expressed in PMBL versus NM-DLBL cDNA representations (Table 1).
Some of these genes, such as elongation factor 2 on chromosome 19pter-q12, and both complement C1r and CD163 on 12p13, were located in chromosomal regions showing frequent gains in PMBL.27,28 One of these fragments was homologous to the mouse interleukin
4-induced gene 1, identified as an IL-4 immediate-early response gene
in splenocytes.22 Specific and recurrent expression of the
human FIG1 mRNA in PMBL was studied by Northern blot
analysis. The FIG1 RDA fragment hybridized with 1.9-kb
transcripts, which were highly expressed in the 5 original PMBLs but
low or undetectable in the 5 original NM-DLBLs (Figure
1).
Structural features of human FIG1 cDNA and protein Human FIG1 cDNA sequence was determined by sequencing overlapping RT-PCR, 5'RACE, and 3'RACE fragments, and alignment of these sequences with the RDA fragment and human expressed sequence tags of the Unigene cluster Hs.380 444. The consensus sequence obtained comprised 1781 nucleotides (nt) and was identical to the sequence recently submitted to GenBank by Chu et al, except for a shorter 5' end ( 16 nt).29 This sequence
exhibited an open reading frame (ORF) of 1701 nt, with an ATG start
codon lying in a strong Kozak context (RnnatgG).30 The 3'
untranslated region of FIG1 was very short, the stop codon
being located within the variant polyadenylation signal ATTAAA (data
not shown).31 Alignment of the human cDNA sequences on the
human genome revealed that the human gene is located within a small
region (7 kilobase [kb]) of chromosome 19q13.33, and is composed of 8 exons, showing an exon/intron organization identical to the mouse gene.
Human FIG1 cDNA encodes a 567 amino acid (aa) protein that
contains 4 potential N-glycosylation sites, several potential protein kinase C, casein kinase II, tyrosine kinase, and cyclic adenosine monophosphate/cyclic guanosine monophosphate (cAMP/cGMP) protein kinase
phosphorylation sites, and 5 N-myristoylation sites. This protein
presents a putative signal peptide (aa 1-22) and a large flavin binding
amino-oxidase domain (aa 78-505; Figure
2). Human FIG1 protein is 80% homologous
to the mouse FIG1 protein in its 505 aa N-terminal part and completely
divergent in its 62 aa C-terminal part. Interestingly, human and mouse
FIG1 proteins show significant homology with the fish endoplasmic
reticulum lumenal L-amino acid oxidase (ERL-LAO, also named AIP for
apoptosis-inducing protein) and the snake venom Apoxin 1 (41%
and 33% identity, respectively; Figure 2), which both possess an
L-amino acid oxidase enzymatic activity and induce apoptosis through
H2O2 production.32-34
FIG1 mRNA expression pattern in normal human tissues and transformed cell lines In nonhematopoietic tissues, FIG1 transcripts were not detected in prostate, ovary, small intestine, and colon, but the FIG1 RDA probe hybridized with abundant 2.4-kb transcripts in the testis (Figure 3A). In normal lymphoid tissues, FIG1 transcripts were detected at very low levels in the thymus, spleen, tonsil, reactive lymph nodes, and resting tonsillar B cells (Figure 3B). As originally described in mice and recently in humans,22,29 RT-PCR experiments showed that FIG1 RNA is induced by IL-4 alone in tonsillar B cells (data not shown). Its expression was highly up-regulated when tonsillar B cells were activated with both IL-4 and CD40 ligand (Figure 3B).
We then studied FIG1 mRNA expression in a panel of human cell lines (Figure 3C). In B-cell lines, FIG1 transcripts were exclusively seen in the PMBL-derived B-cell lines Karpas 1106 and MedB-1, the latter showing a very high level of FIG1 mRNA expression. FIG1 mRNA expression was not detected in pro-B- (RS 4:11, Nalm16), pre-B- (697, Nalm6), Burkitt (Ramos), and the t(14;18) positive RL cell lines. Other hematopoietic (Jurkat, SUDHL1, Peer, DU528, HEL) and nonhematopoietic (HepG2, MZ2, Hela) cell lines were negative for FIG1 expression (data not shown). FIG1 mRNA expression in lymphoid malignancies FIG1 mRNA expression was first analyzed by Northern blot in a limited series of different low- and high-grade B-cell lymphoma entities. We selected for this analysis representative cases of lymphomas ranging from naïve B-cell-derived lymphomas to post-germinal center B-cell-derived lymphomas for which frozen material was available. This series included 2 chronic lymphocytic leukemias (CLLs), 2 mantle cell lymphomas (MCL), 2 Burkitt lymphomas (Bkt), 2 follicular lymphomas (FL), 2 marginal zone lymphomas (MZLs), 2 PMBLs, 4 NM-DLBLs including 2 NM-DLBLs used in the initial RDA experiments, and 2 plasmablastic lymphomas (PL-DLBLs). As shown in Figure 4A, FIG1 mRNA was highly expressed in PMBL and weakly expressed in the other B-cell lymphomas tested.
