| |
|
|
|
|
|
|
|||
|
Prepublished online as a Blood First Edition Paper on December 12, 2002; DOI 10.1182/blood-2002-08-2408.
NEOPLASIA
From the Division of Immunology and Allergology and the
Division of Hematology, University Hospital, Geneva,
Switzerland; the Institute for Transfusion Medicine,
Heinrich Heine University, Duesseldorf, Germany; the
Department of Pathology and Immunology, Washington University School of
Medicine, St Louis, MO; Diagnostic and Therapeutic Hematology,
Kantonsspital, Basel, Switzerland; and NCCR Molecular
Oncology, Swiss Institute for Experimental Cancer Research, Epalinges,
Switzerland.
We have analyzed the phenotype, cytokine profile, and mitotic
history (telomere length) of monoclonal T-cell expansions in 5 CD3+ T-cell large granular lymphocyte (TLGL)
leukemia patients by fluorescence activated cell sorting (FACS) and
single-cell polymerase chain reaction (PCR). We confirm that the common
phenotype of TLGL leukemia is
CD3+CD8+CD45RA+CD27 Lymphoproliferative disorders of large
granular lymphocytes (LGLs) are classified as lymphoid
neoplasms.1,2 They are divided into 2 distinct entities:
approximately 10% to 20% are of the natural killer (NK)
lineage (CD3 Apart from the low malignancy of TLGL leukemia, there are
more indications that the clonal expansion is the result of a perhaps rather common dysregulation of CD8+ T cells. In fact, large
oligoclonal expansions of CD8+ T cells are quite frequent
in elderly people.10 Such clones that may be maintained by
cytokines rather than by antigen11 are of a phenotype
similar to that of normal CD8+ effector T cells of which
the clonal size is still controlled through apoptosis. The latter is
also true for the TLGL clone. In the majority of patients, these cells
are
CD8+CD45RA+CD27 Recently, it has been reported that TLGL cells express killer cell
receptors specific for class I HLA antigens.7,17-19 These receptors, either of the C-type lectin-like type or members of the
immunoglobulin (Ig) superfamily have been initially characterized on NK cells as receptors that inhibit their effector function when
engaged by their major histocompatibility complex (MHC) ligand on the
target cell.20-22 Killer cell immunoglobulin-like
receptors (KIRs) with a long cytoplasmic tail (KIRLs)23
abrogate the activation pathway initiated by other receptors by
recruiting tyrosine phosphatases through an immunoreceptor
tyrosine-based inhibition motif (ITIM) in their intracytoplasmic
domain. C-type lectin-like inhibitory killer cell receptors consist of
heterodimers of CD94 and NKG2A (CD94:NKG2A) of which the latter
molecule also harbors an ITIM motive. The inhibitory function of killer
cell receptors has been studied extensively and their detection on
lymphocytes by fluorescence activated cell sorting (FACS) is often
perceived as evidence that the effector function of the cell is
down-regulated when these receptors are engaged. However, only a few
monoclonal antibodies discriminate the ITIM-bearing killer cell
receptors from their activating (ITAM) counterparts that are either
very homologous with respect to their extracellular domain (Ig
superfamily), or differ only because they are associated with another
member of the NKG2 family (CD94:NKG2C, CD94:NKG2E, or CD94:NKG2F,
respectively). Hence, little is known about the incidence or the
physiologic role of this perhaps more rare activating form of the
killer cell receptor.
In this study, we characterized the monoclonal expansion in 5 patients
diagnosed with TLGL leukemia. We confirm that the expression of
markers such as CD16, CD56, and CD57, once presumed to be
characteristic for LGL leukemia, is indeed heterogeneous and that these
cells express an array of killer cell receptors. Furthermore, we show that most of these killer cell receptors are activating receptors. As a
result, the CD8+ LGL T cell might be readily activated,
which could be the cause of the clinical symptoms characteristic of
the disease.
