|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Prepublished online as a Blood First Edition Paper on November 27, 2002; DOI 10.1182/blood-2002-03-0851.
PHAGOCYTES
From the Department of Pediatrics, Department of
Pharmacology, University of Pittsburgh, PA; the Department of
Biochemistry, University of Toronto, ON, Canada; and the
Programme in Cell Biology, Hospital for Sick Children, Toronto, ON,
Canada.
Through its Src homology 3 (SH3) and SH2 domains, the Src
kinase Lyn interacts with a small number of phosphoproteins, such as
Shc, Cbl, and Vav, which regulate cell cycle and the cytoskeleton. Using Lyn's Unique, SH3, and SH2 domains as bait in a yeast 2-hybrid screen, we isolated a novel gene product with features of a scaffolding protein. We named it Felic because it contains a domain homologous to
the tyrosine kinase Fes and the cytoskeletal protein
ezrin and forms a Lyn interaction with
the GTPase Cdc42 (Felic). Felic was expressed in
both hematopoietic and nonhematopoietic tissues. Because it represents
an alternative splice product related to the Cdc42-interacting protein
4, CIP4, we also refer to Felic as CIP4b. Felic contains an SH3
recognition site RXPXXP and multiple tyrosine residues. In insulin or
serum-stimulated HEK293 cells, Felic became tyrosine phosphorylated.
Like CIP4, Felic associated with Cdc42 in its activated form only.
Unlike CIP4, Felic does not possess a C-terminal SH3 domain.
Coprecipitation studies show that Felic bound to Lyn or activated forms
of Cdc42. Overexpression of Felic or CIP4 inhibited NIH 3T3 cell
invasiveness in a Matrigel assay. Because Lyn and Cdc42 are involved in
phagocytosis, we examined the distribution of Felic in RAW
macrophages during particle ingestion. Felic was recruited more
efficiently than CIP4 to the phagocytic cups. Altogether, these data
suggest that CIP4/Felic constitute a novel family of cytoskeletal
scaffolding proteins, integrating Src and Cdc42 pathways. The absence
of an SH3 domain in Felic provides a structural basis for functional differences.
(Blood. 2003;101:2804-2809) Extracellular signals lead to the activation of
intracelluar kinases and subsequent formation of signaling networks and
cascades, which regulate cell growth, differentiation, movement or
adhesion, and survival.1 Signaling networks rely on
proteins serving as scaffolds for molecular recruitment of adaptors,
enzymes, and substrates.2 A wide range of ligands
activates Src-related protein tyrosine kinases.3 In turn,
Src kinases associate with other proteins via Src homology 2 (SH2)-phosphotyrosine or SH3-proline interactions. Signaling cascades
involving Shc-Grb2-Ras-Erk, Cbl-PI 3-kinase, Fak-Paxillin-Tensin, or
Vav-Rac GEF are associated with Src activation.4-13
The Src-related kinase Lyn is found predominantly in B lymphocytes and
myeloid cells. Lyn Because the involvement of Lyn in growth signaling pathways is complex
and depends on the expression of its binding partners, we sought to
identify relevant binding proteins in a yeast 2-hybrid screen of a
B-cell cDNA library. A unique cDNA clone was identified and verified as
a bona fide interactor of Lyn. This cDNA encodes the tyrosine
kinase Fes and the cytoskeletal protein ezrin and forms a Lyn interaction with the GTPase
Cdc42 (Felic), a scaffolding protein that possesses
a Fes-related coiled-coil domain, homology to ezrin/moesin/radixin
(ERM), and can mediate the interaction of Lyn with the activated form
of the Cdc42 GTPase. Fc Yeast 2-hybrid screening and cloning of human cDNA
Cell culture and expression
