|
|
Prepublished online as a Blood First Edition Paper on January 9, 2003; DOI 10.1182/blood-2002-09-2767.
Previous Article | Table of Contents | Next Article 
Blood, 1 May 2003, Vol. 101, No. 9, pp. 3460-3468
HEMATOPOIESIS
Chromatin immunoprecipitation (ChIP) studies indicate a
role for CCAAT enhancer binding proteins alpha and epsilon (C/EBP
and C/EBP ) and CDP/cut in myeloid maturation-induced lactoferrin
gene expression
Arati Khanna-Gupta,
Theresa Zibello,
Hong Sun,
Peter Gaines, and
Nancy Berliner
From the Section of Hematology, Department of Internal
Medicine, Yale University School of Medicine, New Haven, CT.
 |
Abstract |
In vitro models of granulopoiesis involving the inducible
expression of either CCAAT enhancer binding protein alpha
(C/EBP ) or C/EBP in myeloid cells have been shown to lead
to the induction of a granulocytic maturation program accompanied by
the expression of myeloid-specific genes. Since members of the C/EBP
family of transcription factors recognize and bind to similar
DNA-binding motifs, it has been difficult to elucidate the specific
role of each of the C/EBP family members in eliciting myeloid gene
expression. In order to address this issue, we focused on the
expression of the lactoferrin (LF) gene. LF expression is
transcriptionally regulated in a C/EBP-dependent manner in myeloid
cells. Using chromatin immunoprecipitation (ChIP) analysis we
demonstrate that C/EBP binds to the LF promoter in
nonexpressing cells. Upon induction of maturation, C/EBP binds to
the LF promoter, which correlates with LF expression. Lack of LF
expression in the acute promyelocytic leukemia cell line NB4, which
harbors the t(15;17) translocation, cannot be correlated with aberrant
binding at the C/EBP site in the LF promoter. It is, however,
associated with the persistent binding of the silencer CCAAT
displacement protein (CDP/cut) to the LF promoter in these cells. We
conclude that C/EBP , C/EBP , and CDP/cut all play
definitive roles in regulating late gene expression during normal
myeloid development.
(Blood. 2003;101:3460-3468)
© 2003 by The American Society of Hematology.
 |
Introduction |
Although a number of transcription factors have
been implicated in myelopoiesis,1-4 several members of the
CCAAT enhancer binding protein (C/EBP) family of transcription factors
have been shown to be indispensable for normal development of the
myeloid lineage. The C/EBP family of transcription factors is a class of basic region/leucine zipper (bZIP) factors that recognize
the consensus DNA-binding sequence, 5'-ATTGCGCAAT-3', as obligate dimers. Currently, 6 members of this family of transcription factors have been described, including C/EBP , , , , , and
CHOP-10/GADD 153, all of which contain highly homologous dimerization
(leucine-zipper) domains and DNA-binding (basic-region) motifs. These
proteins have been implicated in regulating gene expression in a
variety of cell types, including adipocytes (reviewed in Darlington et al5), constitutive and acute phase response genes in the
liver (reviewed in Diehl6), and myelomonocytic cells
(reviewed in Lekstrom-Himes and Xanthopoulos7).
Severe hematopoietic abnormalities have been reported for mice
nullizygous for C/EBP and . Although C/EBP /
mice die perinatally due to defects in gluconeogenesis,8,9 they also demonstrate an early block in the differentiation of granulocytes. C/EBP has been postulated to be a master regulator of
the granulopoietic developmental program. Although C/EBP is expressed in several tissues, its expression in the hematopoietic compartment is restricted to the granulocytic lineage, where it is
expressed in the most primitive precursors. Recently, mutations within
the C/EBP gene have been demonstrated in patients with acute myeloid
leukemia (AML) (French-American-British [FAB] classification M1 and M2).10 Additionally, the AML1/ETO fusion
protein that results from the t(8;21) translocation in patients with M2
AML has been shown to down-regulate C/EBP expression,11
suggesting that loss of C/EBP function in AML patients may
contribute to the observed early block in the granulocytic
maturation pathway.
C/EBP is expressed relatively late in the granulocytic maturation
pathway and has been shown to play a role in late myeloid gene
expression.12-14 Absence of C/EBP in mutant mice causes
a late block in the differentiation of granulocytes.
C/EBP / mice produce hyposegmented granulocytes that
are functionally defective. Mutant mice usually survive 2 to 5 months
but eventually succumb to opportunistic bacterial
infections.15 It has been demonstrated that
C/EBP / mice express absent or low levels of RNA for
several genes, including the secondary granule protein (SGP)
genes (murine lactoferrin [mLF], murine neutrophil gelatinase
[mNG], and murine neutrophil collagenase [mNC]). Studies
from our laboratory have demonstrated that expression of mLF
and mNC in the developing neutrophil is dependent on intact C/EBP
binding sites within their gene promoters (Khanna-Gupta et
al16; and A.K.-G. and N.B., manuscript in preparation, 2003). Mutations within the C/EBP gene have been described
in patients with specific granule deficiency (SGD),17,18 a
rare condition marked by defects in neutrophil function including
atypical nuclear morphology, impaired bactericidal activity, and
abnormalities in neutrophil migration, as well as a lack of both
neutrophil and eosinophil secondary granule proteins.19,20
Previous studies using transient transfection analyses have
demonstrated that both C/EBP and C/EBP , in concert with other factors such as PU.1, AML/CBF , and c-Myb, can regulate the promoters of several myeloid-specific genes.14,16,21,22 A number of primary granule protein genes including myeloperoxidase,23
lysozyme, neutrophil elastase,24,25 and mim-1 are thought
to be regulated by C/EBP . Many of the same genes have also been
shown to be regulated by C/EBP .14 Interestingly,
representational difference analysis (RDA), using fetal livers from
wild-type and C/EBP knock-out mice, showed that the expression of
the late secondary granule protein (SGP) genes lactoferrin (LF), human
neutrophil collagenase (HNC), and neutrophil gelatinase associated
lipocalin (NGAL) were absent in C/EBP /
livers.26 In contrast, similar RDA studies using
neutrophils and macrophages from C/EBP / mice did not
identify this group of late-expressing genes as targets of C/EBP ,
even though transient transfection12-14 and C/EBP / mice studies indicated otherwise.
In an attempt to further delineate the role of both C/EBP and
C/EBP in myeloid maturation, several groups, including our own, have
derived cell lines that inducibly express these factors in a myeloid
setting.12,27,28 Granulocytic maturation has been reported
following induced expression of C/EBP as well as C/EBP ,
suggesting that such in vitro overexpression models cannot be used to
distinguish downstream targets of each factor. Additionally, a recent
report has demonstrated that expression of C/EBP from the
C/EBP gene locus is sufficient to drive normal
hematopoiesis in vivo.29 This apparent redundancy in C/EBP
function is unlikely to be reflective of the in vivo role played by the
individual C/EBP family members during granulopoiesis. Since the
expression of C/EBP in a number of myeloid cell lines induced toward
the neutrophil lineage is biphasic, peaking in early and again in late
myeloid cells,27 we hypothesized that C/EBP and the
late-expressing C/EBP may together play a part in the in vivo
regulation of late myeloid genes such as the SGP genes, which are
hallmarks of terminal neutrophil differentiation.30,31
In this study, we used chromatin immunoprecipitation (ChIP) analysis to
dissect the role of C/EBP and C/EBP in mediating the expression
of the late myeloid gene lactoferrin (LF), which serves as a model for
the coordinately regulated SGP group of genes during neutrophil
maturation. We have previously demonstrated that high levels of LF
expression are mediated in part via a C/EBP element within the LF gene
promoter,16 while CCAAT displacement protein
(CDP/cut), a highly conserved silencing factor that binds the LF promoter, coordinately represses expression of LF and all the
SGP genes in early myeloid cells.32,33 Here we demonstrate that C/EBP binds to the LF promoter in nonexpressing cells, whereas binding of C/EBP occurs upon maturation and is correlated with LF
expression. Expression also correlates with loss of CDP/cut binding to
the promoter. We examined the modulation of these transcription factors
in NB4 cells, an acute promyelocytic (APL) cell line that carries the
t(15;17) translocation and fails to express LF upon induction with
all-trans retinoic acid (ATRA). Lack of LF expression in
these cells cannot be correlated with aberrant binding at the C/EBP
site in the LF promoter, since binding of C/EBP and C/EBP appears
to be intact. However, ATRA induction of NB4 cells is associated with
persistent binding of the silencer CDP/cut to the LF promoter. We
conclude that both C/EBP and C/EBP play definitive roles in
regulating late gene expression during normal myeloid development, and
that disruption of the interplay between the positive (C/EBP) and
negative (CDP/cut) regulators of LF gene expression may contribute to
the leukemic phenotype.
