|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
Prepublished online as a Blood First Edition Paper on December 12, 2002; DOI 10.1182/blood-2002-04-1212.
RED CELLS
From the Department of Biotechnology, Kyoto Institute
of Technology, Japan; First Department of Physiology,
Kansai Medical University, Japan; and Biomedical Imaging
Research Center, Fukui Medical University, Japan.
A mitochondrial half-type ATP-binding cassette (ABC) protein, ABC7,
plays a role in iron homeostasis in mitochondria, and defects in human
ABC7 were shown to be responsible for the inherited disease X-linked
sideroblastic anemia/ataxia. We examined the role of ABC7 in the
biosynthesis of heme in erythroid cells where hemoglobin is a major
product of iron-containing compounds. RNA blots showed that the amount
of ABC7 mRNA in dimethylsulfoxide (Me2SO)-treated mouse
erythroleukemia (MEL) cells increased markedly in parallel with the
induction of the mRNA expression of ferrochelatase, the last enzyme in
the pathway to synthesize heme. The transfection of the antisense
oligonucleotide to mouse ABC7 mRNA into Me2SO-treated MEL
cells led to a decrease of heme production, as compared with sense
oligonucleotide-transfected cells. ABC7 protein was shown to be
colocalized with ferrochelatase in mitochondria, as assessed by
immunostaining. Furthermore, in vitro and in vivo pull-down assays
revealed that ABC7 protein is interacted with the carboxy-terminal region containing the iron-sulfur cluster of ferrochelatase. The transient expression of ABC7 in mouse embryo liver BNL-CL2 cells resulted in an increase in the activity and level of ferrochelatase and
thioredoxin, a cytosolic protein containing iron-sulfur. These increases were also observed in MEL cells stably expressing ABC7. When
ABC7 transfectants were treated with Me2SO, an increase in cellular heme concomitant with a marked induction of the expression of
ferrochelatase was observed. The extent of these increases was 3-fold
greater than in control cells. The results indicated that ABC7
positively regulates not only the expression of extramitochondrial thioredoxin but also that of an intramitochondrial
iron-sulfur-containing protein, ferrochelatase. Then, the expression
of ABC7 contributes to the production of heme during the
differentiation of erythroid cells.
(Blood. 2003;101:3274-3280) As the last step in the pathway to synthesize heme,
ferrochelatase catalyzes the insertion of ferrous ions into
protoporphyrin IX to form protoheme, and the eukaryotic enzyme is
located in the inner membrane facing the matrix of the
mitochondrion.1 The mammalian enzyme is nuclear-encoded as
a precursor and translocated into the mitochondrion where the enzyme is
proteolytically processed to its mature form of 41 to 42 kDa.2 The mammalian enzyme contains a cluster of
[2Fe-2S] molecules at the carboxy-terminal.3,4 Human
ferrochelatase mutated in this region was reported to be inactive.3-5 Thus, the iron-sulfur cluster is essential
for the enzyme activity, although the cluster itself is not involved in the binding of ferrous ions as the substrate.4,5
Furthermore, the expression of ferrochelatase was regulated by
intracellular levels of iron via the cluster.6 However,
the biogenesis of the iron-sulfur cluster in the mammalian
ferrochelatase is not well understood.
Iron is not only a substrate for the biosynthesis of heme but also
utilized in the formation of non-heme iron proteins in the
mitochondria, where the main prosthetic group of enzyme subunits for
respiratory chain complexes contains an iron-sulfur cluster. Recently,
3 gene products of a half-type ATP-binding cassette (ABC) transporter,
MTABC3, ABC7, and ABC-me, located in mammalian mitochondria have been
characterized.7-10 A yeast homolog of the mitochondrial
transporter, Atm1p, was shown to promote the mitochondrial iron metabolism and to be involved in the biosynthesis of cytosolic iron-sulfur-containing proteins.11,12 Atm1p-deficient
strains have been shown to accumulate iron in
mitochondria,12,13 and ABC7 and MTABC3 proteins were able
to complement the deficiency in yeast.14,15 In human
beings, defects in ABC7 cause the mitochondrial accumulation of iron in
the inherited disorder sideroplastic anemia, an X-linked recessive
disease.9,15 ABC-me is highly expressed in tissues related
to hematopoiesis. Its induction was observed during erythroid
maturation, and its overexpression in mouse erythroleukemia (MEL) cells
led to an enhanced biosynthesis of hemoglobin.10 Another
half-type ABC transporter, MTABC3, has been isolated recently and when
expressed in yeast ABC3 complemented the accumulation of iron in
mitochondria caused by the defect in Atm1p.7 It has been
demonstrated that the import of iron into yeast mitochondria to be
utilized as a substrate for ferrochelatase was dependent on membrane
potential as an energy source.16 It is unclear, however,
whether the iron transporter supplying ferrochelatase is also involved
in importing iron into the mitochondrial matrix for the biogenesis of
the iron-sulfur cluster. Moreover, the roles of mitochondrial ABC
transporters in heme biosynthesis have received little attention. We
focused on the involvement of ABC7 in the biosynthesis of heme in
erythroid cells where hemoglobin is the predominant iron-containing
product. We report here the induction of ABC7 mRNA expression during
dimethylsulfoxide (Me2SO)-induced differentiation of MEL
cells. The importance of the interaction of ABC7 with ferrochelatase,
and the subsequent increase in ferrochelatase activity, to the
regulation of heme biosynthesis is also shown.
