|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Prepublished online as a Blood First Edition Paper on November 27, 2002; DOI 10.1182/blood-2002-09-2850.
RED CELLS
From the MGC Department of Cell Biology, Erasmus MC,
Rotterdam, The Netherlands; Department of Pharmacology,
University College Dublin, Belfield, Ireland; Department
of Biology, Imperial College of Science, Technology and Medicine,
London, United Kingdom; MPI für Molekulare Genetik,
Ihnestrasse, Berlin, Germany; MRC Molecular Haematology
Unit, Institute of Molecular Medicine, John Radcliffe Hospital, Oxford,
United Kingdom; and Department of Zoology, University of
Hong Kong, China.
To further our understanding of the regulation of vertebrate globin
loci, we have isolated cosmids containing The large amount of intergenic sequences makes
genome analysis a difficult task in most higher vertebrates. Current
research has indicated the pufferfish (Fugu rubripes and the
closely related Spheroides nephelus) as an ideal species for
just this task because it has a relatively compact genome of 400 Mb,
approximately 7.5 times smaller than the human genome.1,2
Nevertheless, the Fugu genome contains a complement of genes
similar to that found in humans.3-5 As a consequence,
genes occur approximately once every 8 kb in the Fugu
genome. Thus, it provides a suitable model for the comparison with gene
loci from higher vertebrates. In our laboratory, we study the
regulation of the human To find potential regulatory elements in the Both pufferfish globin loci are flanked by a highly conserved gene
encoding a protein homologous to Drosophila rhomboid. The observation that a mammalian homologue of this gene,
C16orf8, is found closely linked to the mammalian Construction of the genomic cosmid library
Isolation and characterization of cosmid clones
Transgenic mice The -cosmid was digested with EcoRI, and the 22-kb
DNA fragment containing the globin genes (Figure 4A) was purified on a salt gradient. It was then used at a concentration of 2 µg/mL to
generate transgenic mice.16 DNA isolated from tail clips was used to identify transgenic founder mice by Southern blotting. Transgenic F1 offspring were mated to wild-type FVB mice, and expression of the pufferfish -globin gene was analyzed by reverse transcription-polymerase chain reaction (RT-PCR) of RNA isolated from
yolk sac (day-11.5 embryos), fetal liver (day-13.5 fetuses), and
peripheral blood (adult mice). Primers used were TGGACTGATCAAGAGCGC (sense) and GTCCATGTTCTTCACAGC (antisense); expected product size on
cDNA was 215 base pair (bp). No amplification product was
expected on genomic DNA because the sense primer bridges exon 1 and 2.
DNA sequencing and analysis Subclones from the-globin cosmid were sequenced on an ABI
automated sequencer. Overlapping subclones were then used to assemble the sequences into a contig. Final gaps in the sequence were closed by
direct sequencing of cosmid DNA with custom-designed primers. Sequence
homology searches were performed against the public databases using the
BLAST computer programs17
(http://www.ncbi.nlm.nih.gov/BLAST/, http://www.ensembl.org); the
private database of the Celera company (Rockville, MD; human
and mouse genomes); and the Fugu genomic and cDNA databases
(http://fugu.hgmp.mrc.ac.uk/Analysis/). The loci drawn in Figure 5
represent the consensus of the public and private databases (human,
mouse, and Fugu genome; January 2002) and published papers
(April 2002). Genscan was used to find potential exons
(http://genes.mit.edu/GENSCAN.html). Alignments of human and
Fugu sequences were made with the BLAST 2 sequences program (http://www.ncbi.nlm.nih.gov/blast/bl2seq/bl2.html). To increase the
sensitivity of the searches, the Fugu contig was divided
into 1.1-kb subsequences with 100-bp overlaps. Alignments of
C16orf8 orthologues were visualized with VISTA (Lawrence
Berkeley National Laboratory, Berkeley, CA).18 The
accession number of the  -locus is AY170464.