 |
Materials and methods |
Tissue culture, transient transfections, and luciferase
assay
Human acute promyelocytic leukemia NB4 cells were obtained from
Dr M. Lanotte (Institut National de la Santé et de la Recherche Médicale [INSERM], Paris, France), and were maintained
and grown in RPMI 1640 medium (Gibco BRL, Grand Island, NY)
supplemented with 10% heat-inactivated fetal calf serum (Gemini
Bioproducts, Calabasas, CA), 0.2 mM glutamate, 50 units/mL penicillin,
and 50 µg/mL streptomycin. 32Dwt18 cells (a gift from Dr Daniel Link, University of Washington, St Louis, MO) were grown in Iscoves modified
Dulbecco medium (IMDM) supplemented with 10% fetal calf serum
and 10% WEHI-conditioned medium, as a source of interleukin-3 (IL-3). MPRO cells were obtained from Dr Schickwann Tsai (Mt
Sinai School of Medicine, NY) and were maintained in AIM-V medium
(Gibco BRL) supplemented with 1% fetal calf serum and either
with recombinant granulocyte-macrophage colony-stimulating factor
(GM-CSF; Amgen, Thousand Oaks, CA) or 10%
HM-5-conditioned medium as a source of GM-CSF. All cells were
maintained at 37°C in a humidified 5% CO2 incubator.
Differentiation of NB4 and MPRO cells was performed as described
previously.34,35 Briefly, exponentially growing cells were
washed twice with phosphate-buffered saline (PBS) and resuspended in
growth medium containing 5 to 10 µM all-trans retinoic acid (ATRA; Sigma, St Louis, MO). Cells were incubated for the times
stipulated. Differentiation of 32Dwt18 cells was performed as described
previously.32 Exponentially growing cells were washed
twice with phosphate-buffered saline (PBS) and resuspended in growth
medium containing 1 U/mL erythropoietin (Epo; Amgen) in the absence of
an IL-3 source. Maturation of all inductions was monitored by
Wright-Giemsa staining.
Transient transfection experiments were performed as previously
described.12 Briefly, approximately 1 × 107
32Dwt18 cells were gently pelleted and washed twice with PBS and
resuspended in 180 µL HEPES
(N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid)-buffered saline in electroporation cuvettes. Then, 10 to 20 µg of each reporter plasmid construct and 2 µg pCMV gal
(Clontech, Palo Alto, CA), an internal control plasmid used to monitor
transfection efficiency, were added to each aliquot of cells. Following
a 5-minute incubation period at room temperature, the DNA-cell samples
were electroporated using a Biorad Gene Pulser (Biorad, Hercules, CA) at 400 V with a capacitance of 250 µF. Luciferase expression
levels were normalized to the levels of -galactosidase
expression.32
Chromatin immunoprecpitation (ChIP)
Chromatin immunoprecipitation (ChIP) assays were performed
using the protocol for the acetyl-histone H4 ChIP Assay Kit (Upstate Biotechnology, Lake Placid, NY). Briefly, 2 × 107
32Dwt18 (uninduced and 4-day Epo-induced), MPRO (uninduced and 24-hour
ATRA-induced), and NB4 (uninduced and 48-hour ATRA-induced) cells were
cross-linked by addition of formaldehyde into the medium at a final
concentration of 1% and incubated for 30 minutes at 37°C. Prior to
cross-linking, an aliquot of the cells was removed for analysis of
input chromatin DNA. Cells were then washed with ice-cold
phosphate-buffered saline and resuspended in 200 µL of ChIP lysis
buffer (1% SDS [sodium dodecyl sulfate]; 10 mM EDTA [ethylenediaminetetraacetic acid]; and 50 mM Tris
[tris(hydroxymethyl)aminomethane]-HCl, pH 8.0) with
protease inhibitors (Roche, Indianapolis, IN) and 1 µM diisopropyl
fluorophosphate (DFP; Sigma), incubated on ice for 10 minutes,
and sonicated at 28% power for 3 pulses of 10 seconds each in a
Branson Sonifier 450 (Branson Ultrasonics, Danbury, CT).
Sonicated lysates were then diluted to 2 mL with ChIP dilution buffer
(0.01% SDS; 1.1% Triton X-100; 1.2 mM EDTA; 16.7 mM Tris-HCl, pH 8.0;
and 167 mM NaCl), followed by preclearing with 80 µL protein A-agarose beads or protein G Plus-agarose beads for 60 minutes at
4°C with rotation. The precleared lysates were next
immunoprecipitated using antibodies for either C/EBP (4 µg; Santa
Cruz Biotech, Santa Cruz, CA, sc-158), C/EBP (8 µg; Santa
Cruz Biotech, sc-61), or CDP (4 µg; Santa Cruz Biotech, sc-6327) at
4°C overnight with rotation. A no-antibody control was included with
each experiment. Immune complexes were collected with 60 µL protein
A-agarose or protein G Plus-agarose and washed once with 1 mL each of
the following buffers: low salt wash buffer (0.1% SDS; 1% Triton
X-100; 2 mM EDTA; 20 mM Tris-HCl, pH 8.0; and 150 mM NaCl), high salt
wash buffer (0.1% SDS; 1% Triton X-100; 2 mM EDTA; 20 mM Tris-HCl, pH
8.0; and 1500 mM NaCl), LiCl wash buffer (250 mM LiCl; 1% nonidet P-40
[NP-40]; 1% sodium deoxycholate; 1 mM EDTA; and 10 mM
Tris-HCl, pH 8.0); and twice with 10 mM Tris-HCl, pH 8.0; and
1 mM EDTA. Immune complexes were next eluted using freshly prepared
elution buffer (1% SDS and 0.1 M NaHCO3). Cross-links were
reversed by heating at 65°C in the presence of NaCl followed by
proteinase K treatment. The DNA was recovered by phenol/chloroform
extraction followed by ethanol precipitation and resuspended in 40 µL
distilled water. ChIP DNA (1 µL) was next used as a template
for polymerase chain reaction (PCR) using the appropriate oligos (all
oligos are oriented in the 5' to 3' direction). C/EBP CDP/cut: FP
(forward primer), GCTAACCGGAATATGCTAATCAG; RP (reverse primer),
CCTTTCAGAGACACCTGCTC.12 LF CDP/cut: FP,
GTTTAGTTTGCTTCCAACTG; RP, CCATCTCCTCCTTCTCTTT.32 Murine
NE: FP, GACACCCCCACTGTCG; RP, TTATAGGTGGGAACCAGAG.25 Murine LF C/EBP: FP, GTTTCCTGTACCAGCGCCT; RP,
GTCTGTGGTCTTGGGAGA.36 Human LF C/EBP: FP,
TGGCGGGGAGTGGGAGGGAA; RP, AAGCTTGTCGACCGACTTGGCAAACGAAG.16 Gp91phox CDP/cut: FP, CCAATGATTATTAGCCAATTTCTG; RP,
CATGGTGGCAGAGGTTGAATGT.37 HNP CDP/cut and C/EBP:
FP, GTCAACTGTGTTAGGAGCCAT; RP, CGTGCACAAGTGGACTTC.38
All PCR products were subcloned into the pCRII vector (Invitrogen,
Carlsbad, CA) and sequenced by standard dideoxy sequencing technology to confirm their identity.
Northern blot analysis
Northern blot analysis was performed as described
previously.34 Briefly, 10 µg total RNA prepared using
Trizol reagent (Gibco BRL) from uninduced and ATRA-induced NB4
cells was separated on a 1% denaturing agarose gel, transferred to
nitrocellulose filters, and hybridized to 32P-labeled cDNA
fragments at 68°C in Express-Hyb (Sigma). Filters were washed at high
stringency in 0.1% sodium dodecyl sulfate (SDS) and 0.1 ×
SSC (1 × SSC, 3 M NaCl, 0.3 sodium citrate, pH 7.0) at 60°C
and autoradiographed. Blots were probed sequentially with a previously
described LF probe isolated in our laboratory,34 a cDNA
probe for human gp91phox (provided by David Skalnik, Indiana University, Indianapolis, IN), and a previously described defensin (HNP 1,3) probe.39 A -actin probe was used to confirm
equal RNA loading in each lane.