Blood samples and flow cytometry
Preparation of cDNA
cDNA amplification The procedures are based on methods published by Brady24 and modified by Sauvageau et al.25 In brief, sufficient quantities of cDNA from a single cell were obtained by addition of a 3' oligo(dA) tail to the cDNA by an incubation of 30 minutes at 37°C with 0.5 mM dATP (2'-deoxyadenosine 5'-triphosphate; Gibco BRL) and 1 U terminal deoxynucleotidyl transferase (Promega) in 5 µL of buffer prepared following the manufacturer's protocol. After denaturation (95°C for 3 minutes), 45 µL polymerase chain reaction (PCR) buffer (10 mM Tris-HCl, pH 8.8, 2 mM MgCl2, 100 nM dNTP [2'-deoxynucleoside 5'-triphosphate; Gibco BRL], 0.005% Triton X-100) containing 1 ng oligo dT(60) (CATGTCGTCCAGGCCGCTCTGGGACAAAATATGAATTCT23) and 5 U Taq DNA recombinant polymerase (Gibco BRL) was added, followed by 5 cycles of PCR (50 seconds at 94°C, 2 minutes at 37°C, 9 minutes at 71°C) and 35 cycles (50 seconds at 94°C, 1.5 minutes at 60°C, and 8 minutes at 71 °C).PCR For amplification (35-40 cycles; 30 seconds at 94°C, 45 seconds at 58°C, 60 seconds at 72°C) of the respective genes from 0.5 µL to 1 µL of the amplified cDNA, we used the following primers (40 ng, 1.5 mM MgCl2): glyceraldehyde phosphate dehydrogenase (GAPDH): 5'-GGACCTGACCTGCCGTCTAG-3', rev-5'-GGCCATGTGGGCCATGAGGTC-3'; CD3: 5'-CGTTCAGTTCCCTCCTTTTCTT-3', rev-5'-GATTAGGGGGTTGGTAGGGAGTG-3'; CD94: 5'-AGAAATCCAGCCTGCTTCAGCTTC-3', rev-5'-CACCTTCTCTGCCCCA- AGAAAC-3'; NKG2A(B): 5'-ACTGAACAGGAAATAACCTATGCG-3', rev-5'-GTCACCCATGGATGATGACTGCTG-3'; NKG2C(E,H): 5'-ACCGAACAGGAAATATTCCAAGTA-3', rev-5'-GTCACCCATGGATGATGACTGCTG-3'; NKG2D: 5'-CGCTGTAGCCATGGGAATC-3', rev-5'-AATGTG- TACTAGTCCCATCCAATGA-3'; NKG2F: 5'-ACCGAACAGGAAATATTCCAAGTA-3', rev-5'-CAGATCAGAGTTCTTCGAAG-3'; 1.5 mM MgCl2, KIR2DL1,2,3 KIR3DL12: 5'-GTGACCTTGTCCTG(CT)AGCTCC-3', rev-5'-GATGAAGAGGA(AT)GATGACCACTG-3'; KIR2DL4: 5'-GTGACCTTGTCCTG(CT)AGCTCC-3', rev-5'-GCCACTGAGTACCTAATCACAG-3'; KIR2DS1,2,3,4 KIR3DS1: 5'-TACAGATGCTTCGGCTCTTTC-3', rev-5'-GGAGGATGGTGAAAGGGATTT-3'; tumor necrosis factor alpha (TNF- ): 5'-GTGGACCTTAGGCCTTCCTC-3', rev-5'-ACGGAAAACATGTCT- GAGCC-3'; interferon gamma (IFN- ):
5'-GCAGAGCCAAATTGTCTCCT-3', rev-5'-ATGCTCTTCGACCTCGAAAC-3'; FasL:
5'-GAGCCAGACAAATGGAGGAA-3', rev-5'-GAAGTGAAGATGCTGCCAGTG-3'; granzyme
B: 5'-CCTGGGAAAACACTCACACA-3', rev-5'-GCCATTGTTTCGTCCATAGG-3';
IL-15secreted: 5'-CATGTCTTCATTTTGGGCTGT-3', rev-5'-TGCATCTCCGGACTCAAGTG-3'; CD14: 5'-AGCTCAGAGGTTCGGAAGACTTA-3', rev-5'-ATCTCCACCTCTACTGCAGACACA-3'. For the T-cell receptor (TCR) analysis (spectratyping), all conditions as well as the sequences of
the 6-FAM, HEX, and TET dyes 5'-labeled primers (Amplimmun) corresponding to the 21 variable segments of the TCR beta chain used in
this study have been published previously.26 Data analysis was performed using the Genescan analysis software.
Telomere fluorescence in situ hybridization and flow cytometry (flow FISH) All procedures have been described before.27,28 FACS analysis was performed with a gate on lymphocytes and telomere fluorescence was calculated by subtracting the mean fluorescence of the background control (no probe) from the mean telomere fluorescence obtained from cells hybridized with the telomere probe after calibration with FITC-labeled fluorescent calibration beads (Quantum-24 Premixed; Flow Cytometry Standards, San Juan, Puerto Rico) and conversion into molecules of equivalent soluble fluorochrome (MESF) units. To calculate the telomere length (in base pairs) from the telomere fluorescence in MESF units, the slope (y = 0.019x) of the calibration curve previously described27 was used in the equation bP = MESF × 0.026 × 0.019 × 103.