Preparation of Fugu metaphase spreads Live pufferfish (fingerlings 4-10 cm in size) were purchased from Green Science, Yamaguchi, Japan. Chromosome spreads were prepared as previously described.19 Briefly, the pufferfish were intraperitoneally injected with 0.1% colchicein (approximately 0.1 mL/10 g fish), the fish were killed after 6 to 8 hours, and the kidneys were isolated. Kidney cell suspensions were subjected to hypotonic treatment, and, after fixation, the cells were dropped onto slides and stained with Giemsa.In situ hybridization of Fugu interphase nuclei and metaphase spreads DNA-FISH was performed on interphase nuclei and chromosomal spreads from the pufferfish using biotin- or digoxigenin-labeled plasmid probes containing the Fugu- and -cosmid
DNAs. Preparation of the samples and hybridizations were carried out as
described by Mulder et al.19 The hybridized biotin probe
was detected with 2 layers of avidin-fluorescein isothiocyanate
(FITC), and the hybridized digoxigenin probe was detected with an
anti-digoxigenin antibody followed by a Texas red-labeled secondary
antibody. DNA was counterstained with DAPI.
DNaseI hypersensitive site mapping Nuclei were isolated from frozen F rubripes tissues as described.20 In some instances, mouse fetal livers were added as a source of carrier nuclei. A time-course (0-10 min) of DNaseI digestion was performed at 37°C.20 The reactions were stopped by the addition of sodium dodecyl sulfate (SDS) to 1% final concentration and EDTA (ethylenediaminetetraacetic acid) to 5 mM final concentration. After purification, the DNA was digested with SphI, SacI, or XhoI, fractionated on 0.8% agarose gels, and Southern blotted. Blots were hybridized with various probes from different regions of the-locus to cover the entire locus on overlapping restriction fragments. These probes were made by PCR using the following primer pairs: probe 1, CCGACAAGCGTTGCAGTAAT and ATTCTCCTTTGGCCTGCTTC (product
1082 bp); probe 2, TTCAGACAGGCTAGAATGCC and CGTATGTGGCTTGTTCCCTT (product 605 bp); probe 3, AAGCTGTGTTCTTGACTGGG and
ACCAGGAGTTGCTTTGGAAC (product 1098 bp); probe 4, TGACAACTCGCTGGTAACTG
and TCCACAAGGTCCCTGTATTC (product 554 bp); probe 5, TCAGTGGCGACATTTCACCT and GGAAGGTTCATTTGCACACG (product 970 bp); probe
6, AGCTTGACTCCCGATGAACT and AGAATCTGCCTCGAAGAAGC (product 974 bp);
probe 7, GCAGCAGGTTCTCAATCATC and TAGACACCCAAAGCCTTGAC (product 711 bp).
Expression analysis One microgram total RNA, isolated from various tissues of adult mice, was reverse transcribed with an oligo-dT primer followed by PCR reactions on one fifth of the total synthesis. Primers used are 5'-GGCACACACCAAGAGTTCAGG-3' and 5'-GCACGGTAGCCACAGCAGTA-3' for cytoglobin (293-bp product). Primers for cyclophilin A (5'-TCACCATTTCCGACTGTGGAC-3' and 5'-ACAGGACATTGCGAGCAGATG-3') were used as an internal control (99-bp product). PCR cycles used were determined to be within the linear range of the reactions.