Preparation of nuclear extracts and electrophoretic mobility shift
analysis (EMSA)
Nuclear extracts were prepared as described
previously12 from uninduced and 2-day ATRA-induced NB4
cells. Total protein concentration in the nuclear extract preparations
was assayed using the Bradford assay (BioRad kit) per the
manufacturer's instructions. In general, most preparations yielded 1.5 to 2 µg/µL protein. EMSA analysis was next carried out as
previously described.12 EMSAs were performed by incubating
15 µg nuclear extracts with 20 000 cpm of double-stranded
oligonucleotide harboring the CDP/cut site within the LF
promoter32 in a 20-µL reaction mixture containing 10 mM
HEPES-KOH buffer (pH 7.9), 50 mM KCl, 2.5 mM
MgCl2, 1 mM dithiothreitol (DTT), 10% glycerol, 1 µg acetylated bovine serum albumin (New England Biolabs,
Beverly, MA), and 0.5 µg poly(dI-dC) at 25°C for 20 minutes. For
competition analysis, a 100-fold molar excess of unlabeled
oligonucleotides was added to the nuclear extracts prior to the
addition of the labeled probe. Oligos used for competition have been
previously described.12,32 Binding reactions were resolved
on a 4% nondenaturing polyacrylamide gel containing 1 × TBE (0.089 M
Tris-borate, 0.089 M boric acid, and 0.002 M EDTA) and electrophoresed
at 150 V for 3 hours at 4°C. Gels were exposed to x-ray film with an
intensifying screen overnight at 80°C.
Western blot analysis
Approximately 40 µg nuclear extracts or total cell extracts
prepared from 1 × 106 cells in lysis buffer (15 mM
HEPES, pH 7.9; 0.4 MKCl; 0.1% NP-40; 4 mM NaF; 4 mM
Na3VO4; 0.2 mM EDTA; 0.2 mM EGTA; 1 µM DFP; 1 mM DTT; 1 mM phenylmethylsulfonyl fluoride [PMSF]; and 10%
glycerol) prepared from uninduced and 2-day ATRA-induced NB4 cells;
uninduced and 24-hour ATRA-induced MPRO cells; and uninduced and 4-day
Epo-induced 32Dwt18 cells were transferred to 2 × Laemelli loading
buffer, boiled for 5 minutes, and loaded onto a 4% to 20%
Tris/Glycine gel (Novex, San Diego, CA). Electrophoresis was carried
out at 150 V for 2 hours at room temperature. Electrophoresed proteins were transferred to a polyvinylidene fluoride (PVDF) membrane (BioRad) and blocked with 5% nonfat dry milk in Tris-buffered saline
containing 0.1% Tween-20 (TBS-T) for one hour at room temperature. The
blocked membranes were next incubated with CDP, C/EBP , and C/EBP antibodies at a 1:3000 dilution in TBS-T at 4°C
overnight. Each membrane was washed 3 times with TBS-T + 5% nonfat
dry milk and incubated with either an antigoat horseradish
peroxidase-conjugated secondary antibody (Santa Cruz Biotech) or an
antirabbit horseradish peroxidase-conjugated secondary antibody for
one hour at room temperature. The membrane was washed 5 times in TBS-T
and chemiluminescent detection performed per the manufacturer's
instructions (Amersham, Piscataway, NJ).
 |
Results |
C/EBP C/EBP , and C/EBP expression plasmids transactivate a
C/EBP site containing lactoferrin promoter plasmid in myeloid
cells
Transient cotransfection assays have been widely used to identify
and characterize functional DNA-binding elements within the promoters
of several genes. We have previously demonstrated that myeloid-specific
expression of lactoferrin (LF), a model for secondary granule protein
(SGP) gene expression, is C/EBP-dependent.16 In order to
identify which family member of the C/EBP family of transcription
factors is responsible for mediating high levels of LF expression
during myeloid maturation, we performed a transient cotransfection
assay using a previously identified 89-bp fragment (LF89) of the
lactoferrin gene promoter harboring a C/EBP site cloned into the
promoterless pGL3 basic reporter plasmid.16 The LF89
plasmid was cotransfected with C/EBP expression plasmids into 32Dwt18
cells. The 32Dwt18 cells are a subline of the murine myeloid 32Dcl3
cells that have been stably transfected with a chimeric receptor
containing the extracellular domain of the erythropoietin receptor and
the intracellular domain of the G-CSF receptor. These cells respond to
erythropoietin (Epo) and undergo differentiation along the granulocytic
lineage.32 As is evident in Figure
1, no significant difference between
transactivation effects of C/EBP (5.8-fold) C/EBP (4-fold), or
C/EBP (5.2-fold) on LF89 was observed in 32Dwt18 cells. Since C/EBP
family members bind DNA as dimers, we examined the possibility that
cotransfection of 2 family members may cooperatively transactivate the
LF89 plasmid, indicating a preference of a particular pair for the LF89
C/EBP site. Our data (Figure 1), however, indicate that pairwise
cotransfections of C/EBP family members with LF89 result in an additive
rather than a cooperative effect on LF89 expression. (For example,
LF89 [5.8-fold] + LF89 [4-fold] = LF89 [10-fold].)
The results from this experiment indicate that all 3 C/EBP family
members can transactivate the LF89 plasmid equally well in this in
vitro assay, and hence no definitive conclusion may be drawn as to the
specific involvement of either individual or paired C/EBP family
members in LF expression in a myeloid setting.

View larger version (18K):
[in this window]
[in a new window]
| Figure 1.
Transient cotransfection analysis of LF89 and expression
plasmids for C/EBP , , and in 32Dwt18 cells.
32Dwt18 cells were transiently cotransfected with an LF gene promoter
fragment spanning 89 bp (LF89) harboring a C/EBP site cloned into the
promoterless luciferase reporter pGL3-Basic plasmid (10 µg), and
expression plasmids for C/EBP , , and (5 µg each),
individually or pairwise. A pCMV gal expression plasmid (2 µg) was included in each transfection to normalize for transfection
efficiency. The total concentration of DNA per transfection was
maintained at 22 µg by the addition of salmon sperm DNA where
necessary. Transfected cells were harvested 24 hours after transfection
and assayed for luciferase and -galactosidase activity. Normalized
luciferase values have been represented as a fold increase of
luciferase activity over LF89 alone. Mean ± SE for 3 experiments
performed in duplicate have been illustrated.
|
|
Chromatin immunoprecipitation (ChIP) analysis of C/EBP and
C/EBP in lactoferrin-expressing cells
The use of ChIP analysis to gain an understanding of in vivo
protein-DNA interactions in a number of cell systems has revolutionized the study of DNA-binding proteins and their role in mediating gene
expression (eg, Boyd and Farnham40; Wells et
al41; and Shang and Brown42). This
technique provides a unique glimpse in real time of the binding
activity of a given DNA-binding protein. In order to gain an
understanding of the role of C/EBP and C/EBP in mediating high
levels of LF expression during granulopoiesis, we performed ChIP
analysis in 2 previously characterized murine myeloid cell lines, both
of which are capable of expressing high levels of LF upon induction
toward neutrophil maturation.32,43 MPRO cells are a
promyelocytic cell line harboring a truncated dominant-negative RAR
gene. These cells can be made to undergo neutrophil maturation upon the
addition of pharmacologic levels of ATRA.35,43,44 Western
blot analysis revealed that while the levels of C/EBP are
up-regulated upon induction in both ATRA-induced MPRO cells as well as
Epo-induced 32Dwt18 cells, the levels of C/EBP remained unchanged in
the latter but were up-regulated in the former (Figure
2). This apparent difference in
expression of C/EBP in the 2 myeloid cell lines probably reflects
the observation that C/EBP is expressed in a biphasic manner,
peaking in early and again in late myeloid cells,27 and
that the promyelocytic MPRO cells are not only further along the
granulocytic maturation pathway than 32Dwt18 cells, but mature more
rapidly as well. As is evident in Figure
3A, ChIP analysis using anti-C/EBP and
anti-C/EBP was carried out in MPRO cells before and after induction
for 24 hours with ATRA. Isolated DNA was subjected to PCR both before (Figure 3A, lane 8, input) and after chromatin immunoprecipitation using primers designed to amplify the region within the LF promoter harboring the C/EBP binding site.16 The LF C/EBP site in
uninduced MPRO cells appears to be bound to C/EBP (Figure 3A, lane
2) but not to C/EBP (Figure 3A, lane 4). Induction of MPRO cells
toward neutrophil maturation with ATRA changes the dynamics of protein binding at the LF C/EBP site. C/EBP remains bound (Figure 3A, lane
3), while C/EBP becomes bound to the site (Figure 3A, lane 5). A
no-antibody control (Figure 3A, lane 1) and preimmune serum controls
(Figure 3A, lanes 6-7) yielded no PCR product corresponding to the LF
C/EBP site, thus serving as negative controls. Additionally, irrelevant
oligos did not yield a PCR product, thus emphasizing the specificity of
the observations in this experiment (data not shown).