We then performed real-time quantitative RT-PCR analysis of
FIG1 gene expression in the normal and neoplastic samples
used in Northern blot experiments. We found that the
FIG1/S14 mRNA ratios evaluated with this technique were
parallel to the level of expression observed in Northern blot analysis.
Normal lymphoid tissues (spleen, thymus, lymph nodes) displayed
FIG1/S14 mRNA ratios inferior or equal to 10. The
FIG1/S14 mRNA ratio was equal to 1 in purified tonsillar B
cells and increased to 40 after IL-4+CD40L stimulation.
FIG1/S14 mRNA ratios varied from 12 to 101 in the 5 original
PMBLs and were less than 10 in the 5 original NM-DLBLs. All other
B-cell lymphomas tested displayed FIG1/S14 mRNA ratios less
than 10. We therefore decided to use a FIG1/S14 mRNA cutoff ratio of 10 to distinguish 2 categories of samples: those with high
FIG1 gene expression (FIG1/S14 mRNA ratio > 10) and those with low FIG1 mRNA levels (FIG1/S14
mRNA ratio We then extended our analysis to a larger series of 17 cases of PMBL and 18 cases of NM-DLBL, including the 5 PMBLs and 5 NM-DLBLs used in the RDA experiment. All but one PMBL (16/17) displayed high FIG1 gene expression, whereas most NM-DLBLs (12/18) exhibited low FIG1 mRNA levels (Figure 4B). Among the NM-DLBLs with high FIG1 mRNA levels, 5 were peculiar, because of extranodal origin (one spleen, one skin), suspected origin from the transformation of a follicular and marginal zone lymphoma, respectively (2 cases), or Epstein-Barr virus (EBV) association (one case). The difference between the PMBL and NM-DLBL groups proved significant (Fisher exact test based on the 2 category grading; P = .0003). Moreover, comparison of FIG1/S14 mRNA ratio as a continuous variable in PMBL versus NM-DLBL also demonstrated a significant difference (Mann-Whitney U test, P = .014). Southern blot analysis of FIG1 gene To study whether genomic rearrangements might account for FIG1 gene expression in PMBL, DNAs were extracted from PMBL and NM-DLBL tumor samples, subjected to EcoRI digestion, and analyzed by Southern blot. The blot was hybridized with a FIG1 PCR-generated probe spanning exons 5, 6, and 7. This probe hybridized with the expected 10-kb and 4.5-kb DNA fragments in all PMBL and NM-DLBL tumor samples, as well as in the MedB-1 and the Ramos B-cell lines (Figure 5). Hence, the increased expression of FIG1 mRNA in PMBL did not result from major genetic alterations. Furthermore, the signals correlated with the amount of DNA loaded in each lane, thereby ruling out overexpression related to gain of chromosomal material.