Isolation of cDNAs encoding F rubripes globins To begin to analyze the globin genes of the pufferfish, we prepared RNA from peripheral blood and used this to construct a cDNA library. This library was screened under low-stringency conditions with salmon- and -globin cDNA probes.15 Twenty-four
positive clones were picked and were analyzed by restriction mapping
followed by sequencing and database searches. This resulted in the
isolation of cDNAs encoding Fugu - and -globin
proteins (Figure 1). The -globin cDNA
is designated 1-globin in this paper. BLAST searches of the Fugu
cDNA database revealed many perfect matches with our 1-globin cDNA
and many imperfect matches with another -globin cDNA. For
-globin, we found many highly similar cDNAs aligning with our
-globin cDNA, indicating that these are all derived from the same
gene and suggesting that Fugu contains only one functional
-globin gene. The deduced amino acid sequence of the Fugu
- and -chains predicts that they would form a Bohr-type hemoglobin tetramer.24
Chromosomal clones containing the F rubripes 1- and -globin cDNAs as probes. Two cosmids that
hybridized strongly with the 1-globin probe (-cosmids) were
recovered. One of the -cosmids was rearranged and is not further
considered. In addition, we screened the gridded Fugu
lawrist 4 cosmid library14 with the -globin probe. This
resulted in the isolation of one cosmid (ICRFc66E1840; -cosmid;
see below) strongly hybridizing with this probe. Restriction
mapping and Southern hybridizations failed to demonstrate the presence
of overlapping DNA fragments between the - and -cosmids,
suggesting that their inserts are not closely linked in the
Fugu genome.
DNA-FISH analysis of F rubripes - and -cosmid DNA probes to
evaluate the chromosomal localization of the 2 globin loci. In nuclei, we found 2 red spots with the -cosmid and 2 green spots with the
-cosmid. Confocal microscopy shows that these spots are always
clearly separated, and we did not observe colocalization of the red and
green signals (Figure 2A). Although these
data do not exclude that the loci are on the same chromosome, it shows that they are not closely linked in the pufferfish genome. The analysis
of spread metaphases was more difficult because of the low frequency of
dividing cells and the inefficiency of probe hybridization.
Nevertheless, specific hybridization signals could be detected and
categorized into chromosomes bearing green signals and chromosomes
bearing red signals. Both signals were observed at the telomeric ends
of the chromosomes. However, colocalization of red and green signals on
the same chromosome was never found. Furthermore, the red -cosmid
signal is present on a much larger chromosome than the green
-cosmid signal (Figure 2B). We conclude that the - and
-cosmids represent 2 hemoglobin loci that have separated onto
different chromosomes in the pufferfish.
F rubripes -globin gene cluster, we analyzed the pufferfish cosmid
containing the -globin gene in more detail. We sequenced the
-globin gene and flanking sequences. We found that the cosmid contains one -globin gene that matches our -globin cDNA
perfectly. In addition, we found that 2 putative -globin genes flank
the -globin gene. To validate the assignment of the Fugu
globins as either -type or -type proteins, alignments of human
and Fugu globins are shown in Figure 1.
The
We find a number of distinctive hallmarks in the promoters of the
Fugu
Search for distal regulatory elements We searched for combinations of erythroid-specific transcription factor binding sites (EKLF, GATA, NF-E2)10 to identify regulatory elements of globin expression outside the promoters of the genes. Although we found a clustering of potential NF-E2 binding sites upstream of the4-globin gene, positioned around 25.5 kb in Figure
4A, these sites were part of a 27-bp sequence tandemly repeated 3 times
and located in an area of repetitive DNA (Figure 4A). Such an
arrangement does not resemble previously characterized globin control
elements, and the clustering of these sites is possibly spurious
because of the tandem repeats. BLAST alignments with other vertebrate
globin loci did not reveal any clues to the presence of regulatory
elements. However, sequence conservation in regulatory modules is
usually very poor. We therefore used DNaseI hypersensitive site (HS)
mapping as an alternative approach to obtain information about
potential regulatory elements in the pufferfish -locus. We
isolated nuclei from peripheral blood and digested these with
increasing amounts of DNaseI to reveal the presence of
erythroid-specific DNaseI HS in the locus. As nonerythroid control
tissue we used liver. We chose restriction digests and PCR-generated
hybridization probes suitable for HS mapping (Figure 4A). Southern
blots revealing hypersensitive sites at the globin gene promoters are
shown in Figure 4B. We found that the promoters of the 3- and
-globin genes were in an open chromatin conformation in erythroid
cells only, in agreement with the notion that these genes are actively
transcribed in red blood cells. We did not find hypersensitivity
associated with the 4 promoter, in agreement with our hypothesis
that this promoter is no longer functional. The repetitive sequences
around 25.5 kb appear to be hypersensitive to DNaseI digestion in
erythroid cells, but some hypersensitivity is also found in the control tissue (Figure 4B). Thus, this might reflect an intrinsic property of
these repetitive sequences. In conclusion, the analysis of DNaseI
sensitivity in the pufferfish -locus chromatin demonstrated the
presence of erythroid-specific hypersensitive sites associated with the
promoters of the 3- and -globin genes but has not revealed the
presence of strong erythroid hypersensitive sites at other positions in
the locus. This suggests that activation of the globin genes in
the pufferfish -locus does not require the presence of distant
regulatory elements.