View larger version (18K):
[in this window]
[in a new window]
| Figure 2.
Western blot analysis of C/EBP and C/EBP
expression during myeloid differentiation.
Left panel: Western blot analysis was performed using whole cell
extracts prepared from uninduced (0) and ATRA-induced (24 h) MPRO
cells. The blots were probed with C/EBP and C/EBP antibodies.
Right panel: Western blot analyses were performed on whole cell
extracts prepared from uninduced (0) or Epo-induced (4 d) 32Dwt18
cells. The blots were probed with C/EBP and C/EBP antibodies as
outlined in "Materials and methods." The molecular weights of the
proteins are indicated in kilodaltons.
|
|

View larger version (9K):
[in this window]
[in a new window]
| Figure 3.
Chromatin immunoprecipitation (ChIP) analysis of
C/EBP and C/EBP during myeloid differentiation.
(A) Chromatin immunoprecipitations were performed from uninduced (0)
and ATRA-induced (24 h) MPRO cells using antibodies specific for
C/EBP (lanes 2-3) and C/EBP (lanes 4-5), a no-antibody control
( ) (lanes 1,9), and preimmune serum controls (PIS) (lanes 6-7). The
precipitated chromatin was analyzed using primers specific for the
murine LF (mLF) C/EBP site. Input mLF chromatin (1:10 dilution) is
represented in lane 8. (B) ChIP analysis was performed using uninduced
(0) and 4-day Epo-induced (4d) 32Dwt18 cells and antibodies specific
for C/EBP (lanes 2-3) and C/EBP (lanes 5-6), no-antibody
controls (lanes 1, 4, and 10), and preimmune serum (PIS) controls
(lanes 7-8). Precipitated chromatin was analyzed using primers for the
murine LF (mLF) promoter. Input mLF chromatin (1:10 dilution) is
represented in lane 9. M indicates molecular weight markers.
(C) ChIP analysis of uninduced (0) and ATRA-induced (24 h)
MPRO cells using C/EBP antibodies (lanes 1-2), C/EBP antibodies
(lanes 3-4), and a no-antibody control (lane 5). Precipitated chromatin
was analyzed by PCR using primers specific for murine neutrophil
elastase (mNE). Each ChIP experiment was performed 2 to 3 times. All
PCR products were subcloned and sequenced by dideoxy method to confirm
their identities.
|
|
In order to determine if the pattern of C/EBP and C/EBP binding
at the LF C/EBP site was unique to the MPRO cell system or whether it
formed the basis of a common paradigm with respect to LF expression in
the developing neutrophil, we performed ChIP analysis in a second
myeloid cell line. We have previously shown that 32Dwt18 cells
differentiate in response to Epo induction in the absence of IL-3, and
express the LF gene at levels comparable with the 32Dcl3/G-CSF system,
without encountering the 80% cell death associated with induction of
32Dcl3 with G-CSF.32 ChIP analysis of uninduced and
Epo-induced 32Dwt18 cells demonstrated a dynamic pattern of C/EBP
and C/EBP binding to the LF C/EBP site (Figure 3B), identical to
that observed in the MPRO cell system (Figure 2A). Here again, C/EBP
alone was bound to the LF C/EBP site in uninduced cells (Figure 3B,
lane 2), while both C/EBP (Figure 3B, lane 3) and C/EBP (Figure
3B, lane 6) were bound to this site in the LF promoter in induced
32Dwt18 cells.
Our data thus far indicate a distinct pattern of C/EBP binding and
further suggest that binding of C/EBP to the LF C/EBP site
correlates with the up-regulation of the late SGP gene LF during
neutrophil maturation. We next asked whether the binding dynamics of
C/EBP and C/EBP were different for a C/EBP site in a primary
granule protein in the MPRO cell system. As indicated in Figure 3C,
ChIP analysis of the C/EBP binding site in the neutrophil elastase (NE)
gene promoter25 indicates that C/EBP is bound to the NE
C/EBP site in uninduced cells (Figure 3C, lane 1). However, neither
C/EBP (Figure 3C, lane 2) nor C/EBP (Figure 3C, lane 4) are bound
to this site in induced MPRO cells (Figure 3C, lane 2). Thus the
pattern of C/EBP and C/EBP engagement at the C/EBP sites of a
primary (NE) and a secondary (LF) granule protein gene appears to be
different. Our data reaffirm the previously held view that C/EBP is
involved in inducing expression of the secondary and not the primary
granule protein genes in the maturing neutrophil.13
Chromatin immunoprecipitation (ChIP) analysis of C/EBP and
C/EBP in lactoferrin nonexpressing cells
NB4 is a cell line derived from a patient with acute promyelocytic
leukemia (APL) and harbors the t(15;17) cytogenetic
abnormality.45 These cells undergo partial granulocytic
maturation upon induction with ATRA, in that they undergo apparently
normal phenotypic maturation but manifest a coordinate failure to
express the SGP genes.34 To demonstrate the partial nature
of the neutrophil maturation program induced by ATRA in NB4 cells, we
performed Northern blot analysis. Total RNA isolated from uninduced (0 hours) and ATRA-induced (24, 48, and 72 hours) NB4 cells was subjected
to Northern blot analysis and probed sequentially for the expression of
myeloid-specific genes, including LF. As previously shown, the levels
of the C/EBP transcript were induced upon ATRA
induction,46 as were the levels of defensins (HNP)
(Figure 4), a group of highly conserved
low-molecular-weight cationic peptides that comprise 30% to 50% of
the primary granule proteins,47 and gp91phox, a major
component of the nicotinamide adenine dinucleotide phosphate
(NADPH) oxidase complex in the mature neutrophil (reviewed in
Skalnik4) (Figure 4). As previously shown, no LF mRNA was
detected in either uninduced or ATRA-induced NB4 cells (Figure
4).34

View larger version (68K):
[in this window]
[in a new window]
| Figure 4.
Northern blot analysis of NB4 cells treated with ATRA
. RNA (10 µg) isolated from uninduced (0) and ATRA-induced
(24, 48, 72 h) NB4 cells were subjected to Northern blot analysis.
The blot was sequentially probed with 32P-labeled cDNA
probes for HNP, gp91phox, and LF as described in "Materials and
methods." Equal loading of RNA in each lane was determined by the
presence of an equal concentration of both 18S and 28S ribosomal RNA in
each lane in the ethidium bromide stained gel prior to blotting
(bottom panel).
|
|
It has been previously hypothesized that in APL the PML/RAR fusion
protein resulting from the t(15;17) translocation may interfere with
the function of C/EBP thereby leading to an arrest in these cells at
the promyelocytic stage.48 In order to evaluate this
hypothesis with respect to the nonexpression of the SGP gene LF in
these cells, we performed ChIP analysis for both C/EBP and C/EBP
at the LF C/EBP site in uninduced and induced NB4 cells. No apparent
change was observed in the binding of C/EBP or C/EBP in uninduced
or ATRA-induced NB4 cells (Figure 5A, top left
panel). C/EBP remained bound to the
C/EBP LF site in both uninduced (Figure 5A, top left panel, lane 4) as
well as induced (Figure 5A, top left panel, lane 5) NB4 cells. The
pattern of C/EBP binding at the LF C/EBP site was essentially
identical to that for C/EBP (Figure 5A, top left panel, lanes 2-3).
In contrast, the binding of C/EBP and C/EBP to the recently
described functional C/EBP site in the HNP gene promoter38
showed significant changes, which likely correlate with the expression
of this gene in ATRA-induced NB4 cells. As shown in Figure 5A,
reciprocal binding of C/EBP and C/EBP was observed at the HNP
C/EBP site in uninduced and ATRA-induced NB4 cells: C/EBP bound the
HNP C/EBP site in only the uninduced NB4 cells (Figure 5A, bottom left
panel, lane 4), while C/EBP associated with this site in induced NB4
cells (Figure 5A, bottom left panel, lane 3). The specificity of these
observations was confirmed by the inability of either preimmune serum
(Figure 5A, right panel, lanes 6-7) or a no-antibody control (Figure
5A, lane 1) to yield the appropriate PCR products corresponding to the
C/EBP cis elements in question. Our observations suggest that unlike
neutrophil elastase (Figure 3C), this primary granule protein gene is
regulated by C/EBP binding activity. This is consonant with previous
studies that have demonstrated that the defensins (HNP) are expressed
later than most of the other primary granule proteins,49
and that they share some regulatory features with secondary granule
proteins. For example, the defensins are the only primary granule
proteins that are absent from neutrophils in patients with
neutrophil-specific granule deficiency (SGD).39

View larger version (31K):
[in this window]
[in a new window]
| Figure 5.