Using cDNA representational difference analysis, we
identified the FIG1 mRNA as being regularly expressed in
PMBL but rarely in NM-DLBL. FIG1 was initially identified in
the mouse as an immediate-early IL-4-inducible gene in B
splenocytes.22 This B-cell-specific gene was shown to be
induced in resting cells within 2 hours in response to IL-4 alone, but
not to IL-2, IL-5, or IL-6. This induction was recently demonstrated to
be STAT6 dependent.35 We have shown by Northern blot and
quantitative RT-PCR the high expression of FIG1 in
IL-4-activated human B-cells, in the PMBL-derived B-cell lines MedB-1
and Karpas 1106, and in PMBL as compared with other types of B-cell
lymphomas. Since genomic amplification of the FIG1 gene in
PMBL was ruled out by Southern blot analysis, these results point to a
possible role of the IL-4 signaling pathway in PMBL lymphomagenesis. It
was recently reported that IL-4 activation of the MedB-1 B-cell line
induced down-regulation of IgG/ Another explanation for high FIG1 expression in PMBL could be an activation of the IL-4 signaling pathway through oncogenic events. Oncogenic activation of cytokine signaling pathways in hematopoietic malignancies has already been reported. For example, IL-13 was shown to be secreted by Hodgkin lymphoma (HL) cell lines and to be expressed in Hodgkin and Reed-Sternberg cells in HL.37 IL-13 is thus believed to promote autocrine growth of the neoplastic population in classical Hodgkin lymphoma. Interestingly, JAK2 tyrosine kinase gene is amplified in MedB-1 and was found as part of an amplicon in one case of PMBL.15 As Jak-2 has been shown to be involved in the IL-4 and IL-13 signaling pathway in some nonhematopoietic cell lines,38 one may hypothesize that FIG1 up-regulation is related to abnormal JAK2 activity in PMBL. It is also possible that FIG1 expression in PMBL merely reflects the B-lymphocyte developmental stage at which malignant transformation occurred. FIG1 gene expression is induced in activated B cells. Thus, FIG1 gene expression in PMBL would favor the hypothesis that these lymphomas belong to the activated B-cell-like DLBL group,39 as already suggested by the presence of heavily mutated immunoglobulin genes without evidence of continuing mutational activity in both lymphoma groups.40,41 The protein encoded by the FIG1 gene shares significant homology with secreted apoptosis-inducing L-amino acid oxidases such as Apoxin 1 and ERL-LAO,32-34 suggesting that FIG1 protein might be an ectoenzyme. LAOs catalyze the oxidative deamination of various L-amino acids and produce ammonium and hydrogen peroxide (H2O2). In addition to its ability to induce apoptosis, H2O2 is becoming increasingly recognized as a signal-transducing molecule and appears to be involved in a broad spectrum of signaling pathways.42-44 Furthermore, recent studies have shown that some ectoenzymes are also involved in cellular adhesion.45,46 Thus, although the functions of the protein encoded by the FIG1 gene remain to be characterized, it is tempting to speculate that FIG1 activity might somehow be involved in PMBL lymphomagenesis. In conclusion, we demonstrate in this study the high expression of the IL-4-inducible gene FIG1 in PMBL. Our data suggest that the IL-4/IL-13 pathway may be of significant importance in PMBL lymphomagenesis. Exploration of FIG1 functional properties could give more insight into the oncogenic events involved in this distinct subtype of DLBLs.
We gratefully acknowledge the following pathologists who provided pathologic material: J. Brière, I. Abd Alsamad, A. M. Roucayrol. We thank N. Nio for expert assistance in statistical analysis. We also thank J. Marquet for providing resting and activated tonsillar B cells and S. Legouvello for help in real-time PCR experiments.
Submitted July 23, 2002; accepted November 6, 2002.
Prepublished online as Blood First Edition Paper, November 21, 2002; DOI 10.1182/blood-2002-07-2215.
Supported by a grant from the Association pour la Recherche contre le Cancer (no. 5530) and by the Association pour la Recherche Thérapeutique, Génétique et Immunologique dans les Lymphomes (cofinanced by Roche and Amgen).
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Karen Leroy, Département de Pathologie, Hôpital Henri Mondor, 51 avenue du Maréchal de Lattre de Tassigny, 94010 Créteil, France; e-mail: karen.leroy{at}hmn.ap-hop-paris.fr.
1. Jaffe ES, Harris NL, Stein H, Vardiman JW. World Health Organization Classification of Tumours. Pathology and genetics of tumours of haematopoietic and lymphoid tissues. Lyon, France: IARC Press; 2001. 2. Cazals-Hatem D, Lepage E, Brice P, et al. Primary mediastinal large B-cell lymphoma. A clinicopathologic study of 141 cases compared to 916 nonmediastinal large B-cell lymphomas, a GELA study. Am J Surg Pathol. 1996;20:877-888[CrossRef][Medline] [Order article via Infotrieve].
3.
Van Besien K, Kelta M, Bahaguna P.
Primary mediastinal B-cell lymphoma: a review of pathology and management.
J Clin Oncol.