Genes flanking the F rubripes -globin locus is flanked by genes encoding
odorant receptors.31 If this represents the archetypal
-globin locus, a similar setting might be found for the
Fugu -locus. Using the Genscan computer program, we
found a number of potential exons in the region downstream of the
3-globin gene. These exons are highly homologous to the human
full-length cDNA FLJ22357, which is encoded by the C16orf8
gene located close to the human -globin cluster (gene 5 in Flint et
al10). Because some of the exons and introns are extremely
small (65 bp), the exon-intron structure of this gene is not readily
predicted by Genscan. We made use of the FLJ22357 cDNA and deduced
protein sequence to determine the intron-exon structure of the
Fugu gene. We find that the human and pufferfish genes
contain 18 exons and that all the exon-intron boundaries are in the
same positions. Furthermore, alignment of the predicted proteins
reveals that 72% of the amino acids are identical and 83% are
similar, with just 23 gaps in the alignment of the 855 amino acid (aa)
proteins. This degree of conservation is much higher than that observed
for the hemoglobins (48%-49% identical residues). We conclude that in
the -locus, a homologue of gene 5 is the first gene flanking the
globin genes on the left (Figures 4A, 5).
This is surprising because we have found previously that homologues of
genes telomeric to the human -globin cluster are present in the
pufferfish -locus in the order gene 4, gene 3.1, gene 5, gene 6, and
gene 7, with gene 7 closest to the -globin genes10
(Figure 5).
To the right of the Comparative analysis reveals the presence of a novel globin locus in mammals In the human genome, a paralogue of the C16orf8 gene, encoding FLJ22341, is found on chromosome 17. The pufferfish hemoglobin loci also contain genes highly homologous to the C16orf8 gene. Multiple alignment of the human and pufferfish genes generated with the aid of VISTA18 demonstrates the conservation of the coding exons between the C16orf8-related genes (Figure 6). Because the pufferfish globin loci are flanked by C16orf8 homologues, we searched the surroundings of the FLJ22341 gene on human chromosome 17 for the presence of the other genes found in the pufferfish- and
-globin loci. This comparison yielded 2 remarkable results. First, the FLJ22341 gene is flanked on the left by the
AANAT gene, encoding the arylalkylamine N-acetyltransferase
protein (NP_001079). This gene is present in a similar position in the
pufferfish -locus, but not in the human -locus (Figure 5).
Second, the gene immediately flanking the FLJ22341 gene on
the right encodes a novel member of the globin family
(XM_05881811,12); the official name assigned to this
globin is cytoglobin (CYGB). Our expression analysis of cytoglobin in
the mouse (Figure 7A-B) confirms previous
observations that it is widely expressed11,12 but also
reveals large differences in expression between tissues.
In the human and pufferfish
The - and -globin genes from
the pufferfish F rubripes. We present evidence that
Fugu contains one -globin gene and at least 2 functional
-globin genes. This conclusion is supported by BLAST searches in the
most recent version of the Fugu genome5
(version 8.1.1; release date, July 18, 2002) that indicate the
Fugu genome does not harbor hemoglobin genes in addition to
those contained in the - and -loci.