Northern blot analysis Total RNA (20 µg) prepared by Trizol reagent was loaded onto a 1.2% agarose-formaldehyde gel, and then transferred onto Nytran nitrocellulose filter (Schleicher and Schuell, Keene, NH). In addition, human Multiple Tissue Northern Blot II was purchased from Clontech and used for Northern blotting. The hybridization probe was a randomly primed, 32P-labeled 159-base pair (bp) polymerase chain reaction (PCR) fragment of Felic (nucleotides 1328-1487 from translation start).Transfection and immunoprecipitation studies Cells were harvested 48 hours after transfection and lysed in 1% nonidet P-40 (NP40) solution containing 137 mM NaCl, 20 mM Tris, pH 7.5, 1 mM EDTA (ethylenediaminetetraacetic acid), 10% glycerol, and 10 µg/mL aprotinin, 10 µg/mL leupeptin, 2 mM phenylmethylsulfonyl fluoride (PMSF), and 2 mM NaVO3. An equivalent amount of protein lysates, as determined by Bradford assay (Bio-Rad, Hercules, CA), was subjected to immunoprecipitation with antibodies directed against Lyn, HA, or FLAG epitopes (Santa Cruz Biotechnology, Santa Cruz, CA). Immune complexes were captured with either protein A- or protein G-Sepharose (Santa Cruz Biotechnology) and washed 5 times with phosphate-buffered saline (PBS)/1% NP40. After being resuspended in 2 × Laemmli buffer and boiled for 5 minutes, the immunoprecipitated proteins were loaded onto 5% to 15% sodium dodecyl sulfate (SDS) polyacrylamide gels. After being electrophoresed, proteins were electro-transferred onto polyvinylidene fluoride (PVDF) membrane (ImmoblinP, Medford, MA). After blocking with 5% bovine serum albumin (BSA) in PBS with 0.1% Tween20, membranes were incubated with anti-HA monoclonal antibody, anti-FLAG monoclonal antibody, anti-Syk polyclonal antibody, or anti-Lyn polyclonal antibody. After washing, blots were incubated with secondary antibody, goat anti-rabbit Ig coupled to horseradish peroxidase, or goat anti-mouse Ig coupled to horseradish peroxidase (Bio-Rad). Visualization was done with enhanced chemiluminescence (Amersham, Arlington Heights, IL).Microscopic analysis of phagocytosis For phagocytic assays, sheep red blood cells (SRBCs) and 0.8-µm latex beads were opsonized as described.28 Zymosan particles were opsonized with human serum for 1 hour at 37°C. IgG-opsonized particles were then added to transfected RAW macrophages at a 10:1 ratio and incubated in cold medium for 10 minutes to allow binding. Following, the cells were incubated with warm medium for 7 to 10 minutes to allow formation of phagocytic cups, and fixed immediately with ice-cold 4% paraformaldehyde for 20 minutes and then with room temperature fixative for one hour. For phagocytosis of serum-opsonized zymosan, RAW macrophages were activated with 100 nM phorbol myristate acetate (PMA) for 20 minutes prior to phagocytosis. For immunofluorescence, cells were permeabilized with 0.1% TritonX-100 for 10 minutes, blocked with 5% donkey serum, and followed with mouse anti-HA antibody. Donkey antimouse antibody conjugated with Cy3 was from Jackson ImmunoResearch Laboratories (West Grove, PA) and used at 1:1000. Confocal microscopy and image processing was performed as described.28Matrigel invasiveness assay A 12-well BioCoat Matrigel Invasion Chamber was purchased from Becton Dickinson (San Diego, CA). Following manufacturer's directions, it was allowed to thaw at room temperature. The wells were rehydrated with Dulbecco modified Eagle medium (DMEM). Suspensions of NIH 3T3 cells transfected with either empty vector, HA-CIP4, or HA-Felic were added to the wells at 2.5 × 104 cells/mL. After 24 hours of incubation at 37°C, the cells from the upper surface of the membrane were removed. The filters were fixed and stained with 0.5% Crystal Violet (Sigma). Cover slips were prepared for cell counting and photography. Data were analyzed for statistical significance, using Microsoft Excel software (Bellingham, WA) and the Student paired t test for independent means.