2001;19:1855-1864 4. Kanavaros P, Gaulard P, Charlotte F, et al. Discordant expression of immunoglobulin and its associated molecule mb-1/CD79a is frequently found in mediastinal large B-cell lymphomas. Am J Pathol. 1995;146:735-741[Abstract]. 5. Möller P, Lammler B, Hermann B, Otto HF, Moldenhauer G, Momburg F. The primary mediastinal clear cell lymphoma of B-cell type has variable defects in MHC antigen expression. Immunology. 1986;59:411-417[Medline] [Order article via Infotrieve]. 6. Isaacson PG, Norton AJ, Addis BJ. the human thymus contains a novel population of B lymphocytes. Lancet. 1987;2:1488-1491[Medline] [Order article via Infotrieve]. 7. Hofmann WJ, Momburg F, Möller P. Thymic medullary cells expressing B cell antigens. Hum Pathol. 1988;19:1280-1287[Medline] [Order article via Infotrieve].
8.
Möller P, Moldenhauer G, Momburg F, et al.
Mediastinal lymphoma of clear cell type is a tumor corresponding to terminal steps of B cell differentiation.
Blood.
1987;69:1087-1095 9. De Leval L, Ferry JA, Falini B, Shipp M, Harris NL. Expression of bcl-6 and CD10 in primary mediastinal large B-cell lymphoma. Evidence for derivation from germinal center B cells? Am J Surg Pathol. 2001;25:1277-1282[CrossRef][Medline] [Order article via Infotrieve].
10.
Leithäuser F, Bäuerle M, Quang Huynh M, Möller P.
Isotype-switched immunoglobulin genes with a high load of somatic hypermutation and lack of ongoing mutational activity are prevalent in mediastinal B-cell lymphoma.
Blood.
2001;98:2762-2770 11. Tsang P, Cesarman E, Chadburn A, Liu YF, Knowles DM. Molecular characterization of primary mediastinal B cell lymphoma. Am J Pathol. 1996;148:2017-2025[Abstract].
12.
Capello D, Vitolo U, Pasqualucci L, et al.
Distribution and pattern of BCL-6 mutations throughout the spectrum of B-cell neoplasia.
Blood.
2000;95:651-659
13.
Joos S, Otano-Joos MI, Ziegler S, et al.
Primary mediastinal (thymic) B-cell lymphoma is characterized by gains of chromosomal material including 9p and amplification of the REL gene.
Blood.
1996;87:1571-1578 14. Scarpa A, Taruscio D, Scardoni M, et al. Nonrandom chromosomal imbalances in primary mediastinal B-cell lymphoma detected by arbitrarily primed PCR fingerprinting. Genes Chromosomes Cancer. 1999;26:203-209[CrossRef][Medline] [Order article via Infotrieve].
15.
Joos S, Küpper M, Ohl S, et al.
Genomic imbalances including amplification of the tyrosine kinase gene JAK2 in CD30+ Hodgkin cells.
Cancer Res.
2000;60:549-552
16.
Copie-Bergman C, Gaulard P, Maouche-Chrétien L, et al.
The MAL gene is expressed in primary mediastinal large B-cell lymphoma.
Blood.
1999;94:3567-3575
17.
Alonso MA, Weissman SM.
cDNA cloning and sequence of MAL, a hydrophobic protein associated with human T-cell differentiation.
Proc Natl Acad Sci U S A.
1987;84:1997-2001 18. Schaeren-Wiemers N, Valenzuela DM, Frank M, Schwab ME. Characterization of a rat gene, rMAL, encoding a protein with four hydrophobic domains in central and peripheral myelin. J Neurosci. 1995;15:5753-5764[Abstract].
19.
Martin-Belmonte F, Kremer L, Albar JP, Marazuela M, Alonso MA.
Expression of the MAL gene in the thyroid: the MAL proteolipid, a component of glycolipid-enriched membranes, is apically distributed in thyroid follicles.
Endocrinology.
1998;139:2077-2084 20. Millán J, Alonso MA. MAL, a novel integral membrane protein of human T lymphocytes, associates with glycosylphosphatidylinositol-anchored proteins and Src-like tyrosine kinases. Eur J Immunol. 1998;28:3675-3684[CrossRef][Medline] [Order article via Infotrieve]. 21. Alonso MA, Millán J. The role of lipid rafts in signalling and membrane trafficking in T lymphocytes. J Cell Sci. 2001;114:3957-3965[Medline] [Order article via Infotrieve].
22.
Chu CC, Paul WE.
FIG1, an interleukin 4-induced mouse B-cell gene isolated by cDNA representational difference analysis.
Proc Natl Acad Sci U S A.
1997;94:2507-2512 23. Möller P, Bruderlein S, Strater J, et al. MedB-1, a human tumor cell line derived from a primary mediastinal large B-cell lymphoma. Int J Cancer. 2001;92:348-353[CrossRef][Medline] [Order article via Infotrieve].