The presence of 3 functional hemoglobin genes has been reported
previously for the black rock cod, Notothenia coriiceps. It has been suggested that these fish have no requirement for hemoglobin molecules with different oxygen affinities because there is little variation in temperature and oxygen levels in their
habitat.32,33 This could also apply to the pufferfish. The
Fugu Regulation of globin gene expression One of the aims of the present study was to gain insight in the regulatory mechanisms underlying globin gene expression. We anticipated that the small size of the Fugu globin clusters would facilitate the elucidation of the requirements for high-level, erythroid-specific gene expression. However, we found no expression of the Fugu-cosmid globin genes in transgenic mice.
Other examples have been reported for the Fugu
WT1 gene (N. Hastie, personal communication, March
2000) and the Huntingtin gene.35 Possibly, the evolutionary distance between Fugu and mouse precludes
the activation of Fugu genes in the mouse.
The major regulatory elements of the mammalian hemoglobin loci, Evolution of hemoglobin loci The physical separation of the- and -genes is thought to be
advantageous for the generation of novel - and - chain variants because gene conversion events would suppress the separate evolution of
these 2 globins when the genes are in cis. Furthermore,
separation of the loci increases the flexibility of the spatio-temporal
regulation of globin gene expression, as exemplified by the relatively
recent recruitment of a fetal -like globin gene in some euplacental mammals such as goats and humans.37 It is believed that
the - and -globins have evolved from an ancestral globin gene
through in cis gene duplication events. Later, the - and
-globin genes split onto separate chromosomes through in
trans duplication of the locus followed by the elimination of the
-genes from the -locus and the -genes from the -locus,
resulting in the distinct - and -globin loci found in today's
birds and mammals.37 This model of the common evolutionary
origin of the human - and -globin loci is strongly supported by
our observation that C16orf8 homologues are linked to both
Fugu hemoglobin loci. However, the mammalian -globin loci
are flanked by olfactory receptor genes.31 In Fugu, we find no evidence for homology with mammalian and
chicken -globin loci in the chromosomal regions around the -gene.
Possibly, the locus duplication events leading to the Fugu
and mammalian hemoglobin loci have occurred independently during
evolution. This is supported by the fact that thus far no -only or
-only loci have been found in the 2 major amphibian lineages,
frogs38 and salamanders (T.McM. and S.P., unpublished
data, May 2001). Alternatively, the loci may have arisen from
the same duplication event, with the present day -globin loci in
homoiothermic vertebrates separated from their original flanking genes
through additional chromosomal rearrangements. The analysis of genes
flanking the hemoglobin loci in amphibians might help to distinguish
between these 2 possibilities.
Common evolutionary origin of human globin loci? The comparative analysis of pufferfish and human globin loci is consistent with a common evolutionary origin of the human globin loci since we find short regions of homology flanking the-globin
(pufferfish and human) -globin (pufferfish) and cytoglobin (human) clusters. The current annotation of the Fugu genome
indicates that neuroglobin, myoglobin, and cytoglobin genes are present in this fish species, but it is unclear yet whether any of these globin
genes are also linked to AANAT or C16orf8 genes,
or both (S.P., unpublished observations, August 2002).
Recently, evidence has been presented that ancient genome duplications
contributed to the vertebrate genome.39,40 In agreement with these data, our work supports a model in which globin loci have
evolved through duplication events followed by diversification and
specialization of the separate loci.37 Evidence for the original chromosomal rearrangements that gave rise to human myoglobin, neuroglobin, and
Model for the evolutionary origin of the human globin loci Recently, a model of the evolution of vertebrate globins has been proposed, based on a phylogenetic analysis of the globins.11 In Figure 8, we have adapted this proposal to accommodate the evolution of the human globin loci. The very early ancestor to vertebrates contained a single ancestral globin gene. This globin gene may already have been linked to ancestral AANAT and C16orf8 genes, but there is no experimental evidence to support such linkage. Based on the antiquity of neuroglobin, it has been proposed that the last common ancestor to all vertebrates contained 2 globin loci.11 Thus, duplication of the ancestral globin locus resulted in 2 globin loci, developing into loci encoding neuroglobin and cellular globin. Our data support linkage of the cellular globin locus to the C16orf8 and AANAT genes at this stage. Next, duplication of the cellular globin locus resulted in separate cellular and hemoglobin loci. Linkage of C16orf8 and AANAT genes to cytoglobin and hemoglobin loci supports this mechanism. A further duplication of the cellular globin locus allowed the development of the myoglobin and cytoglobin loci. It is unclear from the pylogenetic data whether this occurred before the jawed vertebrates diverged from the jawless vertebrates (agnathans: lampreys and hagfish),11,36 and it will therefore be of interest to determine whether agnathans have both a myoglobin and a cytoglobin locus. In the hemoglobin locus, gene duplication gave rise to a cluster encoding several monomeric hemoglobins, as found in today's agnathans. This allowed the specialization of individual genes in-type or -type hemoglobins.