Isolation and cloning of Felic To identify new binding partners for Lyn, we screened a Daudi B cell library, since Lyn plays a major role in B-cell signal transduction.28 From the B-cell library screen of more than 100 000 transformants, we isolated 17 clones that interacted with the Lyn bait, which comprised the Unique-SH3-SH2 domains of Lyn. Positives were picked and restreaked onto fresh glucose and then galactose plates. DNA was prepared from positive yeast colonies and used to transform JEB181 bacteria (which were leu-negative and thus could be rescued by the library plasmid, which encodes for -isopropylmalate dehydrogenase that is involved in leucine biosynthesis). Of the 17 clones, 6 appeared to be true interactors upon
rescreening. Automated DNA sequencing was then performed, and
4 of the 6 gave open reading frames of more than 30 amino acids. We
concentrated on sequencing the strongest positive, clone 10-1, which
consisted of 435 nucleotides. With the exception of a 29-nucleotide
insertion AGATCTGGGCCCACCCCCACCC CCATCAC, GenBank searching showed
identical sequence to a partial cDNA, thyroid hormone receptor
interactor 10, and at that time, no homology to any known proteins.
Using a different source of Daudi B cells, we performed reverse
transcriptase (RT)-PCR and 5' RACE PCR (Marathon cDNA
amplification kit). The complete cDNA consisted of 1782 nucleotides, which encoded a 593-amino acid protein of approximately 68 kDa. Using a probe consisting of clone 10-1, we examined hematopoietic and nonhematopoietic tissues. Northern blot analysis showed
transcripts of 2.3 to 2.4 kilobase (kb) and 3.3 kb in both
types of tissues (Figure 1).
Amino acid analysis of Felic and its relationship to CIP4 When the complete cDNA was isolated and sequenced, GenBank searching showed that Felic was highly homologous to CIP4. The difference between these 2 gene products was due to the 29- nucleotide insertion occurring after codon 495 of CIP4. The cDNA was named Felic, because it contains regions that are highly homologous to the amino-terminus of the nonreceptor protein tyrosine kinase Fes/Fer, to the ezrin/radixin/moesin cytoskeletal protein family and it demonstrates a Lyn interaction with activated forms of Cdc42 (Figure 2). Of note, at positions 432 to 437, RPPDPP constitutes a favored SH3 binding site (ie, PXXP) for Src SH3 domains.29,30 A second RXPXXP motif is found only in Felic at positions 310 to 315. A minimal SH3 binding site, the PXXP motif, is found again only in Felic (positions 500-505); however, Lyn does coprecipitate with CIP4 (data not shown). In addition, a proximal Arg residue favors a salt bridge with the corresponding Asp residue found in the SH3 domain of Lyn. Multiple RPXXP or RXPXXP motifs are found in the proline-rich region of Cbl, which we and others have isolated from a cDNA library with Lyn as bait in the yeast 2-hybrid screen.8,16
RT-PCR screening of Daudi B cell mRNA also yielded CIP4 clones. The cDNAs differ in that Felic contains a 29 nucleotide insertion, which occurs after codon 495. As a result of the insertional frameshift, Felic does not have a C-terminal SH3 domain, and a stop codon occurs at codon 594. Genomic cloning of the human Felic/CIP4 locus revealed that the 29 nucleotide sequence is found at the 5' end of exon 13. The isolation of both Felic and CIP4 clones from Daudi B cells and the identification of the additional nucleotides at an exonic 5' end suggested that these proteins represented alternatively spliced products of the same gene. Southern blot analysis of human genomic DNA, digested with 4 different restriction enzymes, showed a single band.31 In vitro association of Felic with Lyn and V12Cdc42 To confirm the yeast 2-hybrid interaction between Lyn and Felic, we constructed eukaryotic expression vectors with FLAG-tagged Felic or CIP4 and cotransfected these with full-length Lyn expression vector or wild-type, inactive, or active forms of HA-tagged Cdc42 in HEK293 cells. Coprecipitation studies showed that Lyn associated with Felic (Figure 3A). Because Felic is expressed in epithelial tissues, such as lung, ovary, and intestine where Src, not Lyn, is found,32-34 we verified that Src could also associate with Felic (Figure 3B). We also confirmed that Felic associated with the active forms of Cdc42 (V12Cdc42 and 61LCdc42) and not the GDP-bound or inactive form of Cdc42 (N17Cdc42) (Figure 3C). Increasing levels of Lyn inhibited the association of Felic with V12Cdc42, suggesting an allosteric effect (Figure 3D).