Materials
DNA probes
Plasmids The full-length cDNA of mouse ABC7 was isolated by PCR using an Me2SO-induced MEL cell cDNA library.19 The primers used were AAGAATTCATGGCGTGCCGATA and AAAAGCTTGGGCAGGAACAATTTCCAC. The DNA fragment was digested with EcoRI and HindIII and ligated into EcoRI-HindIII-digested pcDNA3.1(-)/Myc-His B. The resulting plasmid (pcDNA3(c-Myc)-ABC7) was transformed into Escherichia coli XL1-Blue. pCD-MF carrying the entire mouse ferrochelatase cDNA was as described.18 To construct glutathione-S-transferase (GST) fusion protein expression plasmids, portions of mouse ABC7 cDNA were amplified by PCR and the resulting fragments were ligated into pGEX-4T vector (Amersham-Pharmacia). The plasmids thus constructed were pGEX/ABCG1188-2087, pGEX/ABCG1388-2087, and pGEX/ABCG1608-2087 (numbers indicate the base position of mouse ABC7 cDNA),19 which encoded the ABC7 subfragment fused with GST designated as GST-ABC7 (458-752), GST-ABC7 (521-752), and GST-ABC7 (596-752), respectively (numbers indicate the amino acid positions of mouse ABC7 protein). These proteins were expressed in E coli (strain: DH-5 ) with 0.3 mM
isopropyl-1-thio- -D-galactoside at 25°C for 12 hours.
Mouse ferrochelatase was also expressed in E coli as
follows: the vector pAR20 linearized by digestion with
NdeI and EcoRI was ligated with a whole insert
derived from mouse ferrochelatase cDNA,18 and the
resulting plasmid was designated pAR-MF, which expresses the mouse
ferrochelatase lacking a putative leader peptide in the E
coli expression system.18,20 To make pAR-MF-N395 ,
which lacks the C-terminal 25 amino acids corresponding to the region
of the iron-sulfur cluster of mouse ferrochelatase,6,18 2 primers, 5'-AACATATGACCACCAAACCCCAAGC-3' and
5'-ATGAATTCTCACAGCTTGTTGGATGTGGA-3', were synthesized. pAR-MF was
digested with EcoRI and used as a template. The nucleotide
sequence of each construct was verified by DNA sequencing.
Partial purification of ferrochelatase Ferrochelatase (wild-type and N395) expressed in E
coli was partially purified using Blue-Sepharose
beads.20 The proteins were dialyzed against 10 mM Tris
(tris(hydroxymethyl)aminomethane)-HCl (pH 8.0) containing 20%
glycerol, 0.2% Tween 20, 1 mM dithiothreitol (DTT), and 2 mM EDTA
(ethylenediaminetetraacetic acid).
Preparation of protein extracts and binding assay GST fusion proteins were expressed in E coli. The cells were resuspended in lysis buffer (50 mM Tris-HCl [pH 7.5], 150 mM NaCl, 0.5% Tween 20, 10% glycerol, 1 mM DTT, and 0.1 mM phenylmethylsulfonyl fluoride [PMSF]) and then lysed by brief sonication. The GST fusion proteins were purified with glutathione (GSH)-Sepharose 4B beads in accordance with the manufacturer's instructions. For binding assays, beads (30 to 100 µL) bound to GST fusion protein were used. The amount of protein used was estimated by staining the polyacrylamide gel with Coomassie blue. Binding assays were performed in a total volume of 400 µL containing partially purified ferrochelatase. The mixture was rotated on a wheel at 4°C for 6 hours. The beads were pelleted by centrifugation at 2000 rpm and washed 5 times with ice-cold lysis buffer. After the final wash, the pellets were boiled in SDS-PAGE gel loading buffer for 1 minute and Western blotting was performed.Cell cultures Mouse erythroleukemia (MEL) cells, mouse embryonic liver BNL-CL2 cells, and monkey kidney Cos7 cells were grown in Dulbecco modified Eagle medium (DMEM) supplemented with 10% fetal calf serum (FCS) and antibiotics. BNL-CL2 and Cos7 cells were transfected with 2 µg of the plasmid using the transfection reagent Lipofectamine Plus (Invitrogen Life Technologies, Tokyo, Japan) for 4 to 5 hours according to the manufacturer's recommendation. The cells were then incubated first in DMEM supplemented with 10% fetal calf serum for 5 hours and subsequently in the absence or presence of desferrioxamine for 16 hours. The amounts of heme and porphyrin in the cells were determined as previously described.6Transfection of oligonucleotides Phosphorothioate sense and antisense oligonucleotides corresponding to mouse ABC7 (nucleotide position: 20-40),19 MTABC3 (22-42),7 and ABC-me (1-21)10 were synthesized and purified. MEL cells cultured in the presence of 2% Me2SO for 30 hours were collected and rinsed twice with serum-free DMEM. Phosphothioate antisense or sense oligonucleotides (10 µM) were transfected into the cells using a DOTAP transfection reagent (Roche Molecular Biochemicals, Mannheim, Germany). After 6 hours of incubation, the