Phenotypes of TLGL cells We studied 5 patients diagnosed with TLGL leukemia based on the invariable presence of high numbers of CD3+ LGLs in their blood. During the study, their disease course remained indolent and only one patient (LGL 1) needed treatment with antibiotics for recurrent infections. Lymphocytosis (7 ± 0.9, range 5.9-7.5 G/L) was observed in all but one patient (LGL 5). The left panel of Figure 1 shows that the majority of lymphocytes were CD8+ T cells of which at least 30% to 90% expressed the C-type lectin-like killer cell receptor CD94.18
CD8 expression was either normal (LGL 2, LGL 3), slightly reduced (LGL
1, LGL 5), or dim (LGL 4). In the latter patient, these cells
coexpressed the CD4 molecule. To study other phenotypic markers of LGL
cells, we gated on the virtually monoclonal population (Figure
2) of CD8+CD94+ cells in LGL 1, LGL 2, LGL 3, and LGL 5 or on the CD8dimCD94+ cells in
LGL 4. As shown in the second panel of Figure 1, these cells were
almost homogeneous with respect to the expression of the CD45R-isoforms
and of CD27. The TLGLs in LGL 1, LGL 3, and LGL 5 were
CD8+CD45RAbrightCD27
To study the prevalence of T cells with a TLGL phenotype in healthy
controls, we analyzed the expression of the respective surface markers
in a panel of 27 healthy blood donors (BD). In 25 of 27 of the
individuals, we detected low numbers (1%-5%, see BD 1, Figure 1, for
a representative example) of CD8+CD94+ T cells
that coexpressed the various combinations of CD45RA, CD45RO, CD27, and
CD57 that can be expressed by effector/memory CD8+ T
cells.16 Among these cells, a minor part was indeed
CD45RA+CD27 Large expansions of CD8+CD94+ T cells are monoclonal in nature Figure 2 shows the spectratype analysis of the TCR BV families in the LGL leukemia patients as well as in BD 2 and BD 3. Analysis was performed on mononuclear cells (MNCs; left panel) as well as on the cells with the TLGL phenotype (right panel) that were FACS-sorted using the windows shown in Figure 1. Spectratyping of the MNC samples of LGL 1 and LGL 2 with a pool of primers specific for BV9, BV15, BV17, and BV21 generated a peak that entirely dominated the 4 Gaussian curves of 7 to 9 peaks that these primers generate in healthy controls.26 Furthermore, the CD16+ and CD16 cells in LGL 1 used the
same TCR, showing that this surface marker can be expressed with a
similar intraclonal variation as has been reported for
CD57.6 Also in the other 3 patients, who still had cells
with a heterogeneous phenotype (Figure 1) and with a normal polyclonal
TCR repertoire (Figure 2, left panel), the cells sorted on the basis of
their CD8+CD94+ phenotype were also practically
monoclonal. This was in sharp contrast to the individuals with only
minor populations of T cells with a TLGL phenotype where the TCR
repertoire of these cells was polyclonal (data not shown).
Interestingly, the CD8+CD94+ cells in the 2 blood donors with the persisting high numbers of
CD8+CD94+ T cells were also monoclonal, or in
the case of BD 3, biclonal. Altogether, this suggests that high numbers
of CD8+CD94+ T cells are usually caused by the
expansion of only one or 2 cells. Although such a massive expansion
might be rare, it still occurs frequently enough to cause a monoclonal,
or as has been showed in 20% of the cases,32 a biclonal
expansion in a relatively high number of individuals.
The telomere lengths of TLGL cells are comparable to those of chronically stimulated CD8 effector cells Telomeres are specialized structures at the end of chromosomes that shorten with each cell division. Therefore, the telomere length in T cells reflects their mitotic history and the number of divisions of a memory/effector cell can be estimated by comparing its telomere length with that of a naive T cell. CD8 effector cells are terminally differentiated cells that undergo very few cell divisions after being generated from central memory cells. Expansion of the antigen-specific clone occurs in the pre-effector/central memory stage and therefore the telomere length of memory and effector cells is quite similar.27 We argued that if a TLGL cell were leukemic, the constant ratio between the telomere length of normal CD8 effector cells and that of the other leukocytes in the blood of the same individual33 would be lost. Interestingly, the telomere data of LGL 2, LGL 5, and BD 2 (similar results were obtained for LGL 1, LGL 3, LGL 4, and BD 3) in Figure 3 show that this is not the case.