Tyrosine phosphorylation of Felic Felic contains 11 potential tyrosine phosphorylation sites. Of these, Y472 is the most likely phosphoacceptor site because the extended sequence (TPIYTEFDEDFEEE) is rich in acidic residues. To determine whether Felic is tyrosine phosphorylated, HEK293 cells were transfected with the FLAG-tagged Felic construct. After 30 hours, transfected cells were serum starved overnight, and then stimulated with 10% FCS or 100 ng/mL insulin for 15 minutes. An antiphosphotyrosine blot demonstrated stimulus-induced tyrosine phosphorylation of immunoprecipitated Felic (Figure 4).
Felic localizes to the phagocytic cup The role of Felic in regulating cytoskeletal properties is strongly suggested by the presence of the Cdc42 binding protein domain, its expression in both hematopoietic and epithelial tissues, and its ability to undergo serum-induced tyrosine phosphorylation. Felic/CIP4 also contain a region between residues 329 and 410, which displays 30% homology to the C-terminal region of ezrin/radixin/moesin (ERM), a family of proteins, that links membrane receptors to the actin cytoskeleton. Fc R-mediated phagocytosis is an actin-dependent process that appears to be regulated by Cdc42 and Src-family
kinases.22-24 Therefore, we examined the subcellular
localization of Felic and CIP4 in transfected RAW264.7 cells undergoing
phagocytosis of IgG-opsonized SRBCs. Using immunofluorescence, Felic
and CIP4 are mostly distributed to the cytoplasm in unstimulated RAW
macrophages, although it was also possible to find Felic and CIP4 in
the cell cortex. Importantly, Felic is effectively recruited to sites
of phagocytosis during particle binding and pseudopod extension (Figure 5A-B). This association, like that of
actin, is temporary since no detectable Felic was observed on formed
phagosomes (Figure 5A, asterisks). Compared with Felic, CIP4 weakly
accumulated in phagocytic cups (Figure 5C), suggesting that while Felic
and CIP4 differ only at the extreme C-terminus, this distinction may
lead to a functional difference between the 2 splice variants.
Independent of protein expression, similar results were also obtained
with green fluorescent protein (GFP)-tagged proteins of Felic and CIP4 (data not shown). Felic was also recruited to phagocytic cups containing IgG-opsonized 0.8-µm latex beads that mimic the
size of bacteria, indicating that the recruitment of Felic likely
occurs during bacterial internalization (not illustrated). Finally, the involvement of Felic in phagocytosis is not limited to Fc
receptor-mediated phagocytosis, since phagocytic cups containing
serum-opsonized zymosan, which engage complement receptors, were
enriched in Felic (Figure 5E).
Effect of Felic/CIP4 on cell invasiveness To determine whether Felic or CIP4 affects migration, we analyzed this behavior using the Matrigel-coated filter assay. NIH 3T3 cells were transfected with either empty vector as a control, HA-CIP4, or HA-Felic. Comparable levels of ectopic protein expression were seen. Following 24 hours of incubation in Matrigel, filters were fixed and analyzed. Compared with control cells, both Felic and CIP4 inhibited NIH 3T3 invasiveness, with a statistically significant greater effect for Felic (Figure 6A). Inhibition of cell migration at 48 hours was also seen in confluent NIH 3T3 cells transfected with CIP4 or Felic, which had been disturbed by pipette streaking (Figure 6B).