24.
Nacheva E, Dyer MJ, Metivier C, et al.
B-cell non-Hodgkin's lymphoma cell line (Karpas 1106) with complex translocation involving 18q21.3 but lacking BCL2 rearrangement and expression.
Blood.
1994;84:3422-3428
25.
Hubank M, Schatz DG.
Identifying differences in mRNA expression by representational difference analysis of cDNA.
Nucleic Acids Res.
1994;22:5640-5648 26. Sambrook J, Fritsh EF, Maniatis F. Isolation of high molecular weight DNA from mammalian cells Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory; 1989:9-14. 27. Bentz M, Barth TFE, Brüderlein S, et al. Gain of chromosome arm 9p is characteristic of primary mediastinal B-cell lymphoma (MBL): comprehensive molecular cytogenetic analysis and presentation of a novel MBL cell line. Genes Chromosomes Cancer. 2001;30:393-401[CrossRef][Medline] [Order article via Infotrieve]. 28. Palanisamy N, Abou-Elella AA, Chaganti SR, et al. Similar patterns of genomic alterations characterize primary mediastinal large-B-cell lymphoma and diffuse large-B-cell lymphoma. Genes Chromosomes Cancer. 2002;33:114-122[CrossRef][Medline] [Order article via Infotrieve]. 29. Chavan SS, Tian W, Hsueh K, et al. Characterization of the human homolog of the IL-4 induced gene-1 (Fig1). Biochim Biophys Acta. 2002;1576:70-80[Medline] [Order article via Infotrieve]. 30. Kozak M. Interpreting cDNA sequences: some insights from studies on translation. Mammalian Genome. 1996;7:563-574[CrossRef][Medline] [Order article via Infotrieve].
31.
Beaudoing E, Freier S, Wyatt JR, Claverie JM, Gautheret D.
Patterns of variant polyadenylation signal usage in human genes.
Genome Res.
2000;10:1001-1010
32.
Jung SK, Mai A, Iwamoto M, Fujimoto D, Sakamaki K, Yonehara S.
Purification and cloning of an apoptosis-inducing protein derived from fish infected with Anisakis simplex, a causative nematode of human Anisiakis.
J Immunol.
2000;165:1491-1497 33. Raibekas AA, Massey V. Primary structure of the snake venom L-amino acid oxidase shows high homology with the mouse B cell interleukin 4-induced Fig1 protein. Biochem Biophys Res Commun. 1996;224:134-139[CrossRef][Medline] [Order article via Infotrieve]. 34. Torii S, Yamane K, Mashima T, et al. Molecular cloning and functional analysis of Apoxin I, a snake venom-derived apoptosis-inducing factor with L-amino acid oxidase activity. Biochemistry. 2000;39:3197-3205[CrossRef][Medline] [Order article via Infotrieve].
35.
Schroder AJ, Pavlidis P, Arimura A, Capece D, Rothman PB.
Cutting edge: STAT6 serves as positive and negative regulator of gene expression in IL-4 stimulated B lymphocytes.
J Immunol.
2002;168:996-1000 36. Nelms K, Keegan AD, Zamorano J, Ryan JJ, Paul WE. The IL-4 receptor: signaling mechanisms and biologic functions. Annu Rev Immunol. 1999;17:701-738[CrossRef][Medline] [Order article via Infotrieve].
37.
Skinnider BF, Elia AJ, Gascoyne RD, et al.
Interleukin 13 and interleukin 13 receptor are frequently expressed by Hodgkin and Reed-Sternberg cells of Hodgkin lymphoma.
Blood.
2001;97:250-255 38. Murata T, Noguchi PD, Puri RK. IL-13 induces phosphorylation and activation of JAK2 Janus kinase in human colon carcinoma cell lines: similarities between IL-4 and IL-13 signaling. J Immunol. 1996;156:2972-2978[Abstract]. 39. Alizadeh AA, Eisen MB, Davis RE, et al. Distinct types of diffuse large B-cell lymphoma identified by gene expression profiling. Nature. 2000;403:503-511[CrossRef][Medline] [Order article via Infotrieve].
40.
Lossos IS, Alizadeh AA, Eisen MB, et al.
Ongoing immunoglobulin somatic mutation in germinal center B cell-like but not in activated B cell-like diffuse large cell lymphomas.
Proc Natl Acad Sci U S A.