In all 5 patients as well as in the 2 blood donors with the large
TLGL-like expansions, the telomere length of the lymphocytes showed a
bimodal distribution with population sizes of cells with short
telomeres being proportional to population sizes of monoclonal cells
found by spectratyping. Importantly, the difference in telomere length
between the expanded clone and the other lymphocytes or monocytes in
the same individual was comparable (Figure 3). In LGL 2, representative of a patient with a dominant monoclonal population of
CD8+ cells, the bimodal distribution was completely biased
toward the TLGL CD8+ effector cells with short telomeres,
whereas in LGL 5 and BD 2, the number of cells with short telomeres was
less. However, in all individuals, the difference between the TLGL
cells and the monocytes (dotted line, right panel) was 4 kb to 5 kb,
which is comparable to the difference between effector cells and
monocytes in healthy controls.33 Furthermore, in
all 7 individuals, the length of the telomeres of the expanded clone
was similar TLGL cells express ITAM-harboring killer cell receptors and share many features with functionally active CD8+ effector cells Clinical symptoms of LGL leukemia point to a dysregulation of the immune system. Moreover, the neutropenia might be a result of the high levels of soluble Fas ligand that are produced by the patient's TLGL cells.34 Because these phenomena are hardly compatible with cells expressing CD94 inhibitory receptors with ubiquitous ligands (HLA-E), we determined which NKG2 molecules were expressed by the TLGL cells. In addition, we measured whether the KIRs that had been detected through FACS analysis in LGL 3, LGL 5, and in the 2 blood donors were inhibitory or activating receptors. Because a sort of CD8+CD94+ cells would not yield a 100% pure TLGL population and CD8+CD94+ non-LGL cells might effect the results, we analyzed the killer cell receptors with a PCR method24 that allows the detection of several genes in a single cell. To ascertain that the cell analyzed was a member of the TLGL clone, we determined the TCR BV usage of the single cells FACS-sorted into separate tubes on the basis of the windows of Figure 1. Subsequent analysis was performed on the first 10 cells in which we detected the TCR BV-spectratype band of the dominant clone as the sole TCR transcript. The lower panel (controls) of Table 1 shows that by this method we detected a CD3 transcript in 60% to 90% and a CD94 transcript in
approximately 50% of the cells expressing the clonotypic BV.
Obviously, this indicates the method's lack of sensitivity in
detecting minute amounts of RNA, because cells expressing a TCR should
also transcribe the CD3 molecule that is required for its expression,
while CD94 is very likely transcribed in CD94+ cells.
Therefore, for the killer cell receptor genes for some of which no
transcripts were detected in any of the single cells analyzed, we also
analyzed the transcript in 10 cells sorted with the windows of Figure 1
as controls. Table 1 shows that in 6 of 7 TLGL-like cells, transcripts
for one of the ITAM-associated forms of the NKG2 molecules
(NKG2C/D/E/F) were found, while only LGL 5 coexpressed NKG2A.
Furthermore, all TLGL cells expressed NKG2D, the activating killer cell
receptor not associated with CD94. As expected, no KIR transcripts were
found in LGL 1, LGL 2, and LGL 4, who were negative by FACS analysis.
In the 2 FACS-positive patients, LGL 3 and LGL 5, as well in BD 2 and
BD 3, transcripts for KIRL and for the activating KIRs with a short
cytoplasmic tail (KIRS) were found. Interestingly, the coexpression of
the inhibitory KIRL in LGL 3 was without functional consequences
because the ligands (HLA-Bw4 and HLA-A*030120) for the
KIR3D2 receptor detected by FACS were not expressed by the patient. We
do not know whether this was also the case in LGL 5 and in the 2 blood donors. Here, the cells expressed an array of different KIRs, which
made it impossible by our methods to determine whether the different
receptors that would see their HLA ligands harbored an ITIM or an
ITAM motive.