Here we have reported the isolation, cloning, and characterization of Felic, a novel scaffolding protein that integrates the Src and Cdc42 pathways. Felic differs from its related CIP4 isoform as a result of an out-of-frame 29-nucleotide insertion at codon 496. CIP4 was first identified as a binding partner for the activated form of Cdc42 and then for WASP.25,27 We isolated the 3' end of Felic in a yeast 2-hybrid screen using the noncatalytic portion of Lyn. Both Felic and CIP4 contain a region, corresponding to amino acids 338 to 417, that binds the activated form of Cdc42. This domain does not resemble the classic GBD or CRIB region. Furthermore, Felic and CIP4 also contain an N-terminal region, which has been found to associate with microtubules.27 A proline-rich motif, found in both Felic and CIP4 (amino acids 432-437), provides a mechanism for their interaction with Lyn. Of note, CIP4 contains a C-terminal SH3 domain, which is not found in Felic. Felic contains a unique sequence of 96 amino acids at its C-terminus. To determine any functional differences between Felic and CIP4, we studied their subcellular location in phagocytosing macrophages. Felic, but not CIP4, was recruited along with Lyn to the phagocytic cup, an early stage in phagosome formation. Because Felic was first isolated from a Daudi B cell library, Felic is probably involved uniquely in other cytoskeletal functions. Overexpression of either Felic or CIP4 inhibited the migration of 3T3 cells in Matrigel or after physical separation. We therefore propose that Felic and CIP4 constitute a family of scaffolding proteins with different roles in cytoskeletal organization. Because the SH3 domain of CIP4 binds WASP, we hypothesize that CIP4 can form a complex with Lyn, Cdc42-GTP, and WASP. Microinjection of CIP4 with its SH3 domain deleted was associated with the macrophage's inability to form podosomes, suggesting a critical role for CIP4/WASP interaction.26 In turn, Lyn can phosphorylate WASP, an event enhanced by activated Cdc42.35 While tyrosine phosphorylation of WASP has not been linked to a change in its function, binding of activated Cdc42 permits WASP to unfold, which promotes binding of Arp2/3 and subsequent actin nucleation.36,37 Since Lyn and other Src kinases phosphorylate Vav and Vav2, which results in their activation as GTP exchange factors for Rac and Cdc42,11,38 it is possible that Lyn/CIP4/WASP/Cdc42 constitute a signaling network critical for actin polymerization. The role of Felic in modifying this network or other components of a Lyn/Felic/Cdc42 network remains to be elucidated. An important clue to differences between CIP4 and Felic (CIP4b) is the presence or absence of the C-terminal SH3 domain. Interestingly, 2 additional alternative splice forms have been isolated.31 One, CIP4c, also lacks the SH3 domain, while the other, CIP4h, contains it. SH3 domains are found in a wide variety of signaling molecules. Constitutive association, albeit weak, between SH3-containing proteins and proteins containing a polyproline helix loop facilitates formation of multicomponent signaling complexes. One outcome of multicomponent signaling complexes is to direct intracellular location. Besides WASp, CIP4 can bind proline-rich c-Cbl (K. Sullivan and S.J.C., unpublished observations, May 2002). Therefore, the absence of an SH3 domain in Felic may account for its ability to traffic to the early phagosome.
We thank Drs Margaret Chou and Richard Cerione for providing us with the cDNAs for Cdc42 and Dr Ram Menon for providing bovine insulin. We thank Kevin Sullivan for additional preliminary data. R.J.B. is a recipient of a studentship from the Canadian Institutes of Health Research. A.G. is a Cure for Lymphoma Fellow. S.G. is an International Scholar of the Howard Hughes Medical Institute, a recipient of a Canadian Institute of Health Research (CIHR) Distinguished Scientist Award, and the current holder of the Pitblado Chair in Cell Biology.
Submitted March 19, 2002; accepted November 10, 2002.
Prepublished online as Blood First Edition Paper, November 27, 2002; DOI 10.1182/blood-2002-03-0851.