ChIP analysis of C/EBP and C/EBP in the
leukemic NB4 cell line.
(A) Chromatin immunoprecipitations were performed from uninduced
(0) and ATRA-induced (48 h) NB4 cells using antibodies specific for
C/EBP (lanes 2-3) and C/EBP (lanes 4-5), a no-antibody control
( ) (lanes 1,9), and preimmune serum (PIS) controls (lanes 6-7). The
precipitated chromatin was analyzed using primers specific for the
human LF (LF) promoter (top panel) and the HNP promoter (bottom panel).
Input HNP chromatin (1:10 dilution) is represented in lane 8. This
experiment was repeated 3 times. The identities of PCR products
obtained were confirmed by dideoxy sequencing. (B) Western blot
analysis of whole cell extracts prepared from uninduced (0) and
ATRA-induced (48 h) NB4 cells was performed and probed with C/EBP
and C/EBP antibodies. The molecular weights of the proteins detected
are shown in kilodaltons.
|
|
While protein levels of C/EBP were markedly increased upon ATRA
induction of NB4 cells (Figure 5B, top panel), levels of the larger
42-kDa C/EBP isoform remained unchanged (Figure 5B, bottom
panel). Interestingly, the levels of the shorter 30-kDa C/EBP
isoform appeared to decrease upon ATRA induction of NB4 cells. Previous
studies have demonstrated that this isoform, when expressed at high
levels relative to the 42-kDa isoform, acquires dominant-negative
properties.10 The implications of this observation on the
observed differential binding of C/EBP to its cognate binding sites
in the promoters of LF and HNP (Figure 5A) within the APL milieu remain
to be elucidated.
Persistent binding of CDP/cut to the LF CDP binding site may
account for nonexpression of LF in ATRA-induced NB4 cells
Even though the binding pattern of C/EBP and C/EBP to the LF
C/EBP site correlates with increased LF expression in induced MPRO and
32Dwt18 cells (Figure 3A-B), it appears to be insufficient to
up-regulate expression of LF in ATRA-induced NB4 cells (Figure 4). It
seems likely that the defect associated with nonexpression of LF in NB4
cells induced with ATRA may not be associated with aberrant binding at
the LF C/EBP site. Previous studies from our laboratory have shown that
CCAAT displacement protein (CDP/cut), a highly conserved silencing
factor that binds the LF promoter, coordinately represses expression of
all SGP genes.32,33 CDP/cut is a homeodomain protein that
contains 3 highly homologous domains of 70 amino acids called the
cut repeats.50 CDP/cut is thought to play a
role in determining cell-type specificity in both Drosophila melanogaster and mammals.51,52 In general, CDP/cut is
thought to act as a repressor of developmentally regulated
genes.52-56 In the myeloid compartment, CDP/cut has been
implicated as a transcriptional repressor of the gp91phox gene in
immature myeloid cells,54,57 the C/EBP
gene,12 and the SGP genes.32,33 A CDP/cut
site has recently been described in the promoter of the primary granule HNP 1,3 genes,38 but its functional role in the expression
of this family of genes has not been described.
We therefore assessed whether recruitment of CDP/cut to its cognate
binding sites in the HNP, C/EBP , gp91phox, and LF gene promoters
could be correlated with expression of these genes in the NB4 cell
system. ChIP analysis revealed that CDP/cut was recruited to the
CDP/cut binding sites in uninduced NB4 cells in the promoters of all 4 genes examined (Figure 6A, lane 1).
ATRA-induced differentiation resulted in loss of binding of CDP/cut in
the HNP, C/EBP , and gp91phox gene promoters (Figure 6A, lane 2).
This loss of CDP/cut binding appears to correlate with expression of
these 3 genes in ATRA-induced NB4 cells (Figure 4). CDP/cut binding,
however, was not abolished in the LF promoter in ATRA-induced NB4 cells (Figure 6A, top panel, lane 2), an observation that correlates with the
nonexpression of LF in the NB4 cell system. Loss of CDP/cut binding in
the gp91phox, C/EBP , and HNP promoters could not be explained by a
decrease in protein levels of CDP/cut in ATRA-induced NB4 cells, as
judged by Western blot analysis (Figure 6B), suggesting that the
mechanism underlying loss of CDP/cut binding likely involves posttranslational modifications of the CDP/cut protein.

View larger version (20K):
[in this window]
[in a new window]
| Figure 6.
ChIP analysis of CDP/cut binding to myeloid
promoters in NB4 cells.
(A) Chromatin immunoprecipitations were performed from uninduced (0)
and ATRA-induced (48 h) NB4 cells using an antibody specific for
CDP/cut (lanes 1-2) and a no-antibody control ( ) (lanes 3-4). The
precipitated chromatin was analyzed using primers specific for the
CDP/cut sites in the LF promoter, the HNP promoter, the C/EBP
promoter, and the gp91phox promoter. Input LF/CDP chromatin (1:10
dilution) is represented in lane 5. This experiment was repeated 3 times. The identities of all PCR products obtained were confirmed by
dideoxy sequencing. (B) Western blot analysis was performed on 40-µg
nuclear extracts prepared from uninduced (NB4; day 0), and 48-hour
ATRA-induced (NB4; 48 h ATRA) NB4 cells. The blot was probed with
a CDP/cut-specific antibody. The molecular-weight marker is
indicated.
|
|
The persistent binding of CDP/cut to the LF CDP/cut binding site in
ATRA-induced NB4 cells was further confirmed by EMSA analysis. The LF
CDP/cut binding site (DM2 probe) was used as a probe to compare the
CDP/cut binding status of nuclear extracts prepared from NB4 and
ATRA-induced NB4 cells. CDP/cut protein binding to the LF CDP/cut
binding site was found to be unchanged in uninduced versus ATRA-induced
NB4 cells (Figure 7A, lanes 2-3). The
binding of CDP/cut protein from the NB4 nuclear extracts was found to be specific, as 3 of the DNA-protein complexes (Figure 7A, arrows) were
specifically competed away only in the presence of a 100-fold molar
excess of either the LF/CDP/cut (DM2) oligo itself (Figure 6A, lane 4),
or the neural cell adhesion molecule (NCAM) oligos (Figure 7A,
lane 5), which have previously been shown to bind to the
CDP/cut protein.32 In a parallel EMSA
experiment using the C/EBP CDP/cut binding site as a probe, we were
able to demonstrate a significant decrease in binding of CDP/cut to
this site in ATRA-induced NB4 extracts when compared with uninduced NB4
extracts (Figure 7B, lanes 2-3). This finding further validates the
observation that decreased binding of CDP/cut correlates with
expression of C/EBP in ATRA-induced NB4 cells (Figures 4,6A). Since
persistent CDP/cut binding to the LF silencer element appears to be a
hallmark of LF nonexpression, we conclude that the inability of
ATRA-induced NB4 cells to express the LF gene correlates with
persistent binding of the CDP/cut protein to the LF CDP/cut
binding site.

View larger version (89K):
[in this window]
[in a new window]
| Figure 7.
Persistent binding of CDP/cut to CDP/cut site
in the LF promoter.
(A) Electrophoretic mobility shift analysis was carried out using
32P-labeled double-stranded oligos encoding the CDP/cut
site in the LF promoter (DM2 probe, lane 1). Addition of nuclear
extracts prepared from uninduced (NB4, U, lane 2) and 48-hour
ATRA-induced (NB4, 2d ATRA, lane 3) NB4 cells resulted in the formation
of specific protein-DNA complexes (arrows), which were specifically
competed away by the addition of a 100-fold molar excess of unlabeled
self (lane 4, 100 × DM2), or known CDP/cut binding oligos (ie, NCAM;
lane 5). (B) Binding of CDP/cut to the C/EBP promoter. EMSA analysis
was carried out using 32P-labeled double-stranded oligos
encoding the CDP/cut site in the C/EBP promoter. Addition of nuclear
extracts prepared from uninduced (NB4, U, lanes 2,5) and 48-hour
ATRA-induced (NB4, 2d ATRA, lane 3) NB4 cells resulted in the formation
of specific protein-DNA complex (arrow), which was specifically
competed away by the addition of a 100-fold molar excess of unlabeled
self (lane 4, × 100 DM2), or by the addition of increasing
concentrations of a known CDP/cut binding site (ie, NCAM; lanes
6-8).