The middle panel of Table 1 shows that the same cells with most of
their killer cell receptors in activating form expressed granzyme B,
IFN-
CD3+ LGL leukemia is a monoclonal lymphoproliferative disorder that is currently classified as a lymphoid neoplasm.1 However, whereas the neoplastic character of NK-LGL leukemia is evident, this is not so for monoclonal expansions of large granular T lymphocytes of which the clinical and hematologic characteristics are far from being typical for neoplastic disease. For instance, the number of TLGL cells may already stabilize below 2000/µL and spontaneous regressions do occur. Furthermore, in contrast to malignant cells, the TLGL cell is highly differentiated, usually without chromosomal abnormalities,9,35 and invasion of the bone marrow, which is characteristic for other leukemias, is rarely observed.36 In addition, benign clonal expansions of CD8+ T cells are rather common. Hence, the question is where to draw the line between the truly transformed T lymphocyte on the one hand and a normal T cell escaping from homeostatic control on the other. In this study, we show that the most common phenotype of expanded
monoclonal T-cell populations in patients diagnosed with LGL leukemia
is
CD3+CD8+CD45RA+CD27 The reason why TLGL is intuitively classified as a neoplasm is
the presence of the large monoclonal population of T cells. Yet, this
might be less conspicuous for CD8+ T cells than it is for
other leukocytes. The count of cells with a TLGL phenotype in healthy
individuals ranges from 0.2 × 109/L to
0.4 × 109/L and this population is considerably less
diverse than other T-cell populations.39,40 Moreover, we
noticed that higher numbers of cells with a TLGL phenotype in healthy
controls were mainly owed to the expansion of only a few clones that
persisted for many years. It has been shown that more than 50% of the
CD8+CD27 Several reports have suggested that the abnormal clonal size of TLGL is
owed to a defect in apoptosis,3,15,42 the pathway of
programmed cell death confining the clonal size of CD8+ T
cells. However, TLGL cells are only refractory to apoptosis when tested
directly ex vivo but become sensitive after a short culture in
vitro,15,43 which again is not so different from normal
CD8+ effector cells.43 Likewise, the
expression of the It is not clear why in the same individual only a few CD8+
T cells escape from the homeostatic mechanisms. With age, a continuous spectrum of different sizes of persisting
CD8+CD27 If TLGL cells resemble normal CD8+ effector cells, what could then be the difference between an apparently healthy individual such as BD 2 or BD 3 with a large expansion of CD8+ effector T cells and a TLGL leukemia patient? Before trying to answer this question, one should not forget that the current criteria for TLGL leukemia fit to many individuals without overt disease.3,5-7 For instance, in our group of patients, only LGL 1 (neutropenia, recurring perirectal abscesses) and LGL 5 (autoimmune polysynovitis) had symptoms that may have hinted at TLGL leukemia. The monoclonal expansions in LGL 2 (upper airway infection without neutropenia) and in LGL 3 (diabetes, chronic obstructive pulmonary disease) were detected only after diagnostic procedures of which the indication was unrelated to TLGL leukemia, whereas for LGL 4 (no clinical symptoms, routine control) the diagnosis was entirely fortuitous. Therefore, many TLGL leukemia patients without severe disease may in fact not be so different from the blood donors BD 2 and BD 3 who were "fortuitously diagnosed with TLGL leukemia" while serving as controls in our study. Hence, the question asked above should be rephrased into "why do so few individuals with large monoclonal T-cell populations suffer from severe disease?" Lamy and Loughran have suggested3 that the clinical manifestations of TLGL leukemia are caused by overproduction of Fas-L or of proinflammatory cytokines, which may subsequently lead to neutropenia and autoimmunity. We believe that it is indeed likely that high numbers of activated and ubiquitous3 effector cells are able to disrupt immune processes or boost autoimmune phenomena that otherwise would remain subclinical for years. However, because most expansions of effector T cells do not cause clinical manifestations, the activation state of the TLGL clone, that is, the number of triggers received by its TCR and/or by its activating killer cell receptors, must also be critical. Whether large clonal expansions of CD8+ effector cells will cause clinical symptoms may thus simply depend on how frequently the antigen recognized by the clone is encountered. When a virus has been at the origin of the initial expansion, reinfection, or in the case of a chronic infection, reactivation of the same virus may trigger the clone. Under these circumstances, additional signals would be received by the activating killer cell receptors specific for stress-induced ligands. Owing to the extremely high numbers of virus-specific cells, the virus will be efficiently dealt with so that all classical symptoms of a viral infection may remain unnoticed. By contrast, the sequel of the activation of so many effector cells will be evident. In these patients, the clinical symptoms of TLGL leukemia would be nothing more than an excessive manifestation of the autoimmune phenomena and/or neutropenia that may occur during common viral infections.
We thank Bertrand Huard for stimulating discussions and critical reading of this manuscript.
Submitted August 8, 2002; accepted December 3, 2002.
Prepublished online as Blood First Edition Paper, December 12, 2002; DOI 10.1182/blood-2002-08-2408.