Supported by grants from the American Cancer Society, American Heart Association Grant-in-Aid, National Institutes of Health (NIH) FIRST Award, and NIH Independent Scientist Award to S.J.C.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Seth Corey, Section Pediatric Leukemia/Lymphoma, Division of Pediatrics, MD Anderson Cancer Center, 1515 Holcombe Blvd, Houston, TX 77030; e-mail: sjcorey{at}mdanderson.org.
1. Hunter T. Oncoprotein networks. Cell. 1997;88:333-346[CrossRef][Medline] [Order article via Infotrieve].
2.
Pawson T, Scott JD.
Signaling through scaffold, anchoring, and adaptor proteins.
Science.
1997;278:2075-2080 3. Thomas SM, Brugge JS. Cellular functions regulated by Src family kinases. Annu Rev Cell Dev Biol. 1997;13:513-609[CrossRef][Medline] [Order article via Infotrieve].
4.
McGlade J, Cheng A, Pelicci G, Pelicci PG, Pawson T.
Shc proteins are phosphorylated and regulated by the v-Src and v-Fps protein-tyrosine kinases.
Proc Natl Acad Sci U S A.
1992;89:8869-8873 5. Verderame MF, Guan JL, Woods Ignatoski KM. Transformation and pp60v-src autophosphorylation correlate with SHC- GRB2 complex formation in rat and chicken cells expressing host-range and kinase-active, transformation-defective alleles of v-src. Mol Biol Cell. 1995;6:953-966[Abstract].
6.
Sanjay A, Houghton A, Neff L, et al.
Cbl associates with Pyk2 and Src to regulate Src kinase activity, alpha(v)beta(3) integrin-mediated signaling, cell adhesion, and osteoclast motility.
J Cell Biol.
2001;152:181-195 7. Grishin A, Sinha S, Roginskaya V, et al. Involvement of Shc and Cbl-PI 3-kinase in Lyn-dependent proliferative signaling pathways for G-CSF. Oncogene. 2000;19:97-105[CrossRef][Medline] [Order article via Infotrieve]. 8. Dombrosky-Ferlan PM, Corey SJ. Yeast two-hybrid in vivo association of the Src kinase Lyn with the proto-oncogene product Cbl but not with the p85 subunit of PI 3-kinase. Oncogene. 1997;14:2019-2024[CrossRef][Medline] [Order article via Infotrieve]. 9. Sieg DJ, Ilic D, Jones KC, Damsky CH, Hunter T, Schlaepfer DD. Pyk2 and Src-family protein-tyrosine kinases compensate for the loss of FAK in fibronectin-stimulated signaling events but Pyk2 does not fully function to enhance FAK- cell migration. Embo J. 1998;17:5933-5947[CrossRef][Medline] [Order article via Infotrieve].
10.
Ye ZS, Baltimore D.
Binding of Vav to Grb2 through dimerization of Src homology 3 domains.
Proc Natl Acad Sci U S A.
1994;91:12629-12633 11. Han J, Das B, Wei W, et al. Lck regulates Vav activation of members of the Rho family of GTPases. Mol Cell Biol. 1997;17:1346-1353[Abstract].
12.
Gulbins E, Coggeshall KM, Baier G, Katzav S, Burn P, Altman A.
Tyrosine kinase-stimulated guanine nucleotide exchange activity of Vav in T cell activation.
Science.
1993;260:822-825
13.
Korade-Mirnics Z, Corey SJ.
Src kinase-mediated signaling in leukocytes.
J Leukoc Biol.
2000;68:603-613 14. Nishizumi H, Taniuchi I, Yamanashi Y, et al. Impaired proliferation of peripheral B cells and indication of autoimmune disease in lyn-deficient mice. Immunity. 1995;3:549-560[CrossRef][Medline] [Order article via Infotrieve]. 15. Hibbs ML, Tarlinton DM, Armes J, et al. Multiple defects in the immune system of Lyn-deficient mice, culminating in autoimmune disease. Cell. 1995;83:301-311[CrossRef][Medline] [Order article via Infotrieve].
16.
Tezuka T, Umemori H, Fusaki N, et al.
Physical and functional association of the cbl protooncogen product with an src-family protein tyrosine kinase, p53/56lyn, in the B cell antigen receptor-mediated signaling.