Finally, additional locus duplication events followed by deletions of
globin genes resulted in hemoglobin loci with only -type or -type
globins, typical of birds and mammals. The presence of the -locus,
containing only -type globins, and the -locus, containing both
types of globins, in the pufferfish supports this mechanism.
Furthermore, this suggests that the locus that gave rise to the human
-globin locus was already an "-only" locus when amphibians
diverged from bony fishes, approximately 400 million years ago,
predicting that -only loci are also present in the amphibian and
reptile lineages. Alternatively, the -gene might have been lost from
these loci independently after the divergence of bony fishes and amphibians.
Future directions The model for the evolutionary origin of the human globin loci, presented in Figure 8, makes several predictions that can be experimentally tested through in silico analysis of globin loci in agnathans, amphibians, and reptiles. In combination with in vitro and in vivo assays, this "functional genomics" approach will provide detailed insight into the evolution and regulation of vertebrate globin gene clusters.
Submitted September 1, 2002; accepted November 1, 2002.
Prepublished online as Blood First Edition Paper, November 27, 2002; DOI 10.1182/blood-2002-09-2850.
Supported by the Dutch Organization for Scientific Research NWO.
N.G. and T.M. contributed equally to this work.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Sjaak Philipsen, Erasmus MC Department of Cell Biology, PO Box 1738, 3000 DR Rotterdam, The Netherlands; e-mail: philipsen{at}ch1.fgg.eur.nl.
1. Brenner S, Elgar G, Sandford R, Macrae A, Venkatesh B, Aparicio S. Characterization of the pufferfish (Fugu) genome as a compact model vertebrate genome. Nature. 1993;366:265-268[CrossRef][Medline] [Order article via Infotrieve]. 2. Schofield JP, Elgar G, Greystrong J, et al. Regions of human chromosome 2 (2q32-q35) and mouse chromosome 1 show synteny with the pufferfish genome (Fugu rubripes). Genomics. 1997;45:158-167[CrossRef][Medline] [Order article via Infotrieve]. 3. Venkatesh B, Gilligan P, Brenner S. Fugu: a compact vertebrate reference genome. FEBS Lett. 2000;476:3-7[CrossRef][Medline] [Order article via Infotrieve]. 4. Elgar G, Sandford R, Aparicio S, Macrae A, Venkatesh B, Brenner S. Small is beautiful: comparative genomics with the pufferfish (Fugu rubripes). Trends Genet. 1996;12:145-150[CrossRef][Medline] [Order article via Infotrieve]. 5. Aparicio S, Chapman J, Stupka E, et al. Whole-genome shotgun assembly and analysis of the genome of Fugu rubripes [abstract]. Science. 2002;25:25[Medline] [Order article via Infotrieve]. 6. Hardison R. Hemoglobins from bacteria to man: evolution of different patterns of gene expression. J Exp Biol. 1998;201:1099-1117[Abstract]. 7. Vyas P, Vickers MA, Simmons DL, Ayyub H, Craddock CF, Higgs DR. Cis-acting sequences regulating expression of the human alpha-globin cluster lie within constitutively open chromatin. Cell. 1992;69:781-793[CrossRef][Medline] [Order article via Infotrieve]. 8. Arapinis C, Elion J, Labie D, Krishnamoorthy R. Differences in DNase I sensitivity and methylation within the human beta-globin gene domain and correlation with expression. Eur J Biochem. 1986;156:123-129[Medline] [Order article via Infotrieve].