medium was changed to DMEM containing 7% FCS and antibiotics. The cells were further treated with 2% Me2SO for 18 hours and then collected.Immunostaining For immunostaining, cultured cells were fixed with 4% paraformaldehyde in phosphate-buffered saline (PBS) containing 1 mM CaCl2 and 0.5 mM MgCl2 (PBS [+]) for 20 minutes and permeabilized with 0.1% Triton X-100 in PBS (+) for 30 minutes. The cells were incubated with anti-c-Myc as described.21 After a wash with PBS (+), they were incubated with a fluorolink cyanine 2 (Cy2)-labeled antimouse immunoglobulin G (IgG) (Amersham-Pharmacia). The cells were then thoroughly washed and incubated with antiferrocheratase followed by a fluorolink Cy3-labeled antirabbit IgG (Amersham-Pharmacia). Fluorescence microscopy was performed with an Olympus microscope (Tokyo, Japan).Stable transfection of MEL cells pcDNA(c-Myc)-ABC7 (10 µg) or pcDNA3 (10 µg) was electroporated into MEL cells as described previously.22 For the selection, G418 at a final concentration of 500 µg/mL was added to the culture medium. After 7 days, the G418-resistant cells were diluted, seeded in a 96-well tissue-culture plate, and cultured in the medium containing 500 µg/mL G418. Individual clones were isolated and tested for the expression of mouse ABC7 by immunoblotting using a monoclonal antibody for c-Myc-tag (clone 9E10). Five ABC7-overexpressing clones were obtained, mixed to avoid clonal variation, and maintained in DMEM medium containing 10% FCS and antibiotics.RNA blots Total RNA was isolated from MEL cells by the guanidium isothiocyanate method.6 The RNA (20 µg) was applied to a 1% agarose gel, electrophoresed, and subsequently transferred onto a nylon membrane (Hybond N+; Amersham-Pharmacia) for hybridization with DNA probes. The filters were hybridized, washed, and exposed to an x-ray film as described.6,18Immunoblotting and immunoprecipitation The lysates from BNL-CL2 cells and Cos7 cells transfected with the empty vector pcDNA3, pcDNA(c-Myc)-ABC7, or pCD-MF were also subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and electroblotted onto polyvinylidene difluoride (PVDF) membrane. Immunoblotting was done with antiferrochelatase, anti-c-Myc-tag, anticatalase, and antithioredoxin antibodies as the primary antibodies.6,22 Immunoprecipitation was performed as described23 using antiferrochelatase or anti-c-Myc (9E10) antibodies.Enzyme assays Ferrochelatase activity was measured, using mesoporphyrin and zinc acetate as substrates, as previously described.6 Catalase activity was measured also as reported previously.24 The protein concentration was estimated by the method of Bradford.25
Expression of ABC-type transporter mRNA in MEL cells treated with Me2SO When treated with 2% Me2SO, MEL cells undergo erythroid differentiation and the production of heme is markedly induced. ABC-me was isolated in Me2SO-treated MEL cells, and its overexpression increased the amounts of hemoglobin produced.10 MTABC3 and ABC7 are known to be involved in iron homeostasis in mitochondria. To clarify whether MTABC3, ABC7, and ABC-me are produced in response to Me2SO treatment, RNA blotting was performed. As shown in Figure 1A, ABC7 mRNA was markedly expressed, in parallel with ferrochelatase mRNA. The induction of MTABC3 and ABC-me expression was also observed but to less of an extent than that of ABC7. Although mitochondrial ABC transporters may be involved in the export of iron to cytoplasm rather than the transport of heme, the major-iron containing product in erythroid cells is hemoglobin. Then the above results may suggest that ABC transporters play an important role in the synthesis of hemoprotein. To examine which ABC transporters affect the differentiation of erythroid cells, MEL cells treated with Me2SO for 30 hours were transfected with antisense oligonucleotide to MTABC3, ABC7, or ABC-me, and the the intracellular level of heme was compared with that in cells treated with the sense oligonucleotide. As shown in Figure 1B, the amount of heme in uninduced MEL cells was similar among all the treated cells. The heme content of Me2SO-exposed MEL cells treated with antisense oligonucleotide to ABC7 mRNA decreased to 75%, as compared with that in cells treated with sense oligonucleotide to ABC7 mRNA. When the cells were treated with antisense oligonucleotides to MTABC3 or ABC-me mRNA, the heme content also decreased but to a lesser extent. These results indicated that ABC7 is tightly associated with synthesis of heme in MEL cells induced by Me2SO.