|
|
 |
Discussion |
Gaining an understanding of the role played by closely related
members of a transcription factor family such as the C/EBP family in a
differentiation model has proved to be challenging. In vitro methods
relying on overexpression models and transient transfection analyses
have limitations, as closely related members such as C/EBP and
C/EBP often produce identical results (Figure 1).12-14,16,24,25,27 In this study, we have used chromatin immunoprecipitation (ChIP), a powerful method used to assess the status
of transcription-factor binding to promoters of interest in live
cells,58 to assess the role of 2 closely related members of the C/EBP family of transcription factors ( and ) in myeloid cell differentiation. Our findings reveal that C/EBP , which is expressed very early in the myeloid development program,27
binds to both primary (HNP and NE gene) as well as secondary (LF, and HNC [data not shown]) granule protein gene promoters in uninduced cells in the 3 myeloid development cell systems used in this study. It
is evident from our ChIP analysis that C/EBP may act as a negative
regulator by binding to cis elements either as a homodimer or as a
heterodimer with a yet-to-be-defined binding partner in cells not
expressing its target genes. It is unclear whether C/EBP exerts this
negative regulatory effect via its own previously described negative
regulatory subdomain,59 or whether its putative binding
partner has intrinsic negative regulatory properties. Recent studies
have shown that disruption of the E2F repression domain within the
C/EBP gene is associated with abnormalities in both adipogenesis and
granulopoiesis in transgenic mice.60
Our data confirm the previous observations that C/EBP binds to and
up-regulates the expression of the secondary granule protein genes (LF
[Figure 2A-B] and HNC [data not shown]).12-14 In
addition, we demonstrate that some primary granule protein genes are
regulated by C/EBP . Whereas murine neutrophil elastase
(mNE) expression does not appear to be C/EBP -dependent tin
ATRA-induced MPRO cells (Figure 2C), the defensins (HNP 1,3) do
appear to require C/EBP for high-level expression in ATRA-induced
NB4 cells (Figure 4). As noted in "Results," previous
studies have demonstrated that defensins (HNP) are expressed later in
the neutrophil maturation sequence than the other primary granule
protein genes, and their synthesis overlaps the onset of SGP gene
expression.49 Furthermore, the absent expression of
defensins (HNP) in specific granule deficiency (SGD), in which the
underlying defect is C/EBP -associated, suggests that HNP expression,
like the SGP genes, is C/EBP -dependent.39
The presence of both C/EBP and C/EBP at the C/EBP binding site in
the LF promoter in induced cells suggests that binding of both family
members is necessary for high-level LF expression in the MPRO and
32Dwt18 cell systems (Figure 3A-B). A similar pattern of C/EBP and
C/EBP binding at the LF C/EBP site was also observed in both
uninduced and ATRA-induced NB4 cells (Figure 5). However,
ATRA-induction of NB4 cells does not result in LF expression (Figure
4). It therefore appears that the C/EBP / heterodimer is not
sufficient to mediate high expression levels of LF in the acute
promyelocytic leukemic (APL) NB4 cell line harboring the t(15;17)
translocation resulting in the PML/RAR fusion
protein.45 Previous studies have suggested that
the PML/RAR fusion protein may interfere with the function of
C/EBP by inhibiting the ability of C/EBP to bind to cognate cis
elements in the promoters of C/EBP-regulated genes, thereby blocking
myeloid differentiation in APL cells (reviewed in Tenen48
and references therein). The authors have further suggested a
direct interaction of C/EBP with the PML/RAR fusion protein,
which is lost upon ATRA induction of APL cells resulting in increased
binding of C/EBP to its binding sites.48 Our ChIP data,
however, show that C/EBP is bound to the HNP C/EBP site in uninduced
NB4 cells. Induction of HNP expression in these cells upon ATRA
induction results in the loss of C/EBP binding to its cis element
(Figure 5). Based on our observations, it is likely that in APL
cells the loss rather than the previously hypothesized
gain48 of C/EBP binding, in association with a concomitant gain of C/EBP binding, is correlated with gene expression.
It seems likely that the defect associated with nonexpression of LF in
NB4 cells induced with ATRA is not attributable to aberrant C/EBP
binding since C/EBP binding remains unimpaired at the LF C/EBP
binding site. Previous studies from our laboratory have shown that
CCAAT displacement protein (CDP/cut), a highly conserved silencing
factor binds the LF promoter and modulates its activity during myeloid
differentiation.32,33 ChIP analysis revealed that CDP/cut
was recruited to the CDP/cut binding sites in uninduced NB4 cells in
the promoters of all 4 myeloid-specific gene promoters examined (Figure
6A). ATRA induction of NB4 cells resulted in loss of binding of CDP/cut
in the HNP, C/EBP , and gp91phox gene promoters. This loss of CDP/cut
binding appears to correlate with expression of these 3 genes in
ATRA-induced NB4 cells (Figure 4). CDP/cut binding, however, was not
abolished in the LF promoter in ATRA-induced NB4 cells (Figure 6A, top
panel, lane 2), an observation that correlates with the nonexpression of LF in the NB4 cell system. Changes in CDP/cut binding governing differential stage-specific gene expression are thought to be mediated
by posttranslational modification of the CDP/cut protein rather than
changes in the level of CDP/cut expression (reviewed in
Nepveu61). Whereas this posttranslational activity
remains normal at the HNP, C/EBP , and gp91phox CDP/cut binding
sites, we propose that the CDP/cut modifying activity associated
with the LF CDP/cut site is defective in APL cells.
This observed differential repressive activity of CDP/cut may be
inherent in the molecule itself. CDP/cut is a homeobox protein containing 3 highly conserved DNA-binding repeats referred to as
cut repeats, each of which is capable of recognizing and
binding specific DNA motifs in target genes (reviewed in
Nepveu61). Both acetylation of CDP/cut via p300/CBP and
phosphorylation of CDP/cut are posttranslational modifications that
have been postulated to regulate CDP/cut function.56,62 We
hypothesize that CDP/cut uses a different one (or more) of its 4 DNA-binding elements to bind to the CDP/cut motifs in different myeloid
promoters during neutrophil maturation. Differential modification,
involving either phosphorylation and/or acetylation, of CDP/cut-DNA
complexes in the promoters of these genes likely results in the
observed differential repression exerted by CDP/cut during neutrophil
development. A defect in the ability to specifically modify the
CDP/cut-DNA complex in the LF promoter is thus likely to be
responsible, in part, for the observed persistent binding of CDP/cut to
the LF promoter in ATRA-induced NB4 cells. Since LF is expressed later
in myeloid maturation than any of the other 3 genes examined in this
study, we predict that CDP/cut binding to the site in the LF promoter would be modulated by a different mechanism of posttranslational modification that would likely be shared with other secondary granule
protein genes.
In summary, we have demonstrated specific roles for both C/EBP and
C/EBP in modulating the expression of LF gene expression in the
maturing neutrophil. We have, in addition, demonstrated that the defect
associated with lack of LF expression in an APL cell model does not
involve defective C/EBP binding. That defect may be explained, in part,
by the persistent binding of the repressor CDP/cut to the LF promoter.
 |
Acknowledgments |
The authors would like to thank Dr Steve
Ackerman and members of his laboratory for valuable technical advice
and Dr Arch Perkins for critically reading the manuscript. We also
thank members of the Myeloid Stem Cell group at Yale University School
of Medicine for helpful insights and discussions.
 |
Footnotes |
Submitted September 10, 2002; accepted December 18, 2002.
Prepublished
online as Blood First Edition Paper, January 9, 2003; DOI
10.1182/ blood-2002-09-2767.
Supported by National Institutes of Health awards RO1-DK53471
and PO1-HL63357 (N.B.) and by the Anna G. and Argall L. Hull Cancer Research Award (A.K.-G.).
The publication costs of this
article were defrayed in part by
page charge payment. Therefore,
and solely to indicate this fact,
this article is hereby marked
"advertisement"
in accordance with 18 U.S.C.
section 1734.
Reprints: Nancy Berliner, Department of Internal
Medicine, Section of Hematology, WWW-428, Yale University School of
Medicine, 333 Cedar St, New Haven, CT, 06510; e-mail:
nancy.berliner{at}yale.edu.
 |
References |
1.
Shivdasani RA, Orkin SH.
The transcriptional control of hematopoiesis.
Blood.
1996;87:4025-4039[Free Full Text].
2.
Tenen DG, Hromas R, Licht JD, Zhang D-E.
Transcription factors, normal myeloid development, and leukemia.
Blood.
1997;90:489-519[Free Full Text].
3.
Orkin S.
Diversification of hematopoietic stem cells to specific lineages.
Nat Rev Genet.
2000;1:57-64[CrossRef][Medline]
[Order article via Infotrieve].
4.
Skalnik D.