Supported by a grant from the Swiss National Science Foundation (no. 3100-65'357.01) by the Dr Henri Dubois-Ferrière-Dinu Lipatti Foundation and by the Fondation pour la Lutte contre le Cancer.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Eddy Roosnek, Unité d'Immunologie de Transplantation, Hôpital cantonal universitaire de Genève, 24 rue Micheli-du-Crest, CH-1211 Genève 14, Switzerland; e-mail: roosnek{at}medecine.unige.ch.
1.
Harris NL, Jaffe ES, Stein H, et al.
A revised European-American classification of lymphoid neoplasms: a proposal from the International Lymphoma Study Group.
Blood.
1994;84:1361-1392
2.
Harris NL, Jaffe ES, Diebold J, et al.
World Health Organization classification of neoplastic diseases of the hematopoietic and lymphoid tissues: report of the Clinical Advisory Committee meeting, Airlie House, Virginia, November 1997.
J Clin Oncol.
1999;17:3835-3849 3. Lamy T, Loughran TP. Current concepts: large granular lymphocyte leukemia. Blood Rev. 1999;13:230-240[CrossRef][Medline] [Order article via Infotrieve]. 4. Scott CS, Richards SJ, Sivakumaran M, et al. Transient and persistent expansions of large granular lymphocytes (LGL) and NK-associated (NKa) cells: the Yorkshire Leukaemia Group Study. Br J Haematol. 1993;83:505-515[Medline] [Order article via Infotrieve]. 5. Pandolfi F, Loughran TP, Starkebaum G, et al. Clinical course and prognosis of the lymphoproliferative disease of granular lymphocytes: a multicenter study. Cancer. 1990;65:341-348[CrossRef][Medline] [Order article via Infotrieve]. 6. Richards SJ, Short M, Scott CS. Clonal CD3+CD8+ large granular lymphocyte (LGL)/NK-associated (NKa) expansions: primary malignancies or secondary reactive phenomena? Leuk Lymphoma. 1995;17:303-311[Medline] [Order article via Infotrieve].
7.
Semenzato G, Zambello R, Starkebaum G, Oshimi K, Loughran TP Jr.
The lymphoproliferative disease of granular lymphocytes: updated criteria for diagnosis.
Blood.
1997;89:256-260 8. Bartlett NL, Longo DL. T-small lymphocyte disorders. Semin Hematol. 1999;36:164-170[Medline] [Order article via Infotrieve].
9.
Dhodapkar MV, Li CY, Lust JA, Tefferi A, Phyliky RL.
Clinical spectrum of clonal proliferations of T-large granular lymphocytes: a T-cell clonopathy of undetermined significance?
Blood.
1994;84:1620-1627
10.
Posnett DN, Sinha R, Kabak S, Russo C.
Clonal populations of T cells in normal elderly humans: the T cell equivalent to "benign monoclonal gammapathy."
J Exp Med.
1994;179:609-618
11.
Ku CC, Kappler J, Marrack P.
The growth of the very large CD8(+) T cell clones in older mice is controlled by cytokines.
J Immunol.
2001;166:2186-2193 12. Mollet L, Fautrel B, Leblond V, et al. Leukemic CD3+ LGL share functional properties with their CD8+ CD57+ cell counterpart expanded after BMT. Leukemia. 1999;13:230-240[CrossRef][Medline] [Order article via Infotrieve].
13.
Zambello R, Trentin L, Facco M, et al.
Analysis of TNF-receptor and ligand superfamily molecules in patients with lymphoproliferative disease of granular lymphocytes.
Blood.
2000;96:647-654 14. Lamy T, Loughran TP. Large granular lymphocyte leukemia. Cancer Control. 1998;5:25-33[Medline] [Order article via Infotrieve].
15.
Lamy T, Liu JH, Landowski TH, Dalton WS, Loughran TP Jr.
Dysregulation of CD95/CD95 ligand-apoptotic pathway in CD3(+) large granular lymphocyte leukemia.
Blood.
1998;92:4771-4777
16.
Hamann D, Kostense S, Wolthers KC, et al.
Evidence that human CD8(+)CD45RA+CD27(-) cells are induced by antigen and evolve through extensive rounds of division.
Int Immunol.
1999;11:1027-1033
17.
Cambiaggi A, Orengo AM, Meazza R, et al.
The natural killer-related receptor for HLA-C expressed on T cells from CD3+ lymphoproliferative disease of granular lymphocytes displays either inhibitory or stimulatory function.
Blood.
1996;87:2369-2375 18. Hoffmann T, De Libero G, Colonna M, et al. Natural killer-type receptors for HLA class I antigens are clonally expressed in lymphoproliferative disorders of natural killer and T-cell type. Br J Haematol. 2000;110:525-536[CrossRef][Medline] [Order article via Infotrieve].