9.
Tuan D, Solomon W, Li Q, London IM.
The "beta-like-globin" gene domain in human erythroid cells.
Proc Natl Acad Sci U S A.
1985;82:6384-6388
10.
Flint J, Tufarelli C, Peden J, et al.
Comparative genome analysis delimits a chromosomal domain and identifies key regulatory elements in the alpha globin cluster.
Hum Mol Genet.
2001;10:371-382
11.
Burmester T, Ebner B, Weich B, Hankeln T.
Cytoglobin: a novel globin type ubiquitously expressed in vertebrate tissues.
Mol Biol Evol.
2002;19:416-421 12. Trent JT 3rd, Hargrove MS. A ubiquitously expressed human hexacoordinate hemoglobin [abstract]. J Biol Chem. 2002;13:13.
13.
Grosveld FG, Lund T, Murray EJ, Mellor AL, Dahl HH, Flavell RA.
The construction of cosmid libraries which can be used to transform eukaryotic cells.
Nucleic Acids Res.
1982;10:6715-6732 14. Burgtorf C, Welzel K, Hasenbank R, Zehetner G, Weis S, Lehrach H. Gridded genomic libraries of different chordate species: a reference library system for basic and comparative genetic studies of chordate genomes. Genomics. 1998;52:230-232[CrossRef][Medline] [Order article via Infotrieve]. 15. Wagner A, Deryckere F, McMorrow T, Gannon F. Tail-to-tail orientation of the Atlantic salmon alpha- and beta-globin genes. J Mol Evol. 1994;38:28-35[Medline] [Order article via Infotrieve].
16.
Kollias G, Hurst J, deBoer E, Grosveld F.
The human beta-globin gene contains a downstream developmental specific enhancer.
Nucleic Acids Res.
1987;15:5739-5747 17. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990;215:403-410[CrossRef][Medline] [Order article via Infotrieve].
18.
Mayor C, Brudno M, Schwartz JR, et al.
VISTA: visualizing global DNA sequence alignments of arbitrary length.
Bioinformatics.
2000;16:1046-1047 19. Mulder MP, Wilke M, Langeveld A, et al. Positional mapping of loci in the DiGeorge critical region at chromosome 22q11 using a new marker (D22S183). Hum Genet. 1995;96:133-141[CrossRef][Medline] [Order article via Infotrieve]. 20. Ellis J, Tan-Un KC, Harper A, et al. A dominant chromatin-opening activity in 5' hypersensitive site 3 of the human beta-globin locus control region. EMBO J. 1996;15:562-568[Medline] [Order article via Infotrieve].
21.
Corpet F.
Multiple sequence alignment with hierarchical clustering.
Nucleic Acids Res.
1988;16:10881-10890 22. Knight SJ, Lese CM, Precht KS, et al. An optimized set of human telomere clones for studying telomere integrity and architecture. Am J Hum Genet. 2000;67:320-332[CrossRef][Medline] [Order article via Infotrieve].
23.
Volff JN, Korting C, Schartl M.
Multiple lineages of the non-LTR retrotransposon Rex1 with varying success in invading fish genomes.
Mol Biol Evol.
2000;17:1673-1684 24. Perutz M. Molecular anatomy and physiology of hemoglobin. In: Steinberg MH,Forget BG,Higgs DR,Nagel RL, eds. Disorders of Hemoglobin. Cambridge, England: Cambridge University Press; 2001:174-196.
25.
Dodgson JB, Engel JD.
The nucleotide sequence of the adult chicken alpha-globin genes.
J Biol Chem.
1983;258:4623-4629
26.
Steinberg MH.
Case report: effects of iron deficiency and the
27.
Rosatelli MC, Oggiano L, Battista Leoni G, et al.
Thalassemia intermedia resulting from a mild beta-thalassemia mutation.