Interaction of ABC7 with ferrochelatase in vitro To determine whether ABC7 protein can interact with ferrochelatase, GST fusion protein with the entirely soluble C-terminal half of ABC7, containing the adenosine triphosphate (ATP)-binding domain and presumably expanding in the matrix of mitochondria, was coupled to glutathione-Sepharose beads and incubated with a partially purified recombinant mouse ferrochelatase. As shown in Figure 2A, the GST-ABC (458-752) fusion protein was found to associate with ferrochelatase. A weak interaction was observed with GST-ABC (521-752), but deletion of part of the ATP-binding domain (GST-ABC [596-752]) led to a complete loss of interaction. No interaction was observed with GST alone either. Mammalian ferrochelatase contains an iron-sulfur cluster at the carboxy-terminal. When a truncated form of ferrochelatase (N395)
whose carboxy-terminal region was deleted was expressed and incubated
with the GST-ABC7 (458-752) fusion protein, no interaction was observed
(Figure 2B). These results indicated that ABC7 interacted with
ferrochelatase at the carboxy-terminus.
Interaction of ABC7 with ferrochelatase in vivo To examine the localization of ABC7 and ferrochelatase, both their cDNAs were cotransfected into Cos7 cells. The proteins expressed were then stained with antibodies. Ferrochelatase is known to be distributed in the inner membrane of mitochondria. Immunofluorescence analysis with antiferrochelatase indicated that the mouse ferrochelatase appeared predominantly in the mitochondria of Cos7 cells (Figure 3A). Protein extracts prepared from cells expressing ferrochelatase and/or c-Myc-tagged ABC7 were analyzed by immunoblotting (Figure 3B). The expression of mouse ferrochelatase with a molecular mass of 42 kDa markedly increased on transfection with pCD-MF. Endogenous ferrochelatase was detected as a faint band of immunoprecipitates only in the cells transfected with ABC7 cDNA. When c-Myc-tagged ABC7 was expressed, the monoclonal antibody for c-Myc reacted only with a protein in the mitochondria (Figure 3A). A protein of about 80 kDa was detected by immunoblotting (Figure 3B). The merged pattern showed that the 2 stainings matched well, indicating that the proteins have a similar location. To demonstrate that ferrochelatase could interact with ABC7 protein, coimmunoprecipitation analysis was performed. Immunoprecipitation of the cell extracts with monoclonal antibody for c-Myc, followed by immunoblot analysis using antiferrochelatase, revealed that ferrochelatase was present in c-Myc immunoprecipitates (Figure 3C). Conversely, immunoprecipitation with antiferrochelatase, followed by immunoblot analysis using anti-c-Myc, revealed that ABC7 was present in ferrochelatase immunoprecipitates from cells transfected with ABC7 cDNA (Figure 3D). These results confirmed the association between ferrochelatase and ABC7.
Positive role for ABC7 in heme biosynthesis in nonerythroid and erythroid cells We next transfected ABC7 cDNA into mouse embryo liver BNL-CL2 cells and examined the ferrochelatase activity. The activity in cells transiently expressing ABC7 increased, as compared with that in empty vector-transfected cells (Figure 4A). Catalase activity was also examined, but the activity was not changed by the expression of ABC7 (Figure 4B). Immunoblot analysis confirmed that the amount of ferrochelatase in transfected cells also increased (Figure 4C). Bekri et al reported that expression of ABC7 inatm1
yeast restores the formation of extramitochondrial iron-sulfur cluster proteins.9 Then we examined the level of thioredoxin, a
cytosolic iron-sulfur cluster protein in BNL-CL2 cells transiently
expressing ABC7. As shown in Figure 4C, the amount of thioredoxin
increased in the transfected cells as compared with the controls,
whereas that of catalase did not change on the expression of
ABC7.
To generate MEL cells stably expressing mouse ABC7, pcDNA(c-Myc)-ABC
was transfected and G418-resistant cells were selected. Five clones
stably expressing ABC7 were isolated and mixed, and the expression of
ABC7 was examined by immunoblotting. A specific band reacting with
anti-c-Myc-tag in ABC7 cDNA-transfected cells was detected (data not
shown). Figure 5A shows the amount of
heme in ABC7-expressing MEL cells. The amount in uninduced
ABC7-transfectants was about 2.5-fold higher than that in empty
vector-transfected cells. The growth rate of MEL cells expressing ABC7
was similar to that of control cells. To cause the MEL cells to
differentiate, they were treated with 2%Me2SO. The amount
of heme in the ABC7 transfectants increased sharply with time, whereas
the production of heme in control MEL cells treated with
Me2SO started slowly. At 120 hours after the induction, the
level of heme in ABC7 transfectants was about 2.5-fold that in the
control cells. When the amounts of ferrochelatase and thioredoxin were
compared between ABC7-expressing and control cells, both were found to
be higher in the former (Figure 5B). On treatment with
Me2SO, the amounts of ferrochelatase and thioredoxin
increased in control cells. In ABC7 transfectants, treatment with
Me2SO increased the expression of ferrochelatase while
decreasing that of thioredoxin. Thus, the expression of ABC7 led to an
increase in the production of heme in nonerythroid and erythroid cells
and to an accelerated induction of differentiation of MEL cells.