19.
Casado LF, Granados E, Algara P, Navarro F, Martinez-Frejo MC, Lopez-Botet M.
High expression of the ILT2 (LIR-1) inhibitory receptor for major histocompatibility complex class I molecules on clonal expansions of T large granular lymphocytes in asymptomatic patients.
Haematologica.
2001;86:457-463 20. Lanier LL. NK cell receptors. Annu Rev Immunol. 1998;16:359-393[CrossRef][Medline] [Order article via Infotrieve]. 21. Long EO. Regulation of immune responses through inhibitory receptors. Annu Rev Immunol. 1999;17:875-904[CrossRef][Medline] [Order article via Infotrieve]. 22. Moretta L, Biassoni R, Bottino C, Mingari MC, Moretta A. Human NK-cell receptors. Immunol Today. 2000;21:420-422[CrossRef][Medline] [Order article via Infotrieve]. 23. Andre P, Biassoni R, Colonna M, et al. New nomenclature for MHC receptors. Nat Immunol. 2001;2:661[CrossRef][Medline] [Order article via Infotrieve]. 24. Brady G, Iscove NN. Construction of cDNA libraries from single cells. Methods Enzymol. 1993;225:611-623[Medline] [Order article via Infotrieve].
25.
Sauvageau G, Lansdorp PM, Eaves CJ, et al.
Differential expression of homeobox genes in functionally distinct CD34+ subpopulations of human bone marrow cells.
Proc Natl Acad Sci U S A.
1994;91:12223-12227
26.
Dumont-Girard F, Roux E, Van Lier RA, et al.
Reconstitution of the T cell compartment after bone marrow transplantation: restoration of the repertoire by thymic emigrants.
Blood.
1998;92:4464-4471 27. Rufer N, Dragowska W, Thornbury G, Roosnek E, Lansdorp PM. Telomere length dynamics in human lymphocyte subpopulations measured by flow cytometry. Nat Biotechnol. 1998;16:743-747[CrossRef][Medline] [Order article via Infotrieve].
28.
Rufer N, Brümmendorf TH, Chapuis B, et al.
Accelerated telomere shortening is limited to the first year following stem cell transplantation.
Blood.
2001;97:575-577
29.
Baars PA, Maurice MM, Rep M, Hooibrink B, Van Lier RA.
Heterogeneity of the circulating human CD4+ T cell population: further evidence that the CD4+CD45RA
30.
Hamann D, Baars P, Rep MHG, et al.
Phenotypic and functional separation of memory and effector human CD8+ T cells.
J Exp Med.
1997;186:1407-1418 31. Melenhorst JJ, Sorbara L, Kirby M, Hensel NF, Barrett AJ. Large granular lymphocyte leukaemia is characterized by a clonal T-cell receptor rearrangement in both memory and effector CD8+ lymphocyte populations. Br J Haematol. 2001;112:189-194[CrossRef][Medline] [Order article via Infotrieve]. 32. Lima M, Teixeira MA, Queiros ML, et al. Immunophenotypic characterization of normal blood CD56+lo versus CD56+hi NK-cell subsets and its impact on the understanding of their tissue distribution and functional properties. Blood Cells Mol Dis. 2001;27:731-743[CrossRef][Medline] [Order article via Infotrieve].
33.
Rufer N, Brummendorf TH, Kolvraa S, et al.
Telomere fluorescence measurements in granulocytes and T lymphocyte subsets point to a high turnover of hematopoietic stem cells and memory T cells in early childhood.
J Exp Med.
1999;190:157-167
34.
Liu JH, Wei S, Lamy T, et al.
Chronic neutropenia mediated by fas ligand.
Blood.
2000;95:3219-3222 35. Wong KF, Chan JC, Liu HS, Man C, Kwong YL. Chromosomal abnormalities in T-cell large granular lymphocyte leukaemia: report of two cases and review of the literature. Br J Haematol. 2002;116:598-600[CrossRef][Medline] [Order article via Infotrieve].
36.
Morice WG, Kurtin PJ, Tefferi A, Hanson CA.
Distinct bone marrow findings in T-cell granular lymphocytic leukemia revealed by paraffin section immunoperoxidase stains for CD8, TIA-1, and granzyme B.
Blood.
2002;99:268-274
37.
Bauer S, Groh V, Wu J, et al.
Activation of NK cells and T cells by NKG2D, a receptor for stress-inducible MICA.
Science.