Blood.
1989;73:601-605 28. Perkins AC, Sharpe AH, Orkin SH. Lethal beta-thalassaemia in mice lacking the erythroid CACCC-transcription factor EKLF. Nature. 1995;375:318-322[CrossRef][Medline] [Order article via Infotrieve]. 29. Nuez B, Michalovich D, Bygrave A, Ploemacher R, Grosveld F. Defective haematopoiesis in fetal liver resulting from inactivation of the EKLF gene. Nature. 1995;375:316-318[CrossRef][Medline] [Order article via Infotrieve].
30.
Wijgerde M, Gribnau J, Trimborn T, et al.
The role of EKLF in human beta-globin gene competition.
Genes Dev.
1996;10:2894-2902
31.
Bulger M, van Doorninck JH, Saitoh N, et al.
Conservation of sequence and structure flanking the mouse and human beta-globin loci: the beta-globin genes are embedded within an array of odorant receptor genes.
Proc Natl Acad Sci U S A.
1999;96:5129-5134
32.
Cocca E, Ratnayake-Lecamwasam M, Parker SK, et al.
Genomic remnants of alpha-globin genes in the hemoglobinless Antarctic icefishes.
Proc Natl Acad Sci U S A.
1995;92:1817-1821 33. D'Avino R, Caruso C, Schinina ME, et al. The amino acid sequence of the alpha- and beta-chains of the two hemoglobins of the Antarctic fish Notothenia coriiceps neglecta. FEBS Lett. 1989;250:53-56[CrossRef][Medline] [Order article via Infotrieve]. 34. Satoh H, Inokuchi N, Nagae Y, Okazaki T. Organization, structure, and evolution of the nonadult rat beta-globin gene cluster. J Mol Evol. 1999;49:122-129[CrossRef][Medline] [Order article via Infotrieve].
35.
Sathasivam K, Baxendale S, Mangiarini L, et al.
Aberrant processing of the Fugu HD (FrHD) mRNA in mouse cells and in transgenic mice.
Hum Mol Genet.
1997;6:2141-2149 36. Colbert EH, Morales M. Introduction Evolution of the Vertebrates. 4th ed. New York, NY: John Wiley-Liss; 1991:1-15. 37. Hardison R. Organization, evolution and regulation of the globin genes. In: Steinberg MH,Forget BG,Higgs DR,Nagel RL, eds. Disorders of Hemoglobin. Cambridge, England: Cambridge University Press; 2001:95-116. 38. Patient RK, Elkington JA, Kay RM, Williams JG. Internal organization of the major adult alpha- and beta-globin genes of X. laevis. Cell. 1980;21:565-573[CrossRef][Medline] [Order article via Infotrieve]. 39. McLysaght A, Hokamp K, Wolfe KH. Extensive genomic duplication during early chordate evolution. Nat Genet. 2002;31:200-204[CrossRef][Medline] [Order article via Infotrieve]. 40. Abi-Rached L, Gilles A, Shiina T, Pontarotti P, Inoko H. Evidence of en bloc duplication in vertebrate genomes. Nat Genet. 2002;31:100-105[CrossRef][Medline] [Order article via Infotrieve].
© 2003 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  S.-I. Kim, E. H. Bresnick, and S. J. Bultman BRG1 directly regulates nucleosome structure and chromatin looping of the {alpha} globin locus to activate transcription Nucleic Acids Res., October 1, 2009; 37(18): 6019 - 6027. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. J. Near, S. K. Parker, and H. W. Detrich III A Genomic Fossil Reveals Key Steps in Hemoglobin Loss by the Antarctic Icefishes Mol. Biol. Evol., November 1, 2006; 23(11): 2008 - 2016. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2003 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
(embryonic) G
-A
-
that
is, aa 208 to 855 of FLJ22357; aa 1 to 619 of FLJ22341; aa 210 to 855 of the pufferfish 
88 C
T mutation on HbA2 levels in beta-thalassemia.
Am J Med Sci.
1993;305:312-313