The present study has demonstrated the involvement of ABC7 in the biosynthsis of heme via interaction with ferrochelatase. Comparison of the mRNA levels of 3 known ABC transporters during the differentiation of MEL cells revealed that MTABC3, ABC7, and ABC-me mRNAs were all induced to express, and the extent of induction was greatest for ABC7 mRNA. Furthermore, the expression of ABC7 mRNA during the cellular differentiation paralleled that of ferrochelatase. The importance of ABC7 in the iron-dependent regulation of ferrochelatase led us to examine its involvement in the biosynthesis of heme in erythroid cells where heme is a major product of iron metabolism. Antisense oligonucleotide to ABC7 mRNA caused inhibition of the biosynthesis of heme in Me2SO-treated MEL cells, and MEL cells overexpressing ABC7 contained 2.5-fold more heme than control MEL cells. The induction of ABC7 during the differentiation of MEL cells roughly parallels that of ABC-me, MTABC3, and the heme-biosynthetic enzymes. The low level of expression of the ABC-me transcript in GATA-1-negative erythroid colonies was explained by the GATA-1-controlled expression of ABC-me.10 Because several putative binding sequences for factors involved in erythroid cell differentiation, including GATA-1 and E-box, were found in the promoter region of the human ABC7 gene,9 the transcription of ABC7 can be controlled by GATA-1 and an erythroid-specific E-box-activating factor, Tal1. Mitochondria play roles in many essential and specialized functions during erythroid differentiation, including the synthesis of hemoglobin, production of energy, integration of apoptotic signals, and gradual self-elimination. Although the site and role of ABC7 involvement in iron homeostasis is unclear, the effects of the expression of ABC7 in MEL cells favor a role in the production of hemoglobin. Because ABC7 and ABC-me do not induce the spontaneous differentiation of MEL cells,10 the effects of these ABC transporters differed from those of other proteins related to transcription, including Tal-126 and HERF-1,27 which triggered spontaneous differentiation of MEL cells. Thus, these transporters enhance the functions of the hemoglobin synthesis machinery coordinately activated during Me2SO-induced erythroid differentiation. In vitro and in vivo protein-protein interaction experiments revealed
that ABC7 binds specifically to ferrochelatase. The importance of the
carboxy-terminal region that contains the iron-sulfur cluster of
ferrochelatase is highlighted by the inability of a truncated
ferrochelatase (N395 It is reported that yeast mutants lacking Atm1p, a yeast homolog of
ABC7, synthesize heme normally12,13 and heme trafficking is not compromised by the absence,29 suggesting that yeast
ferrochelatase is expressed normally in The import of iron into mitochondria must be tightly regulated because
little accumulation of iron is observed in the mutants defective in
heme biosynthesis,31 but the mechanism of iron metabolism
in mitochondria is unclear. Recently, Arabidopsis at ABC1
was shown to be involved in the synthesis of chlorophyll and required
for the transport and correct distribution of
protoporphyrin.32 Defects in Atm1p in yeast cause a marked
increase in the mitochondrial iron content, and ABC7 expression
complemented to a large extent the failure of We previously reported that the cellular content of heme decreased
slightly when erythroleukemia K562 cells were treated with desferrioxamine, indicating that the decrease in ferrochelatase causes
the decrease in the synthesis of heme.6 However,
protoporphyrin did not accumulate in desferrioxamine-treated K562 cells
where the formation of heme was suppressed. Moreover, no accumulation of any porphyrin was observed in MEL cells treated with antisense oligonucleotide to ABC7 mRNA (K.K., T.F., and S.T., unpublished observations, 2002). In contrast, defects in ferrochelatase
cause the accumulation of protoporphyrin in patients with
erythropoietic protoporphyria,33 a phenomenon inconsistent
with the findings of this study. These results suggest that iron
regulates the de novo synthesis of porphyrin, which is consistent with
the observation that in erythroid cells protoporphyrin IX levels are
coupled to the availability of iron as a result of a translational
induction of erythroid-specific Shirihai et al reported that ABC-me is expressed at high levels in the erythroid tissues of embryos and adults.10 Overexpression of ABC-me in MEL cells enhanced the increase in heme caused by Me2SO, whereas heme suppressed the expression of ABC-me, suggesting that ABC-me plays a role in the trafficking of heme intermediates. The present study demonstrates that ABC7 contributes to the metabolism of heme in mitochondria in a fashion similar to ABC-me. This raises the question of whether the functions of ABC7 and ABC-me differ in the biosynthesis of heme. Considering that mutants deficient in ABC7 exhibit X-linked sideroblastic anemia and mitochondrial ABC transporters function in iron homeostasis,9 ABC-me may be responsible for the unidentified sideroblastic anemia in the autosomal tract. However, it is not clear if a molecular defect of ABC-me is related to this inherited disease. Further study is required to clarify the molecular mechanisms underlying the shared and unique functions of ABC7, MTABC3, and ABC-me during the differentiation of erythroid cells.