1999;285:727-729 38. Sutherland CL, Chalupny NJ, Cosman D. The UL16-binding proteins, a novel family of MHC class I-related ligands for NKG2D, activate natural killer cell functions. Immunol Rev. 2001;181:185-192[CrossRef][Medline] [Order article via Infotrieve]. 39. Morley JK, Batliwalla F, Hingorani R, Gregersen PK. Oligoclonal CD8+ T cells are preferentially expanded in the CD57+ subset. J Immunol. 1995;154:6182-6190[Abstract].
40.
Posnett DN, Edinger JW, Manavalan JS, Irwin C, Marodon G.
Differentiation of human CD8 T cells: implications for in vivo persistence of CD8+ CD28 41. Lantelme E, Granziero L, Angman L, Giachino C. Clonal predominance, but preservation of a polyclonal reservoir, in the normal alpha beta T-cell repertoire. Hum Immunol. 1997;53:49-56[CrossRef][Medline] [Order article via Infotrieve]. 42. Camagna A, Cedrone L, Care A, et al. Short report: polyclonal expansion of CD3+/CD4+/CD56+ large granular lymphocytes and autoimmunity associated with dysregulation of Fas/FasL apoptotic pathway. Br J Haematol. 2001;112:204-207[CrossRef][Medline] [Order article via Infotrieve]. 43. Melenhorst JJ, Brummendorf TH, Kirby M, Lansdorp PM, Barrett AJ. CD8+ T cells in large granular lymphocyte leukemia are not defective in activation- and replication-related apoptosis. Leuk Res. 2001;25:699-708[CrossRef][Medline] [Order article via Infotrieve].
44.
Zambello R, Facco M, Trentin L, et al.
Interleukin-15 triggers the proliferation and cytotoxicity of granular lymphocytes in patients with lymphoproliferative disease of granular lymphocytes.
Blood.
1997;89:201-211 45. Bulfone-Paus S, Ungureanu D, Pohl T, et al. Interleukin-15 protects from lethal apoptosis in vivo. Nat Med. 1997;3:1124-1128[CrossRef][Medline] [Order article via Infotrieve]. 46. Mackall CL, Bare CV, Granger LA, et al. Thymic-independent T cell regeneration occurs via antigen-driven expansion of peripheral T cells resulting in a repertoire that is limited in diversity and prone to skewing. J Immunol. 1996;156:4609-4616[Abstract].
© 2003 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
M. W. Wlodarski, Z. Nearman, A. Jankowska, N. Babel, J. Powers, P. Leahy, H.-D. Volk, and J. P. Maciejewski Phenotypic differences between healthy effector CTL and leukemic LGL cells support the notion of antigen-triggered clonal transformation in T-LGL leukemia J. Leukoc. Biol., March 1, 2008; 83(3): 589 - 601. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Barbey, E. Pradervand, N. Barbier, and F. Spertini Ex Vivo Monitoring of Antigen-Specific CD4+ T Cells after Recall Immunization with Tetanus Toxoid Clin. Vaccine Immunol., September 1, 2007; 14(9): 1108 - 1116. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Lin, M. Nieda, J. F. Hutton, V. Rozenkov, and A. J. Nicol Comparative gene expression analysis of NKT cell subpopulations J. Leukoc. Biol., July 1, 2006; 80(1): 164 - 173. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. R. Ruprecht, M. Gattorno, F. Ferlito, A. Gregorio, A. Martini, A. Lanzavecchia, and F. Sallusto Coexpression of CD25 and CD27 identifies FoxP3+ regulatory T cells in inflamed synovia J. Exp. Med., June 6, 2005; 201(11): 1793 - 1803. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Gniadecki and A. Lukowsky Monoclonal T-Cell Dyscrasia of Undetermined Significance Associated With Recalcitrant Erythroderma Arch Dermatol, March 1, 2005; 141(3): 361 - 367. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Rufer, A. Zippelius, P. Batard, M. J. Pittet, I. Kurth, P. Corthesy, J.-C. Cerottini, S. Leyvraz, E. Roosnek, M. Nabholz, et al. Ex vivo characterization of human CD8+ T subsets with distinct replicative history and partial effector functions Blood, September 1, 2003; 102(5): 1779 - 1787. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Lima, J. Almeida, M. dos Anjos Teixeira, M. d. C. Alguero, A. H. Santos, A. Balanzategui, M. L. Queiros, P. Barcena, A. Izarra, S. Fonseca, et al. TCR{alpha}{beta}+/CD4+ Large Granular Lymphocytosis: A New Clonal T-Cell Lymphoproliferative Disorder Am. J. Pathol., August 1, 2003; 163(2): 763 - 771. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2003 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||