J Exp Med.
1996;183:675-680
17.
Yamanashi Y, Okada M, Semba T, et al.
Identification of HS1 protein as a major substrate of protein-tyrosine kinase(s) upon B-cell antigen receptor-mediated signaling.
Proc Natl Acad Sci U S A.
1993;90:3631-3635
18.
Satterthwaite AB, Lowell CA, Khan WN, Sideras P, Alt FW, Witte ON.
Independent and opposing roles for Btk and lyn in B and myeloid signaling pathways.
J Exp Med.
1998;188:833-844
19.
Nishizumi H, Horikawa K, Mlinaric-Rascan I, Yamamoto T.
A double-edged kinase Lyn: a positive and negative regulator for antigen receptor-mediated signals.
J Exp Med.
1998;187:1343-1348 20. Roginskaya V, Zuo S, Caudell E, Nambudiri G, Kraker AJ, Corey SJ. Therapeutic targeting of Src-kinase Lyn in myeloid leukemic cell growth. Leukemia. 1999;13:855-861[CrossRef][Medline] [Order article via Infotrieve].
21.
Corey SJ, Dombrosky-Ferlan PM, Zuo S, et al.
Requirement of Src kinase Lyn for induction of DNA synthesis by granulocyte colony-stimulating factor.
J Biol Chem.
1998;273:3230-3235
22.
Cox D, Chang P, Zhang Q, Reddy PG, Bokoch GM, Greenberg S.
Requirements for both Rac1 and Cdc42 in membrane ruffling and phagocytosis in leukocytes.
J Exp Med.
1997;186:1487-1494 23. Massol P, Montcourrier P, Guillemot JC, Chavrier P. Fc receptor-mediated phagocytosis requires CDC42 and Rac1. Embo J. 1998;17:6219-6229[CrossRef][Medline] [Order article via Infotrieve].
24.
Fitzer-Attas CJ, Lowry M, Crowley MT, et al.
Fcgamma receptor-mediated phagocytosis in macrophages lacking the Src family tyrosine kinases Hck, Fgr, and Lyn.
J Exp Med.
2000;191:669-682 25. Aspenstrom P. A Cdc42 target protein with homology to the non-kinase domain of FER has a potential role in regulating the actin cytoskeleton. Curr Biol. 1997;7:479-487[CrossRef][Medline] [Order article via Infotrieve]. 26. Linder S, Hufner K, Wintergerst U, Aepfelbacher M. Microtubule-dependent formation of podosomal adhesion structures in primary human macrophages. J Cell Sci. 2000;113:4165-4176[Abstract].
27.
Tian L, Nelson DL, Stewart DM.
Cdc42-interacting protein 4 mediates binding of the Wiskott-Aldrich syndrome protein to microtubules.
J Biol Chem.
2000;275:7854-7861 28. DeFranco AL, Chan VW, Lowell CA. Positive and negative roles of the tyrosine kinase Lyn in B cell function. Semin Immunol. 1998;10:299-307[CrossRef][Medline] [Order article via Infotrieve].
29.
Rickles RJ, Botfield MC, Zhou XM, Henry PA, Brugge JS, Zoller MJ.
Phage display selection of ligand residues important for Src homology 3 domain binding specificity.
Proc Natl Acad Sci U S A.
1995;92:10909-10913 30. Rickles RJ, Botfield MC, Weng Z, et al. Identification of Src, Fyn, Lyn, PI3K and Abl SH3 domain ligands using phage display libraries. Embo J. 1994;13:5598-5604[Medline] [Order article via Infotrieve]. 31. Wang L, Rudert WA, Grishin A, et al. Identification and genetic analysis of human and mouse activated Cdc42 interacting protein-4 isoforms. Biochem Biophys Res Commun. 2002;293:1426-1430[CrossRef][Medline] [Order article via Infotrieve]. 32. Biscardi JS, Tice DA, Parsons SJ. c-Src, receptor tyrosine kinases, and human cancer. Adv Cancer Res. 1999;76:61-119[Medline] [Order article via Infotrieve]
33.