We thank Dr Takashi Osumi, Himeji Institute of Technology, for the antibody for rat catalase, and Dr Y. Sokawa for valuable suggestions.
Submitted June 27, 2002; accepted October 31, 2002.
Prepublished online as Blood First Edition Paper, December 12, 2002; DOI 10.1182/blood-2002-04-1212.
Supported in part by grants from the Ministry of Education, Science, Sports and Culture of Japan and the Yamanouchi Foundation for Research on Metabolic Disorders.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Shigeru Taketani, Department of Biotechnology, Kyoto Institute of Technology, Kyoto 606-8585, Japan; e-mail: taketani{at}ipc.kit.ac.jp.
1. Jones MS, Jones OTG. The structural organization of haem synthesis of rat liver mitochondria. Biochem J. 1969;113:507-514[Medline] [Order article via Infotrieve]. 2. Taketani S. Molecular and genetic characterization of ferrochelatase. In: Fujita H, ed. Regulation of Heme Protein Synthesis. Dayton, OH: AlphaMed Press; 1994:41-54. 3. Furukawa T, Kohno H, Tokunaga R, Taketani S. Nitric oxide-mediated inactivation of mammalian ferrochelatase in vivo and in vitro: possible involvement of the iron-sulphur cluster of the enzyme. Biochem J. 1995;310:533-538[Medline] [Order article via Infotrieve]. 4. Ferreira GC. Ferrochelatase. Int J Biochem Cell Biol. 1999;31:995-1000[CrossRef][Medline] [Order article via Infotrieve]. 5. Sellers VM, Johnson MK, Dailey HA. Function of the [2Fe-2S] cluster in mammalian ferrochelatase: a possible role as a nitric oxide sensor. Biochemistry. 1996;35:2699-2704[CrossRef][Medline] [Order article via Infotrieve]. 6. Taketani S, Adachi Y, Nakahashi Y. Regulation of the expression of human ferrochelatase by intracellular iron levels. Eur J Biochem. 2000;267:4685-4692[Medline] [Order article via Infotrieve].
7.
Mitsuhashi N, Miki T, Senbongi H, et al.
MTABC3, a novel mitochondrial ATP-binding cassette protein involved in iron homeostasis.
J Biol Chem.
2000;275:17536-17540 8. Shimada Y, Okuno S, Kawai A, et al. Cloning and chromosomal mapping of a novel ABC transporter gene (hABC7), a candidate for X-linked sideroblastic anemia with spinocerebellar ataxia. J Hum Genet. 1998;43:115-122[CrossRef][Medline] [Order article via Infotrieve].
9.
Bekri S, Kispal G, Lange H, et al.
Human ABC7 transporter: gene structure and mutation causing X-linked sideroblastic anemia with ataxia with disruption of cytosolic iron-sulfur protein maturation.
Blood.
2000;96:3256-3264 10. Shirihai OS, Gregory T, Yu C, et al. ABC-me: a novel mitochondrial transporter induced by GATA-1 during erythroid differentiation. EMBO J. 2000;19:2492-2502[CrossRef][Medline] [Order article via Infotrieve]. 11. Kispal G, Csere P, Prohl C, Lill R. The mitochondrial proteins Atm1p and Nfs1p are essential for biogenesis of cytosolic Fe/S proteins. EMBO J. 1999;18:3981-3989[CrossRef][Medline] [Order article via Infotrieve]. 12. Lill R, Kispal G. Mitochondrial ABC transporters. Res Microbiol. 2001;152:331-340[Medline] [Order article via Infotrieve]. 13. Leighton J, Schatz G. An ABC transporter in the mitochondrial inner membrane is required for normal growth of yeast. EMBO J. 1995;14:188-195[Medline] [Order article via Infotrieve]. 14. Csere P, Lill R, Kispal G. Identification of a human mitochondrial ABC transporter, the functional orthologue of yeast Atm1p. FEBS Lett. 1998;441:266-270[CrossRef][Medline] [Order article via Infotrieve].
15.
Allikmets R, Raskind WH, Hutchinson A, et al.
Mutation of a putative mitochondrial iron transporter gene (ABC7) in X-linked sideroblastic anemia and ataxia (XLSA/A).
Hum Mol Genet.
1999;8:743-749
16.
Lange H, Kispal G, Lill R.