Transcriptional mechanisms regulating myeloid-specific genes.
Gene.
2002;284:1-21[CrossRef][Medline]
[Order article via Infotrieve].
5.
Darlington GJ, Rossi SE, MacDougald OA.
The role of C/EBP genes in adipocyte differentiation.
J Biol Chem.
1998;273:30057-30060[Free Full Text].
6.
Diehl AM.
Roles of CCAAT/enhancer-binding proteins in regulation of liver regenerative growth.
J Biol Chem.
1998;273:30843-30846[Abstract/Free Full Text].
7.
Lekstrom-Himes J, Xanthopoulos KG.
Biological role of CCAAT/enhancer-binding protein family of transcription factors.
J Biol Chem.
1998;273:28545-28548[Abstract/Free Full Text].
8.
Flodby P, Barlow C, Kylefjord H, Ahrlund-Richter L, Xanthopoulos KG.
Increased hepatic cell proliferation and lung abnormalities in mice deficient in CCAAT/enhancer binding protein alpha.
J Biol Chem.
1996;271:24753-24760[Abstract/Free Full Text].
9.
Wang N-D, Finegold MJ, Bradley A, et al.
Impaired energy homeostasis in C/EBP-alpha knockout mice.
Science.
1995;269:1108-1112[Abstract/Free Full Text].
10.
Pabst T, Muller B, Zhang P.
Dominant negative mutations of CEBPA encoding CCAAT/enhancer binding protein- (C/EBP ), in acute myeloid leukemia.
Nat Genet.
2001;27:263-270[CrossRef][Medline]
[Order article via Infotrieve].
11.
Pabst T, Muller B, Harakawa N, Zhang D-E, Tenen D.
AML-ETO down regulates the granulocytic differentiation factor C/EBP in t(8;21) myeloid leukemia.
Nat Med.
2001;7:444-451[CrossRef][Medline]
[Order article via Infotrieve].
12.
Khanna-Gupta A, Zibello TZ, Sun H, Lekstrom-Himes J, Berliner N.
C/EBP mediates myeloid differentiation and is regulated by the CCAAT displacement protein (CDP/cut).
Proc Natl Acad Sci U S A.
2001;98:8000-8005[Abstract/Free Full Text].
13.
Verbeek W, Lekstrom-Himes JA, Park DJ, et al.
Myeloid transcription factor C/EBP is involved in the positive regulation of lactoferrin gene expression in neutrophils.
Blood.
1999;94:3141-3150[Abstract/Free Full Text].
14.
Verbeek W, Gombart A, Chumakov A, Muller C, Friedman A, Koeffler H.
C/EBP directly interacts with the DNA binding domain of c-myb and cooperatively activates transcription of myeloid promoters.
Blood.
1999;93:3327-3337[Abstract/Free Full Text].
15.
Yamanaka R, Barlow C, Lekstrom-Himes J, et al.
Impaired granulopoiesis, myelodysplasia, and early lethality in CCAAT/enhancer binding protein epsilon-deficient mice.
Proc Natl Acad Sci U S A.
1997;94:13187-13192[Abstract/Free Full Text].
16.
Khanna-Gupta A, Zibello TA, Simkevich C, Rosmarin AG, Berliner N.
Sp1 and C/EBP are necessary to activate the lactoferrin gene promoter during myeloid differentiation.
Blood.
2000;95:3734-3741[Abstract/Free Full Text].
17.
Lekstrom-Himes JA, Dorman SE, Kopar P, Holland SM, Gallin JI.
Neutrophil-specific granule deficiency results from a novel mutation with loss of function of the transcription factor CCAAT/enhancer binding protein .
J Exp Med.
1999;189:1847-1852[Abstract/Free Full Text].
18.
Gombart AF, Shiohara M, Kwok SH, Agematsu K, Komiyama A, Koeffler HP.
Neutrophil-specific granule deficiency: homozygous recessive inheritance of a frameshift mutation in the gene encoding transcription factor C/EBP .
Blood.
2000;97:2561-2567.
19.
Tamura A, Agematsu K, Mori T, et al.
A marked decrease in defensin mRNA in the only case of congenital neutrophil-specific granule deficiency reported in Japan.
Int J Hematol.
1994;59:137-142[Medline]
[Order article via Infotrieve].
20.
Rosenberg HF, Gallin JI.
Neutrophil-specific granule deficiency includes eosinophils.
Blood.
1993;82:268-273[Abstract/Free Full Text].
21.
Zhang DE, Hetherington CJ, Meyers S, et al.
CCAAT enhancer-binding protein (C/EBP) and AML1 (CBF alpha2) synergistically activate the macrophage colony-stimulating factor receptor promoter.
Mol Cell Biol.
1996;16:1231-1240[Abstract].
22.
Zhang DE, Hohaus S, Voso MT, et al.
Function of PU.1, C/EBP, and AML1 in early myelopoiesis: regulation of multiple myeloid CSF receptor promoters. In:
Wollf L,Perkins AS, eds.
Current Topics in Microbiology and Immunology. Berlin, Germany: Springer-Verlag; 1996:137-147.
23.
Ford AM, Bennett CA, Healy LE, Towatari M, Greaves MF, Enver T.
Regulation of the myeloperoxidase enhancer binding proteins PU.1, C-EBP , - and - during granulocytic-lineage specification.
Proc Natl Acad Sci U S A.
1996;93:10838-10843[Abstract/Free Full Text].
24.
Oelgeschlager M, Nuchprayoon I, Luscher B, Friedman AD.
C/EBP, c-Myb, and PU.1 cooperate to regulate the neutrophil elastase promoter.
Mol Cell Biol.
1996;16:4714-4725.
25.
Nuchprayoon I, Simkevich CP, Luo M, Friedman AD, Rosmarin AG.
GABP cooperates with c-Myb and C/EBP to activate the neutrophil elastase promoter.
Blood.
1997;89:4546-4554[Abstract/Free Full Text].
26.
Iwama A, Zhang P, Darlington GJ, McKercher SR, Maki R, Tenen DG.
Use of RDA analysis of knockout mice to identify myeloid genes regulated in vivo by PU.1 and C/EBP alpha.
Nucl Acids Res.
1998;26:3034-3043[Abstract/Free Full Text].
27.
Radomska HS, Huettner CS, Zhang P, Cheng T, Scadden DT, Tenen DG.
C/EBP is a regulatory switch sufficient for induction of granulocytic differentiation in bipotential myeloid cells [abstract].
Blood.
1998;90:400a.
28.
Wang Q, Friedman A.
C/EBPs are required for granulopoiesis independent of their induction of the granulocyte-colony stimulating factor receptor.
Blood.
2002;99:2776-2785[Abstract/Free Full Text].
29.
Jones L, Lin M-L, Chen S-S, et al.
Expression of C/EBP from the C/EBP gene locus is sufficient for normal hematopoiesis in vivo.
Blood.
2002;99:2032-2036[Abstract/Free Full Text].
30.
Khanna-Gupta A, Zibello T, Berliner N.
Coordinate regulation of neutrophil secondary granule protein gene expression.
Curr Top Microbiol Immunol.
1996;211:165-171[Medline]
[Order article via Infotrieve].
31.
Berliner N.
Molecular biology of neutrophil differentiation.
Curr Opinion Hematol.
1998;5:49-53[Medline]
[Order article via Infotrieve].
32.
Khanna-Gupta A, Zibello T, Kolla S, Neufeld EJ, Berliner N.
CCAAT displacement protein (CDP/cut) recognizes a silencer element within the lactoferrin gene promoter.
Blood.
1997;90:2784-2795.
33.
Lawson ND, Khanna-Gupta A, Berliner N.
Isolation and characterization of the cDNA for mouse neutrophil collagenase: demonstration of shared negative regulatory pathways for neutrophil secondary granule protein gene expression.
Blood.
1998;91:2517-2524.
34.
Khanna-Gupta A, Kolibaba K, Zibello TA, Berliner N.
NB4 cells show bilineage potential and an aberrant pattern of neutrophil secondary granule protein gene expression.
Blood.
1994;84:294-302[Abstract/Free Full Text].
35.
Lawson N, Krause D, Berliner N.
Normal neutrophil differentiation and secondary granule gene expression in the EML and MPRO cell lines.
J Exp Hematol.
1998;26:1178-1185.
36.
Shi H, Teng CT.
Characterization of a mitogen response unit in the mouse lactoferrin gene promoter.
J Biol Chem.
1994;269:12973-12980[Abstract/Free Full Text].
37.
Skalnik DG, Strauss EC, Orkin SH.
CCAAT displacement protein as a repressor of the myelomonocytic-specific gp91-phox gene promoter.