Daulhac L, Kowalski-Chauvel A, Pradayrol L, Vaysse N, Seva C.
Src-family tyrosine kinases in activation of ERK-1 and p85/p110- phosphatidylinositol 3-kinase by G/CCKB receptors.
J Biol Chem.
1999;274:20657-20663 34. Cartwright CA, Mamajiwalla S, Skolnick SA, Eckhart W, Burgess DR. Intestinal crypt cells contain higher levels of cytoskeletal-associated pp60c-src protein tyrosine kinase activity than do differentiated enterocytes. Oncogene. 1993;8:1033-1039[Medline] [Order article via Infotrieve]. 35. Guinamard R, Aspenstrom P, Fougereau M, Chavrier P, Guillemot JC. Tyrosine phosphorylation of the Wiskott-Aldrich syndrome protein by Lyn and Btk is regulated by CDC42. FEBS Lett. 1998;434:431-436[CrossRef][Medline] [Order article via Infotrieve]. 36. Rohatgi R, Ma L, Miki H, et al. The interaction between N-WASP and the Arp2/3 complex links Cdc42-dependent signals to actin assembly. Cell. 1999;97:221-231[CrossRef][Medline] [Order article via Infotrieve].
37.
Higgs HN, Pollard TD.
Activation by Cdc42 and PIP(2) of Wiskott-Aldrich syndrome protein (WASp) stimulates actin nucleation by Arp2/3 complex.
J Cell Biol.
2000;150:1311-1320
38.
Abe K, Rossman KL, Liu B, et al.
Vav2 is an activator of Cdc42, Rac1, and RhoA.
J Biol Chem.
2000;275:10141-10149
© 2003 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  S. M. Hartig, S. Ishikura, R. S. Hicklen, Y. Feng, E. G. Blanchard, K. A. Voelker, C. S. Pichot, R. W. Grange, R. M. Raphael, A. Klip, et al. The F-BAR protein CIP4 promotes GLUT4 endocytosis through bidirectional interactions with N-WASp and Dynamin-2 J. Cell Sci., July 1, 2009; 122(13): 2283 - 2291. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. H. Roberts-Galbraith, J.-S. Chen, J. Wang, and K. L. Gould The SH3 domains of two PCH family members cooperate in assembly of the Schizosaccharomyces pombe contractile ring J. Cell Biol., January 12, 2009; 184(1): 113 - 127. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Kannan, A. Audet, H. Huang, L.-j. Chen, and M. Wu Cholesterol-Rich Membrane Rafts and Lyn Are Involved in Phagocytosis during Pseudomonas aeruginosa Infection J. Immunol., February 15, 2008; 180(4): 2396 - 2408. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. M. Bared, C. Buechler, A. Boettcher, R. Dayoub, A. Sigruener, M. Grandl, C. Rudolph, A. Dada, and G. Schmitz Association of ABCA1 with Syntaxin 13 and Flotillin-1 and Enhanced Phagocytosis in Tangier Cells Mol. Biol. Cell, December 1, 2004; 15(12): 5399 - 5407. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. C. Larocca, R. A. Shanks, L. Tian, D. L. Nelson, D. M. Stewart, and J. R. Goldenring AKAP350 Interaction with cdc42 Interacting Protein 4 at the Golgi Apparatus Mol. Biol. Cell, June 1, 2004; 15(6): 2771 - 2781. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2003 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
/
-modified Eagle medium
(
). Cells were then grown overnight in
RPMI depleted of serum and 2% bovine serum albumin, then
stimulated with 10% FCS or 100 ng/mL insulin for 15 minutes at 37°C.
Lysates were prepared and immunoprecipitated (IP) with FLAG-antibody,
and blotted with antiphosphotyrosine mAb 4G10 (Upstate Biotechnology,
Lake Placid, NY). Lower panel shows comparable levels of
immunoprecipitated Felic. WCLs show expression of
Felic.