Mechanism of iron transport to the site of heme synthesis inside yeast mitochondria.
J Biol Chem.
1999;274:18989-18996 17. Kohno H, Okuda M, Furukawa T, Tokunaga R, Taketani S. Site-directed mutagenesis of human ferrochelatase: identification of histidine-263 as a binding site for metal ions. Biochim Biophys Acta. 1994;1209:95-100[CrossRef][Medline] [Order article via Infotrieve].
18.
Taketani S, Nakahashi Y, Osumi T, et al.
Molecular cloning, sequencing and expression of mouse ferrochelatase.
J Biol Chem.
1990;265:19377-19380 19. Savary S, Allikmets R, Denizot F, et al. Isolation and chromosomal mapping of a novel ATP-binding cassette transporter conserved in mouse and human. Genomics. 1997;41:275-278[CrossRef][Medline] [Order article via Infotrieve]. 20. Okuda M, Kohno H, Furukawa T, Tokunaga R, Taketani S. Overexpression in Escherichia coli, and one-step purification of the human recombinant ferrochelatase. Biochim Biophys Acta. 1994;1200:123-128[Medline] [Order article via Infotrieve].
21.
Mohri T, Adachi Y, Ikehara S, Hioki K, Tokunaga R, Taketani S.
Activated Rac1 selectively up-regulates the expression of integrin 22. Taketani S, Furukawa T, Furuyama K. Expression of coproporphyrinogen oxidase and synthesis of hemoglobin in human erythroleukemia K562 cells. Eur J Biochem. 2001;268:1705-1711[Medline] [Order article via Infotrieve]. 23. Mohri T, Kameshita I, Suzuki S, et al. Rapid adhesion and spread of non-adherent colon cancer Colo201 cells induced by the protein kinase inhibitors, K252a and KT5720 and suppression of the adhesion by the immunosuppressants FK506 and cyclosporin A. Cell Struct Funct. 1998;23:255-264[Medline] [Order article via Infotrieve].
24.
Taketani S, Tokunaga R.
Rat liver ferrochelatase: purification, properties, and stimulation by fatty acids.
J Biol Chem.
1981;256:12748-12753 25. Bradford MM. A rapid and sensitive method for quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72:248-254[CrossRef][Medline] [Order article via Infotrieve]. 26. Aplan PD, Nakahara K, Orkin SH, Kirsch IR. The SCL gene product: a positive regulator of erythroid differentiation. EMBO J. 1992;11:4073-4081[Medline] [Order article via Infotrieve].
27.
Harada H, Harada Y, O'Brien DP, Rice DS, Naeve CW, Downing JR.
HERF1, a novel hematopoiesis-specific RING finger protein, is required for terminal differentiation of erythroid cells.
Mol Cell Biol.
1999;19:3808-3815 28. Dailey HA, Finnegan MG, Johnson MS. Human ferrochelatase is an iron-sulfur protein. Biochemistry. 1994;33:403-407[CrossRef][Medline] [Order article via Infotrieve]. 29. Kispal G, Csere P, Guiard B, Lill R. The ABC transporter Atm1p is required for mitochondrial iron homeostasis. FEBS Lett. 1997;418:346-350[CrossRef][Medline] [Order article via Infotrieve]. 30. Dailey HA, Dailey TA, Wu CK, et al. Ferrochelatase at the millennium: structures, mechanisms and [2Fe-2S] clusters. Cell Mol Life Sci. 2000;57:1909-1926[CrossRef][Medline] [Order article via Infotrieve]. 31. Tangeras A. Effect of decreased ferrochelatase activity on iron and porphyrin content in mitochondria of mice with porphyria induced by griseofulvin. Biochim Biophys Acta. 1986;882:77-84[Medline] [Order article via Infotrieve].
32.
Moller SG, Kunkel T, Chua NH.
A plastidic ABC protein involved in intercompartmental communication of light signaling.
Genes Dev.
2001;15:90-103 33. Brenner DA, Didier JM, Fraiser F, Christensen SR, Evans GA, Dailey HA. A molecular defect in human protoporphyria. Am J Hum Genet. 1992;50:1203-1210[Medline] [Order article via Infotrieve]. 34. Richardson DR, Ponka P. The molecular mechanisms of the metabolism and transport of iron in normal and neoplastic cells. Biochim Biophys Acta. 1997;1331:1-40[Medline] [Order article via Infotrieve]. 35. Haile DJ. Regulation of genes of iron metabolism by the iron-response proteins. Am J Med Sci. 1999;318:230-240[CrossRef][Medline] [Order article via Infotrieve].
36.
Cox TC, Bottomley SS, Wiley JS, Bawden MJ, Matthews CS, May BK.
X-linked pyridoxine-responsive sideroblastic anemia due to a Thr388-to-Ser substitution in erythroid 5-aminolevulinate synthase.
N Engl J Med.
1994;330:675-679
37.