J Biol Chem.
1991;266:16736-16744[Abstract/Free Full Text].
38.
Tsutsumi-Ishii Y, Hasebe T, Nagaoka I.
Role of CCAAT/Enhancer binding protein site in transcription of human neutrophil peptide-1 and 3 defensin genes.
J Immunol.
2000;164:3264-3273[Abstract/Free Full Text].
39.
Johnston JJ, Boxer LA, Berliner N.
Correlation of messenger RNA levels with protein defects in specific granule deficiency.
Blood.
1992;80:2088-2091[Abstract/Free Full Text].
40.
Boyd K, Farnham P.
Coexamination of site-specific transcription factor binding and promoter activity in living cells.
Mol Cell Biol.
1999;19:8393-8399[Abstract/Free Full Text].
41.
Wells J, Graveel C, Bartley S, Madore S, Farnham P.
The identification of E2F-1-specific target genes.
Proc Natl Acad Sci U S A.
2002;99:3890-3895[Abstract/Free Full Text].
42.
Shang Y, Brown M.
Molecular determinants for tissue specificity of SERMs.
Science.
2002;295:2465-2468[Abstract/Free Full Text].
43.
Lawson ND, Krause DS, Berliner N.
Normal neutrophil differentiation and secondary granule gene expression in the EML and MPRO cell lines.
Exp Hematol.
1998;26:1178-1185[Medline]
[Order article via Infotrieve].
44.
Tsai S, Collins SJ.
A dominant negative retinoic acid receptor blocks neutrophil differentiation at the promyelocyte stage.
Proc Natl Acad Sci U S A.
1993;90:7153-7157[Abstract/Free Full Text].
45.
Lanotte M, Martin-Thouvenin V, Najman S, Balerini P, Valensi F, Berger R.
NB4, a maturation inducible cell line with t(15;17) marker isolated from a human acute promyelocytic leukemia (M3).
Blood.
1991;5:1080-1086.
46.
Park DJ, Chumakov AM, Vuong PT, et al.
CCAAT/enhancer binding protein is a potential target gene in acute promyelocytic leukemia treatment.
J Clin Invest.
1999;103:1399-1408[Medline]
[Order article via Infotrieve].
47.
Rice W, Ganz T, Kinkade J, Selsted M, Lehrer R, Parmley R.
Defensin-rich dense granules of human neutrophils.
Blood.
1987;70:757-765[Abstract/Free Full Text].
48.
Tenen D.
Abnormalities of C/EBP alpha transcription factor: a major target in acute myeloid leukemia.
Leukemia.
2001;15:688-689[CrossRef][Medline]
[Order article via Infotrieve].
49.
Berliner N, Hsing A, Graubert T, et al.
Granulocyte colony-stimulating factor induction of normal human bone marrow progenitors results in neutrophil-specific gene expression.
Blood.
1995;85:799-803[Abstract/Free Full Text].
50.
Blochlinger K, Bodmer R, Jack J, Jan LY, Jan YN.
Primary structure and expression of a product from Cut, a locus involved in specifying sensory organ identity in Drosophila melanogaster.
Nature.
1988;333:629-635[CrossRef][Medline]
[Order article via Infotrieve].
51.
Blochlinger K, Jan LY, Jan YN.
Transformation of sensory organ identity by ectopic expression of Cut in Drosophila.
Genes Dev.
1991;5:1124-1135[Abstract/Free Full Text].
52.
Anders V, Nadal-Ginard B, Mahdavi V.
Clox, a mammalian homeobox gene related to Drosophila cut, encodes DNA-binding regulatory proteins differentially expressed during development.
Development.
1992;116:321-334[Medline]
[Order article via Infotrieve].
53.
Neufeld EJ, Skalnik DG, Lievens PM, Orkin SH.
Human CCAAT displacement protein is homologous to the Drosophila homeoprotein, cut.
Nat Genetics.
1992;1:50-55[CrossRef][Medline]
[Order article via Infotrieve].
54.
Lievens PM, Donady JJ, Tufarelli C, Neufeld EJ.
Repressor activity of CCAAT displacement protein in HL-60 myeloid leukemia cells.
J Biol Chem.
1995;270:12745-12750[Abstract/Free Full Text].
55.
Mailly F, Berube G, Harada R, Mao PL, Nepveu A.
The human Cut homeodomain protein can repress gene expression by two distinct mechanisms: active repression and competition for binding site occupancy.
Mol Cell Biol.
1996;16:5346-5357[Abstract].
56.
Croqueret O, Berube G, Nepveu A.
The mammalian cut homeodomain protein functions as cell-cycle-dependent transcriptional repressor which down modulated p21WAF-1/CIP1/SDI1 in S phase.
EMBO J.
1998;17:4680-4694[CrossRef][Medline]
[Order article via Infotrieve].
57.
Luo W, Sklanik DG.
CCAAT displacement protein competes with multiple transcriptional activators for binding to four sites in the proximal gp91phox promoter.
J Biol Chem.
1996;271:18203-18210[Abstract/Free Full Text].
58.
Kuo M, Allis C.
In vivo cross-linking and immunoprecipitation for studying dynamic protein:DNA associations in a chromatin environment.
Methods.
1999;19:425-433[CrossRef][Medline]
[Order article via Infotrieve].
59.
Nerlov C, Ziff E.
Three levels of functional interaction determine the activity of CCAAT/enhancer binding protein-alpha on the serum albumin promoter.
Genes Dev.
1994;8:350-362[Abstract/Free Full Text].
60.
Porse B, Pedersen T, Xu X, et al.
E2F repression by C/EBP is required for adipogenesis and granulopoiesis.
Cell.
2001;107:247-258[CrossRef][Medline]
[Order article via Infotrieve].
61.
Nepveu A.
Role of the multifunctional CDP/cut/cux homeodomain transcription factor in regulating differentiation, cell growth and development.
Gene.
2001;270:1-15[CrossRef][Medline]
[Order article via Infotrieve].
62.
Li S, Aufiero B, Schiltz RL, Walsh MJ.
Regulation of the homeoprotein CCAAT displacement/cut protein function by histone acetyltransferases p300/CREB-binding protein (CBP)-associated factor and CBP.
Proc Natl Acad Sci U S A.
2000;97:7166-7171[Abstract/Free Full Text].

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
M. Moriuchi and H. Moriuchi
Induction of Lactoferrin Gene Expression in Myeloid or Mammary Gland Cells by Human T-Cell Leukemia Virus Type 1 (HTLV-1) Tax: Implications for Milk-Borne Transmission of HTLV-1
J. Virol.,
July 15, 2006;
80(14):
7118 - 7126.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Khanna-Gupta, H. Sun, T. Zibello, L. Lozovatsky, P. K. Ghosh, D. C. Link, M. L. McLemore, and N. Berliner
p120 nucleolar-proliferating antigen is a direct target of G-CSF signaling during myeloid differentiation
J. Leukoc. Biol.,
May 1, 2006;
79(5):
1011 - 1021.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. F. Gombart, U. Krug, J. O'Kelly, E. An, V. Vegesna, and H. P. Koeffler
Aberrant expression of neutrophil and macrophage-related genes in a murine model for human neutrophil-specific granule deficiency
J. Leukoc. Biol.,
November 1, 2005;
78(5):
1153 - 1165.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. J. Krupp, L. E. Yaich, R. J. Wessells, and R. Bodmer
Identification of Genetic Loci That Interact With cut During Drosophila Wing-Margin Development
Genetics,
August 1, 2005;
170(4):
1775 - 1795.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Dong, S. Fujii, H. Li, H. Nakabayashi, M. Sakai, S. Nishi, D. Goto, T. Furumoto, S. Imagawa, T. A.K.M. Zaman, et al.
Interleukin-6 and Mevastatin Regulate Plasminogen Activator Inhibitor-1 Through CCAAT/Enhancer-Binding Protein-{delta}
Arterioscler Thromb Vasc Biol,
May 1, 2005;
25(5):
1078 - 1084.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q. Zhu, U. Maitra, D. Johnston, M. Lozano, and J. P. Dudley
The Homeodomain Protein CDP Regulates Mammary-Specific Gene Transcription and Tumorigenesis
Mol. Cell. Biol.,
June 1, 2004;
24(11):
4810 - 4823.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. A. Maun, P. Gaines, A. Khanna-Gupta, T. Zibello, L. Enriquez, L. Goldberg, and N. Berliner
G-CSF signaling can differentiate promyelocytes expressing a defective retinoic acid receptor: evidence for divergent pathways regulating neutrophil differentiation
Blood,
March 1, 2004;
103(5):
1693 - 1701.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|