2000;97:10209-10213 41. Barth TFE, Leithäuser F, Joos S, Bentz M, Möller P. Mediastinal (thymic) large B-cell lymphoma: where do we stand? Lancet Oncol. 2002;3:229-234[CrossRef][Medline] [Order article via Infotrieve]. 42. Bodgan C, Röllinghoff M, Diefenbach A. Reactive oxygen and reactive nitrogen intermediates in innate and specific immunity. Curr Opin Immunol. 2000;12:64-76[CrossRef][Medline] [Order article via Infotrieve]. 43. Carballo M, Conde M, Bekay RE, et al. Oxidative stress triggers STAT3 tyrosine phosphorylation and nuclear translocation in human lymphocytes. J Biol Chem. 1999;25:17580-17586. 44. Abe J, Berk BC. Fyn and JAK2 mediate Ras activation by reactive oxygen species. J Biol Chem. 1999;30:21003-21010. 45. Jalkanen S, Salmi M. Cell surface monoamine oxidases: enzymes in search of a function. EMBO J. 2001;20:3893-3901[CrossRef][Medline] [Order article via Infotrieve]. 46. Salmi M, Jalkanen S. VAP-1: an adhesin and an enzyme. Trends Immunol. 2001;22:211-216[CrossRef][Medline] [Order article via Infotrieve].
47.
Thompson JD, Higgins DG, Gibson TJ, Clustal W.
Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice.
Nucleic Acids Res.
1994;22:4673-4680
© 2003 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
S. H. Cho, S. Goenka, T. Henttinen, P. Gudapati, A. Reinikainen, C. M. Eischen, R. Lahesmaa, and M. Boothby PARP-14, a member of the B aggressive lymphoma family, transduces survival signals in primary B cells Blood, March 12, 2009; 113(11): 2416 - 2425. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-L. Boulland, J. Marquet, V. Molinier-Frenkel, P. Moller, C. Guiter, F. Lasoudris, C. Copie-Bergman, M. Baia, P. Gaulard, K. Leroy, et al. Human IL4I1 is a secreted L-phenylalanine oxidase expressed by mature dendritic cells that inhibits T-lymphocyte proliferation Blood, July 1, 2007; 110(1): 220 - 227. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. S. Lossos Molecular Pathogenesis of Diffuse Large B-Cell Lymphoma J. Clin. Oncol., September 10, 2005; 23(26): 6351 - 6357. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Feuerhake, J. L. Kutok, S. Monti, W. Chen, A. S. LaCasce, G. Cattoretti, P. Kurtin, G. S. Pinkus, L. de Leval, N. L. Harris, et al. NF{kappa}B activity, function, and target-gene signatures in primary mediastinal large B-cell lymphoma and diffuse large B-cell lymphoma subtypes Blood, August 15, 2005; 106(4): 1392 - 1399. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Tagawa, S. Tsuzuki, R. Suzuki, S. Karnan, A. Ota, Y. Kameoka, M. Suguro, K. Matsuo, M. Yamaguchi, M. Okamoto, et al. Genome-Wide Array-Based Comparative Genomic Hybridization of Diffuse Large B-Cell Lymphoma: Comparison between CD5-Positive and CD5-Negative Cases Cancer Res., September 1, 2004; 64(17): 5948 - 5955. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Guiter, I. Dusanter-Fourt, C. Copie-Bergman, M.-L. Boulland, S. le Gouvello, P. Gaulard, K. Leroy, and F. Castellano Constitutive STAT6 activation in primary mediastinal large B-cell lymphoma Blood, July 15, 2004; 104(2): 543 - 549. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Savage, S. Monti, J. L. Kutok, G. Cattoretti, D. Neuberg, L. de Leval, P. Kurtin, P. D. Cin, C. Ladd, F. Feuerhake, et al. The molecular signature of mediastinal large B-cell lymphoma differs from that of other diffuse large B-cell lymphomas and shares features with classical Hodgkin lymphoma Blood, December 1, 2003; 102(12): 3871 - 3879. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Rosenwald, G. Wright, K. Leroy, X. Yu, P. Gaulard, R. D. Gascoyne, W. C. Chan, T. Zhao, C. Haioun, T. C. Greiner, et al. Molecular Diagnosis of Primary Mediastinal B Cell Lymphoma Identifies a Clinically Favorable Subgroup of Diffuse Large B Cell Lymphoma Related to Hodgkin Lymphoma J. Exp. Med., September 15, 2003; 198(6): 851 - 862. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2003 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||