Kim YH, Nergonia H, Muller C, Pitt BR, Watkins WD, Lancaster JR.
Loss and degradation of enzyme-bound heme induced by cellular nitric oxide synthesis.
J Biol Chem.
1995;270:5710-5713 38. Weiss G, Goosen B, Dopler W, et al. Translational regulation via iron-responsive elements by the nitric oxide/NO-synthase pathway. EMBO J. 1993;12:3651-3657[Medline] [Order article via Infotrieve]. 39. Brown GC. Nitric oxide and mitochondrial respiration. Biochim Biophys Acta. 1999;1411:351-369[Medline] [Order article via Infotrieve].
© 2003 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  J. Lynch, Y. Fukuda, P. Krishnamurthy, G. Du, and J. D. Schuetz Cell Survival under Stress Is Enhanced by a Mitochondrial ATP-Binding Cassette Transporter That Regulates Hemoproteins Cancer Res., July 1, 2009; 69(13): 5560 - 5567. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Sakaino, T. Kataoka, and S. Taketani Post-Transcriptional Regulation of the Expression of Ferrochelatase by Its Variant mRNA J. Biochem., June 1, 2009; 145(6): 733 - 738. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Mizutani, R. Sanuki, K. Kakimoto, S. Kojo, and S. Taketani Involvement of 101F6, a Homologue of Cytochrome b561, in the Reduction of Ferric Ions J. Biochem., December 1, 2007; 142(6): 699 - 705. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Shvartsman, R. Kikkeri, A. Shanzer, and Z. I. Cabantchik Non-transferrin-bound iron reaches mitochondria by a chelator-inaccessible mechanism: biological and clinical implications Am J Physiol Cell Physiol, October 1, 2007; 293(4): C1383 - C1394. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Pondarre, D. R. Campagna, B. Antiochos, L. Sikorski, H. Mulhern, and M. D. Fleming Abcb7, the gene responsible for X-linked sideroblastic anemia with ataxia, is essential for hematopoiesis Blood, April 15, 2007; 109(8): 3567 - 3569. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Cavadini, G. Biasiotto, M. Poli, S. Levi, R. Verardi, I. Zanella, M. Derosas, R. Ingrassia, M. Corrado, and P. Arosio RNA silencing of the mitochondrial ABCB7 transporter in HeLa cells causes an iron-deficient phenotype with mitochondrial iron overload Blood, April 15, 2007; 109(8): 3552 - 3559. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. A. Schoenfeld, E. Napoli, A. Wong, S. Zhan, L. Reutenauer, D. Morin, A. R. Buckpitt, F. Taroni, B. Lonnerdal, M. Ristow, et al. Frataxin deficiency alters heme pathway transcripts and decreases mitochondrial heme metabolites in mammalian cells Hum. Mol. Genet., December 15, 2005; 14(24): 3787 - 3799. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Ohgari, M. Sawamoto, M. Yamamoto, H. Kohno, and S. Taketani Ferrochelatase consisting of wild-type and mutated subunits from patients with a dominant-inherited disease, erythropoietic protoporphyria, is an active but unstable dimer Hum. Mol. Genet., January 15, 2005; 14(2): 327 - 334. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. A. Graf, S. E. Haigh, E. D. Corson, and O. S. Shirihai Targeting, Import, and Dimerization of a Mammalian Mitochondrial ATP Binding Cassette (ABC) Transporter, ABCB10 (ABC-me) J. Biol. Chem., October 8, 2004; 279(41): 42954 - 42963. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Horiguchi, K.-i. Arimoto, A. Mizutani, Y. Endo-Ichikawa, H. Nakada, and S. Taketani Galectin-1 Induces Cell Adhesion to the Extracellular Matrix and Apoptosis of Non-Adherent Human Colon Cancer Colo201 Cells J. Biochem., December 1, 2003; 134(6): 869 - 874. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2003 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
) or pcDNA(c-Myc)-ABC7 plasmids (
)
and incubated for 24 and 48 hours. The cells were then collected,
washed twice with PBS, and homogenized. The homogenates were
centrifuged at 900g for 10 minutes. The assay of
ferrochelatase activity was as described. (B) Catalase activity.
Catalase activity was measured using homogenates as above. Data in
panels 4A-B are expressed as the means ± SDs of
triplicate experiments. (C) Immunoblot analysis. Cells transfected
with empty vector or pcDNA3-ABC7 were cultured. The cellular proteins
were analyzed by SDS-PAGE, transferred onto PVDF membrane, and
immunoblotted using antiferrochelatase, anticatalase, and
antithioredoxin.
) and control (
) cells were collected and the amount of
heme was measured. Data are expressed as the means ± SDs of
triplicate experiments. (B) Immunoblot analysis. Immunoblotting was
performed using antiferrochelatase and antithioredoxin. The transfected
and control cells were separately cultured with 2% Me2SO
for 0 hours and 72 hours.
-aminolevulinic acid synthase
(ALA-S2) by iron.